ID: 1129479009

View in Genome Browser
Species Human (GRCh38)
Location 15:75808252-75808274
Sequence CCCCGACTGTGAGCAAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129479002_1129479009 -4 Left 1129479002 15:75808233-75808255 CCATGAGGTCTCCCTCCAGCCCC No data
Right 1129479009 15:75808252-75808274 CCCCGACTGTGAGCAAGGCTGGG No data
1129479001_1129479009 -1 Left 1129479001 15:75808230-75808252 CCTCCATGAGGTCTCCCTCCAGC No data
Right 1129479009 15:75808252-75808274 CCCCGACTGTGAGCAAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129479009 Original CRISPR CCCCGACTGTGAGCAAGGCT GGG Intergenic
No off target data available for this crispr