ID: 1129479364

View in Genome Browser
Species Human (GRCh38)
Location 15:75810822-75810844
Sequence CAAGAGAGGGAGACTGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129479364_1129479368 -2 Left 1129479364 15:75810822-75810844 CCCAGCACAGTCTCCCTCTCTTG No data
Right 1129479368 15:75810843-75810865 TGTGCCCCATTTCCACCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129479364 Original CRISPR CAAGAGAGGGAGACTGTGCT GGG (reversed) Intergenic
No off target data available for this crispr