ID: 1129473672

View in Genome Browser
Species Human (GRCh38)
Location 15:75768808-75768830
Sequence TTCCTAGGAGCCAGGCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129473658_1129473672 15 Left 1129473658 15:75768770-75768792 CCTAGTGGCCCTGCCCAACCCAC No data
Right 1129473672 15:75768808-75768830 TTCCTAGGAGCCAGGCATGGAGG No data
1129473663_1129473672 6 Left 1129473663 15:75768779-75768801 CCTGCCCAACCCACTGGGGCCAA No data
Right 1129473672 15:75768808-75768830 TTCCTAGGAGCCAGGCATGGAGG No data
1129473667_1129473672 -4 Left 1129473667 15:75768789-75768811 CCACTGGGGCCAAGATGACTTCC No data
Right 1129473672 15:75768808-75768830 TTCCTAGGAGCCAGGCATGGAGG No data
1129473657_1129473672 21 Left 1129473657 15:75768764-75768786 CCTCGGCCTAGTGGCCCTGCCCA No data
Right 1129473672 15:75768808-75768830 TTCCTAGGAGCCAGGCATGGAGG No data
1129473666_1129473672 -3 Left 1129473666 15:75768788-75768810 CCCACTGGGGCCAAGATGACTTC No data
Right 1129473672 15:75768808-75768830 TTCCTAGGAGCCAGGCATGGAGG No data
1129473656_1129473672 22 Left 1129473656 15:75768763-75768785 CCCTCGGCCTAGTGGCCCTGCCC No data
Right 1129473672 15:75768808-75768830 TTCCTAGGAGCCAGGCATGGAGG No data
1129473664_1129473672 2 Left 1129473664 15:75768783-75768805 CCCAACCCACTGGGGCCAAGATG No data
Right 1129473672 15:75768808-75768830 TTCCTAGGAGCCAGGCATGGAGG No data
1129473665_1129473672 1 Left 1129473665 15:75768784-75768806 CCAACCCACTGGGGCCAAGATGA No data
Right 1129473672 15:75768808-75768830 TTCCTAGGAGCCAGGCATGGAGG No data
1129473662_1129473672 7 Left 1129473662 15:75768778-75768800 CCCTGCCCAACCCACTGGGGCCA No data
Right 1129473672 15:75768808-75768830 TTCCTAGGAGCCAGGCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129473672 Original CRISPR TTCCTAGGAGCCAGGCATGG AGG Intergenic
No off target data available for this crispr