ID: 1129476319

View in Genome Browser
Species Human (GRCh38)
Location 15:75786534-75786556
Sequence GCTGCTGGAGCTGCAGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129476310_1129476319 14 Left 1129476310 15:75786497-75786519 CCGGTGTGGCGGCTGAGCACCCC No data
Right 1129476319 15:75786534-75786556 GCTGCTGGAGCTGCAGGAGCTGG No data
1129476309_1129476319 20 Left 1129476309 15:75786491-75786513 CCGGCTCCGGTGTGGCGGCTGAG No data
Right 1129476319 15:75786534-75786556 GCTGCTGGAGCTGCAGGAGCTGG No data
1129476316_1129476319 -10 Left 1129476316 15:75786521-75786543 CCCTTCAGGTGAAGCTGCTGGAG No data
Right 1129476319 15:75786534-75786556 GCTGCTGGAGCTGCAGGAGCTGG No data
1129476313_1129476319 -6 Left 1129476313 15:75786517-75786539 CCCTCCCTTCAGGTGAAGCTGCT No data
Right 1129476319 15:75786534-75786556 GCTGCTGGAGCTGCAGGAGCTGG No data
1129476312_1129476319 -5 Left 1129476312 15:75786516-75786538 CCCCTCCCTTCAGGTGAAGCTGC No data
Right 1129476319 15:75786534-75786556 GCTGCTGGAGCTGCAGGAGCTGG No data
1129476314_1129476319 -7 Left 1129476314 15:75786518-75786540 CCTCCCTTCAGGTGAAGCTGCTG No data
Right 1129476319 15:75786534-75786556 GCTGCTGGAGCTGCAGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129476319 Original CRISPR GCTGCTGGAGCTGCAGGAGC TGG Intergenic
No off target data available for this crispr