ID: 1129473670

View in Genome Browser
Species Human (GRCh38)
Location 15:75768800-75768822
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129473658_1129473670 7 Left 1129473658 15:75768770-75768792 CCTAGTGGCCCTGCCCAACCCAC No data
Right 1129473670 15:75768800-75768822 AAGATGACTTCCTAGGAGCCAGG No data
1129473656_1129473670 14 Left 1129473656 15:75768763-75768785 CCCTCGGCCTAGTGGCCCTGCCC No data
Right 1129473670 15:75768800-75768822 AAGATGACTTCCTAGGAGCCAGG No data
1129473657_1129473670 13 Left 1129473657 15:75768764-75768786 CCTCGGCCTAGTGGCCCTGCCCA No data
Right 1129473670 15:75768800-75768822 AAGATGACTTCCTAGGAGCCAGG No data
1129473664_1129473670 -6 Left 1129473664 15:75768783-75768805 CCCAACCCACTGGGGCCAAGATG No data
Right 1129473670 15:75768800-75768822 AAGATGACTTCCTAGGAGCCAGG No data
1129473662_1129473670 -1 Left 1129473662 15:75768778-75768800 CCCTGCCCAACCCACTGGGGCCA No data
Right 1129473670 15:75768800-75768822 AAGATGACTTCCTAGGAGCCAGG No data
1129473663_1129473670 -2 Left 1129473663 15:75768779-75768801 CCTGCCCAACCCACTGGGGCCAA No data
Right 1129473670 15:75768800-75768822 AAGATGACTTCCTAGGAGCCAGG No data
1129473665_1129473670 -7 Left 1129473665 15:75768784-75768806 CCAACCCACTGGGGCCAAGATGA No data
Right 1129473670 15:75768800-75768822 AAGATGACTTCCTAGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129473670 Original CRISPR AAGATGACTTCCTAGGAGCC AGG Intergenic