ID: 1129478174

View in Genome Browser
Species Human (GRCh38)
Location 15:75801805-75801827
Sequence ATGCGAAAACAGATGTTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129478172_1129478174 15 Left 1129478172 15:75801767-75801789 CCTTTGGGGTGGGTTCAGAGAGC No data
Right 1129478174 15:75801805-75801827 ATGCGAAAACAGATGTTGCATGG No data
1129478173_1129478174 -7 Left 1129478173 15:75801789-75801811 CCTGTTCAGACTCAAGATGCGAA No data
Right 1129478174 15:75801805-75801827 ATGCGAAAACAGATGTTGCATGG No data
1129478171_1129478174 19 Left 1129478171 15:75801763-75801785 CCAGCCTTTGGGGTGGGTTCAGA No data
Right 1129478174 15:75801805-75801827 ATGCGAAAACAGATGTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129478174 Original CRISPR ATGCGAAAACAGATGTTGCA TGG Intergenic
No off target data available for this crispr