ID: 1129478348

View in Genome Browser
Species Human (GRCh38)
Location 15:75803040-75803062
Sequence ACGTGGGGCCTTGTGTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129478344_1129478348 10 Left 1129478344 15:75803007-75803029 CCAAGTGCAATTTGTCTGATAAA No data
Right 1129478348 15:75803040-75803062 ACGTGGGGCCTTGTGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129478348 Original CRISPR ACGTGGGGCCTTGTGTGTCC TGG Intergenic
No off target data available for this crispr