ID: 1129479002

View in Genome Browser
Species Human (GRCh38)
Location 15:75808233-75808255
Sequence GGGGCTGGAGGGAGACCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129479002_1129479013 24 Left 1129479002 15:75808233-75808255 CCATGAGGTCTCCCTCCAGCCCC No data
Right 1129479013 15:75808280-75808302 ACGCTCAGTAGGTCAGAGTGAGG No data
1129479002_1129479005 -9 Left 1129479002 15:75808233-75808255 CCATGAGGTCTCCCTCCAGCCCC No data
Right 1129479005 15:75808247-75808269 TCCAGCCCCGACTGTGAGCAAGG No data
1129479002_1129479012 13 Left 1129479002 15:75808233-75808255 CCATGAGGTCTCCCTCCAGCCCC No data
Right 1129479012 15:75808269-75808291 GCTGGGCTCATACGCTCAGTAGG No data
1129479002_1129479007 -5 Left 1129479002 15:75808233-75808255 CCATGAGGTCTCCCTCCAGCCCC No data
Right 1129479007 15:75808251-75808273 GCCCCGACTGTGAGCAAGGCTGG No data
1129479002_1129479014 25 Left 1129479002 15:75808233-75808255 CCATGAGGTCTCCCTCCAGCCCC No data
Right 1129479014 15:75808281-75808303 CGCTCAGTAGGTCAGAGTGAGGG No data
1129479002_1129479009 -4 Left 1129479002 15:75808233-75808255 CCATGAGGTCTCCCTCCAGCCCC No data
Right 1129479009 15:75808252-75808274 CCCCGACTGTGAGCAAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129479002 Original CRISPR GGGGCTGGAGGGAGACCTCA TGG (reversed) Intergenic
No off target data available for this crispr