ID: 1129473675

View in Genome Browser
Species Human (GRCh38)
Location 15:75768830-75768852
Sequence GCCAGCATGCACCTGAACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129473663_1129473675 28 Left 1129473663 15:75768779-75768801 CCTGCCCAACCCACTGGGGCCAA No data
Right 1129473675 15:75768830-75768852 GCCAGCATGCACCTGAACTGAGG No data
1129473673_1129473675 -3 Left 1129473673 15:75768810-75768832 CCTAGGAGCCAGGCATGGAGGCC No data
Right 1129473675 15:75768830-75768852 GCCAGCATGCACCTGAACTGAGG No data
1129473669_1129473675 9 Left 1129473669 15:75768798-75768820 CCAAGATGACTTCCTAGGAGCCA No data
Right 1129473675 15:75768830-75768852 GCCAGCATGCACCTGAACTGAGG No data
1129473664_1129473675 24 Left 1129473664 15:75768783-75768805 CCCAACCCACTGGGGCCAAGATG No data
Right 1129473675 15:75768830-75768852 GCCAGCATGCACCTGAACTGAGG No data
1129473666_1129473675 19 Left 1129473666 15:75768788-75768810 CCCACTGGGGCCAAGATGACTTC No data
Right 1129473675 15:75768830-75768852 GCCAGCATGCACCTGAACTGAGG No data
1129473665_1129473675 23 Left 1129473665 15:75768784-75768806 CCAACCCACTGGGGCCAAGATGA No data
Right 1129473675 15:75768830-75768852 GCCAGCATGCACCTGAACTGAGG No data
1129473667_1129473675 18 Left 1129473667 15:75768789-75768811 CCACTGGGGCCAAGATGACTTCC No data
Right 1129473675 15:75768830-75768852 GCCAGCATGCACCTGAACTGAGG No data
1129473662_1129473675 29 Left 1129473662 15:75768778-75768800 CCCTGCCCAACCCACTGGGGCCA No data
Right 1129473675 15:75768830-75768852 GCCAGCATGCACCTGAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129473675 Original CRISPR GCCAGCATGCACCTGAACTG AGG Intergenic
No off target data available for this crispr