ID: 1129473664

View in Genome Browser
Species Human (GRCh38)
Location 15:75768783-75768805
Sequence CATCTTGGCCCCAGTGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129473664_1129473672 2 Left 1129473664 15:75768783-75768805 CCCAACCCACTGGGGCCAAGATG No data
Right 1129473672 15:75768808-75768830 TTCCTAGGAGCCAGGCATGGAGG No data
1129473664_1129473670 -6 Left 1129473664 15:75768783-75768805 CCCAACCCACTGGGGCCAAGATG No data
Right 1129473670 15:75768800-75768822 AAGATGACTTCCTAGGAGCCAGG No data
1129473664_1129473671 -1 Left 1129473664 15:75768783-75768805 CCCAACCCACTGGGGCCAAGATG No data
Right 1129473671 15:75768805-75768827 GACTTCCTAGGAGCCAGGCATGG No data
1129473664_1129473675 24 Left 1129473664 15:75768783-75768805 CCCAACCCACTGGGGCCAAGATG No data
Right 1129473675 15:75768830-75768852 GCCAGCATGCACCTGAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129473664 Original CRISPR CATCTTGGCCCCAGTGGGTT GGG (reversed) Intergenic