ID: 1129479014

View in Genome Browser
Species Human (GRCh38)
Location 15:75808281-75808303
Sequence CGCTCAGTAGGTCAGAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129479001_1129479014 28 Left 1129479001 15:75808230-75808252 CCTCCATGAGGTCTCCCTCCAGC No data
Right 1129479014 15:75808281-75808303 CGCTCAGTAGGTCAGAGTGAGGG No data
1129479006_1129479014 10 Left 1129479006 15:75808248-75808270 CCAGCCCCGACTGTGAGCAAGGC No data
Right 1129479014 15:75808281-75808303 CGCTCAGTAGGTCAGAGTGAGGG No data
1129479011_1129479014 4 Left 1129479011 15:75808254-75808276 CCGACTGTGAGCAAGGCTGGGCT No data
Right 1129479014 15:75808281-75808303 CGCTCAGTAGGTCAGAGTGAGGG No data
1129479003_1129479014 14 Left 1129479003 15:75808244-75808266 CCCTCCAGCCCCGACTGTGAGCA No data
Right 1129479014 15:75808281-75808303 CGCTCAGTAGGTCAGAGTGAGGG No data
1129479010_1129479014 5 Left 1129479010 15:75808253-75808275 CCCGACTGTGAGCAAGGCTGGGC No data
Right 1129479014 15:75808281-75808303 CGCTCAGTAGGTCAGAGTGAGGG No data
1129479004_1129479014 13 Left 1129479004 15:75808245-75808267 CCTCCAGCCCCGACTGTGAGCAA No data
Right 1129479014 15:75808281-75808303 CGCTCAGTAGGTCAGAGTGAGGG No data
1129479008_1129479014 6 Left 1129479008 15:75808252-75808274 CCCCGACTGTGAGCAAGGCTGGG No data
Right 1129479014 15:75808281-75808303 CGCTCAGTAGGTCAGAGTGAGGG No data
1129479002_1129479014 25 Left 1129479002 15:75808233-75808255 CCATGAGGTCTCCCTCCAGCCCC No data
Right 1129479014 15:75808281-75808303 CGCTCAGTAGGTCAGAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129479014 Original CRISPR CGCTCAGTAGGTCAGAGTGA GGG Intergenic
No off target data available for this crispr