ID: 1129473656

View in Genome Browser
Species Human (GRCh38)
Location 15:75768763-75768785
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129473656_1129473670 14 Left 1129473656 15:75768763-75768785 CCCTCGGCCTAGTGGCCCTGCCC No data
Right 1129473670 15:75768800-75768822 AAGATGACTTCCTAGGAGCCAGG No data
1129473656_1129473671 19 Left 1129473656 15:75768763-75768785 CCCTCGGCCTAGTGGCCCTGCCC No data
Right 1129473671 15:75768805-75768827 GACTTCCTAGGAGCCAGGCATGG No data
1129473656_1129473672 22 Left 1129473656 15:75768763-75768785 CCCTCGGCCTAGTGGCCCTGCCC No data
Right 1129473672 15:75768808-75768830 TTCCTAGGAGCCAGGCATGGAGG No data
1129473656_1129473668 7 Left 1129473656 15:75768763-75768785 CCCTCGGCCTAGTGGCCCTGCCC No data
Right 1129473668 15:75768793-75768815 TGGGGCCAAGATGACTTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129473656 Original CRISPR GGGCAGGGCCACTAGGCCGA GGG (reversed) Intergenic
No off target data available for this crispr