ID: 1129484867

View in Genome Browser
Species Human (GRCh38)
Location 15:75860997-75861019
Sequence ATCTTTGTTCTGCTACTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 1, 2: 8, 3: 63, 4: 391}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129484865_1129484867 -3 Left 1129484865 15:75860977-75860999 CCAGACCGTGATAGGTTTGAATC 0: 1
1: 0
2: 1
3: 4
4: 48
Right 1129484867 15:75860997-75861019 ATCTTTGTTCTGCTACTTACTGG 0: 1
1: 1
2: 8
3: 63
4: 391
1129484866_1129484867 -8 Left 1129484866 15:75860982-75861004 CCGTGATAGGTTTGAATCTTTGT 0: 1
1: 0
2: 3
3: 16
4: 209
Right 1129484867 15:75860997-75861019 ATCTTTGTTCTGCTACTTACTGG 0: 1
1: 1
2: 8
3: 63
4: 391
1129484863_1129484867 17 Left 1129484863 15:75860957-75860979 CCAGTGTTTGGTTTTTGGAGCCA 0: 1
1: 5
2: 4
3: 19
4: 231
Right 1129484867 15:75860997-75861019 ATCTTTGTTCTGCTACTTACTGG 0: 1
1: 1
2: 8
3: 63
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129484867 Original CRISPR ATCTTTGTTCTGCTACTTAC TGG Intronic
901518813 1:9768087-9768109 ATCGTAGCTCTGCTACTTATTGG - Intronic
902154412 1:14472582-14472604 TTCTGTTTTCTGCTACTTCCAGG - Intergenic
902408867 1:16201459-16201481 GTCTCGGCTCTGCTACTTACTGG + Intronic
902743545 1:18457524-18457546 ATCTTGGTTTTGCCACTTTCAGG + Intergenic
903102977 1:21049200-21049222 CTCTTTGTTCTGGAACTTGCTGG - Intronic
903630881 1:24769479-24769501 ATCACAGTACTGCTACTTACTGG - Intronic
904291637 1:29489844-29489866 ATCCCAGTTCTGCCACTTACTGG + Intergenic
904608605 1:31712878-31712900 ATCCTGGCTCTGCTACTTCCTGG + Intergenic
904894489 1:33803997-33804019 ATCCCAGTTCTGCCACTTACTGG + Intronic
905779557 1:40695979-40696001 ATCTGGGCTCTGCTACTTACTGG - Intronic
906477380 1:46178774-46178796 ATCCTGGCTCTGCCACTTACAGG + Intronic
906912782 1:49973016-49973038 GTCTTGGTTCTGCCACTTAATGG - Intronic
907034369 1:51203166-51203188 ATCTTGGCTCTGTTACTTAATGG + Intergenic
907173290 1:52492596-52492618 ATTTTAGTTCTGCCACTTACTGG - Intronic
907391519 1:54161346-54161368 ATCCTGGTTCTGCCACTTAGAGG - Intronic
907759600 1:57344145-57344167 AACTTGGTTCTGCCATTTACTGG - Intronic
907840248 1:58150179-58150201 ATCTTGGCTCTGCAACTTCCTGG - Intronic
908124712 1:61018864-61018886 ATCCTGGTTCTGCCACTTACTGG - Intronic
908816717 1:68042724-68042746 ATCCTGGCTCTGCTACTTACCGG + Intergenic
909202130 1:72704041-72704063 CTCTTGATTCTGCCACTTACTGG + Intergenic
909265561 1:73553516-73553538 TTCCTTGTTCTTCAACTTACAGG + Intergenic
909888721 1:80975568-80975590 ATTTTTGTTCTGCTACTTTAAGG - Intergenic
910113514 1:83707078-83707100 ATTTTTGTGCTGCTACATGCTGG + Intergenic
910752613 1:90650335-90650357 AGCTTTGTTTTTCTATTTACTGG - Intergenic
912248339 1:107984584-107984606 ATGCCTGTACTGCTACTTACTGG - Intergenic
912390608 1:109300143-109300165 ATCCTTGTTCTGGTGCTTACAGG - Intronic
913364909 1:118026709-118026731 ATCTTCCTTCTCTTACTTACTGG - Intronic
913706536 1:121429888-121429910 ATCTTATTTCTGGTACCTACAGG + Intergenic
915169227 1:153966306-153966328 ATCTTGGTTCAGCTACTTACAGG + Intronic
915767328 1:158376151-158376173 ATTTTTGTTCTGCTAATTTGGGG - Intergenic
915767529 1:158379321-158379343 ATTTTTGTTCTGCTAATTTAGGG - Intergenic
916185667 1:162130282-162130304 ATCCTAGTTCTGCCACTTACAGG - Intronic
916292465 1:163181550-163181572 TTCTTTGCTCTGTAACTTACTGG - Intronic
916382267 1:164225296-164225318 ATCTCAGTTCTGCCACTTAATGG + Intergenic
916506030 1:165428966-165428988 ATCTATATTCTTCTTCTTACAGG - Exonic
917626312 1:176850070-176850092 ATCCTGGCTCTGCCACTTACTGG - Intergenic
918984448 1:191605696-191605718 ATCCTGGCTTTGCTACTTACTGG + Intergenic
919094224 1:193010466-193010488 ATCCTAGATCTACTACTTACTGG + Intergenic
919168945 1:193929677-193929699 ATCTTTGATCAGCTTTTTACTGG - Intergenic
919395354 1:197040033-197040055 ATATATCCTCTGCTACTTACAGG - Intronic
919572394 1:199265039-199265061 ATCCTGGTTCTACCACTTACTGG + Intergenic
921544449 1:216457664-216457686 ATCTTAGTTCTACCATTTACTGG + Intergenic
921986238 1:221315978-221316000 ATTTGTGTTCTGTCACTTACAGG + Intergenic
922130151 1:222769689-222769711 ATCTTAGATCTGCCACTTGCTGG - Intergenic
922967121 1:229699605-229699627 ATCCTTGCTTTGCTACTTACTGG + Intergenic
1063873544 10:10446281-10446303 ATCTGGGCTCTGCTACTGACAGG - Intergenic
1064391671 10:14947534-14947556 ATCCTGGTCCTGCCACTTACTGG + Intronic
1064493283 10:15883026-15883048 ATCTTTCTTCTGATTCTTAAAGG - Intergenic
1065313930 10:24443322-24443344 ATCTCTGTTCTGCTACTCTCTGG - Intronic
1065412701 10:25447353-25447375 ATATTGGCTCTGCCACTTACTGG - Intronic
1068718187 10:60211419-60211441 ATCCTTGTTCTGCCACTAATTGG + Intronic
1068842510 10:61631185-61631207 ATCCTTCCTCTGCCACTTACTGG + Intergenic
1068937624 10:62651305-62651327 ATCTTTGTTCTGGTAATCAATGG + Intronic
1069883970 10:71611665-71611687 ATCATGGGTCTGCTACTTACTGG - Intronic
1069954716 10:72042891-72042913 ATCTTTGTTTTGCTTGTTGCTGG - Intergenic
1070485047 10:76922296-76922318 ATCCTGGTTCTGCTGCTAACTGG - Intronic
1070973071 10:80583355-80583377 GTCTTTTTTCTTCTACTTCCTGG - Intronic
1071112634 10:82177872-82177894 ATATTTTTTCTTCTCCTTACTGG - Intronic
1071511099 10:86263021-86263043 ATCTTTGTTCTGCGAGTGAAGGG + Intronic
1072910717 10:99498395-99498417 ATCTCAGTTCTACCACTTACTGG - Intergenic
1072959427 10:99915861-99915883 ATCTCAGCTCTTCTACTTACTGG - Intronic
1073157124 10:101355990-101356012 ATTTTTGTTTTCCTACTTAGAGG + Intronic
1074788434 10:116862777-116862799 ATCATGGTTGTTCTACTTACAGG + Exonic
1074893901 10:117758144-117758166 ATCCTGGTTCTGCCACCTACTGG + Intergenic
1074987162 10:118668730-118668752 ATCGTGGTTCTGCCACCTACTGG + Intergenic
1075422522 10:122312784-122312806 TTCTATGTTCTGCTACGTTCTGG + Intronic
1079099220 11:17530400-17530422 ATCCTGGCTCTGCCACTTACTGG + Intronic
1079305532 11:19317993-19318015 ATCCTAGCTCTGCCACTTACTGG + Intergenic
1079475819 11:20828084-20828106 ATCTTGGATCTACCACTTACTGG + Intronic
1079671768 11:23179751-23179773 AGCTTTGTTCTGCAACATGCTGG + Intergenic
1080088139 11:28311164-28311186 ATCATTGTTTTGCTACTTAATGG + Intronic
1080205123 11:29719906-29719928 ATCTTTTTTCTTCTGCTAACTGG + Intergenic
1080267983 11:30421647-30421669 ATCTTGGCTCTACTACTTACTGG - Intronic
1081490705 11:43566369-43566391 CTCTGTGTTCACCTACTTACAGG - Intronic
1081912905 11:46711579-46711601 GTCCTGGTTCTGCTACTGACTGG - Intergenic
1082027163 11:47581101-47581123 ATCTTGGTTCTGCCACTAAATGG + Intronic
1083031218 11:59594255-59594277 ATATCTGTTCTTCTCCTTACAGG - Exonic
1083295807 11:61715092-61715114 GTCTTGGCTCTGCCACTTACTGG - Intronic
1083676806 11:64330578-64330600 ATCTTGGCTCTGCCACTTCCTGG + Intergenic
1083830203 11:65226600-65226622 ATCTCAGCTCTGCCACTTACTGG + Intergenic
1085299996 11:75452266-75452288 ATCCTGGCTCTGCTACCTACTGG + Intronic
1085718983 11:78896793-78896815 ACCCTGGTTCTGCCACTTACTGG + Intronic
1085825138 11:79839376-79839398 AACTTTGTTCTTCTAATTATAGG + Intergenic
1085826828 11:79857029-79857051 ATTTTGGTTCTTCGACTTACTGG - Intergenic
1085960947 11:81461300-81461322 TTCTGGGTTCTGCTACTTGCTGG + Intergenic
1086248169 11:84780452-84780474 ATCTTTGTTCCAGTTCTTACAGG - Intronic
1086430038 11:86727733-86727755 ATCTATGCTTTGCTGCTTACTGG + Intergenic
1086465294 11:87046891-87046913 ATCTCAGTCCTGCCACTTACTGG + Intronic
1086556530 11:88117685-88117707 ATCTTAGTTCCCCTACTTTCTGG + Intronic
1087143200 11:94786969-94786991 ATCTTATTTCTGCTAGTAACTGG + Intronic
1087301911 11:96446026-96446048 TTCTTTGTTCTGGTTCTCACAGG + Intronic
1088111088 11:106262516-106262538 GTCTTGGCTCTGTTACTTACTGG - Intergenic
1088699379 11:112398333-112398355 CTCTTGGTTCTGCTGCTTATTGG + Intergenic
1088917239 11:114236983-114237005 GTCTTTGGGCTGCTACTTTCTGG - Intronic
1089372372 11:117970590-117970612 ATCTCACTTCTGCTACTTACTGG - Intergenic
1089488126 11:118862961-118862983 ATCCCAGTTCTGCTACTTATTGG + Intergenic
1090917938 11:131182813-131182835 ATCCCAGCTCTGCTACTTACTGG + Intergenic
1092119292 12:6032672-6032694 ATCTTGATTCTGCCACTTATTGG + Intronic
1092158443 12:6300826-6300848 ATCTTGGTTTTGCTGCTTATGGG - Intergenic
1093987782 12:25556387-25556409 ATCTTGGCTCTGCCATTTACTGG - Intronic
1094008692 12:25783738-25783760 ATCATCGTTCCACTACTTACAGG - Intergenic
1094464597 12:30738372-30738394 ATCTTGGCTCTACCACTTACTGG + Intronic
1094531032 12:31275131-31275153 ATCCTGGTTTTGCTACTTACTGG - Intergenic
1094764963 12:33583839-33583861 ATACAAGTTCTGCTACTTACTGG - Intergenic
1094784527 12:33831004-33831026 GTATTTGTATTGCTACTTACAGG - Intergenic
1097262996 12:57729963-57729985 ATCCTGGTTCTGCCACTTACTGG + Intronic
1097535595 12:60866170-60866192 ATCCTTGTTCTTCTAGTCACTGG + Intergenic
1097578499 12:61424626-61424648 ATTTAGGCTCTGCTACTTACTGG - Intergenic
1097630045 12:62049825-62049847 ATCTTTGTTCTGCAATTTCTTGG - Intronic
1098234297 12:68403686-68403708 ATCCTTGCTCTGTCACTTACTGG - Intergenic
1099174076 12:79400588-79400610 ATTTCTGTCCTGCTACTTTCTGG - Intronic
1099317401 12:81101834-81101856 ATCTTTTTTTTTATACTTACTGG + Intronic
1100366933 12:93930272-93930294 ATCTTGGTTCTGCCACTTCTTGG - Intergenic
1101132615 12:101704983-101705005 ACATTTGCTCTGCTACTTACTGG - Intronic
1101132690 12:101705645-101705667 ACATTTGCTCTGCTACTTACTGG - Intronic
1101446493 12:104740513-104740535 GTCTTTGCTCTGCTGCTTTCTGG + Intronic
1101898188 12:108771100-108771122 ATCTTTGCTCTGCCACTTCCTGG - Intergenic
1102434708 12:112912025-112912047 ATTTTACTTCTGCTACTTATTGG - Intronic
1102823246 12:115925879-115925901 ATCTTGGTTCTGCCACTTCTTGG - Intergenic
1102894297 12:116586295-116586317 ATCTTGGCTCTGCCACTTACTGG + Intergenic
1106272043 13:28164329-28164351 GTCTTGGTTCTGCCATTTACTGG - Intronic
1106875090 13:34063254-34063276 ATCTTTGCTTTGCTGCATACAGG - Intergenic
1108094894 13:46891305-46891327 ATCCTTGTTGTGCTACTTACTGG + Intronic
1108801656 13:54104151-54104173 ATCATTGTTCGGTTACTTATTGG + Intergenic
1109316526 13:60755940-60755962 ATTCTGGTTCTGCAACTTACAGG - Intergenic
1109470313 13:62795490-62795512 ATTTTTGCTTTGCTACTTACTGG - Intergenic
1109582963 13:64365465-64365487 ATCTTTACTGTGCTACTTAAGGG + Intergenic
1109588593 13:64444290-64444312 ATCTCTGTTCTGTCACTTACTGG + Intergenic
1110117381 13:71836446-71836468 ATCTTTTCTCTGCCACTTGCTGG - Intronic
1110166960 13:72454068-72454090 ATCTTGACTCTACTACTTACTGG + Intergenic
1110371516 13:74746420-74746442 ATTTTGATTCTGCTACTTAATGG - Intergenic
1110591891 13:77272776-77272798 ATCTTTGGTCTGCTAATAACAGG + Intronic
1111187894 13:84764704-84764726 CTCTGAGTTCTGCTACTTACTGG - Intergenic
1112118709 13:96385892-96385914 ATCTGGGATCTGCTACCTACTGG - Intronic
1112481294 13:99777900-99777922 ATCTTGGTTCTGCTATTTAATGG - Intronic
1112650732 13:101394408-101394430 ATCTTAGTTCTTTCACTTACTGG - Intronic
1114294266 14:21315183-21315205 AACTTTTTTCTTTTACTTACAGG - Intronic
1115630853 14:35243681-35243703 AACCTAGTTCTGCTACTTACTGG + Intronic
1116261462 14:42633595-42633617 GTCTTTGTTCAGATAATTACAGG - Intergenic
1117384781 14:55200733-55200755 ATCTTTGTTCTGGAGCTGACAGG - Intergenic
1118293959 14:64551685-64551707 CTATCAGTTCTGCTACTTACTGG - Intronic
1118416444 14:65541967-65541989 ATTCTGGTTCTGCTACTTACTGG + Intronic
1118611311 14:67542438-67542460 AACTTGGCTCTGCCACTTACTGG + Intronic
1118928610 14:70217819-70217841 ATCTAAGCTCTGCTACTTATTGG - Intergenic
1119583493 14:75809871-75809893 ATCTATGTTCTGCAAATGACAGG + Intronic
1119702358 14:76763641-76763663 ATCTCAGTTCTGCCACTTACTGG - Intronic
1119718218 14:76873680-76873702 ATCTTGGCGTTGCTACTTACTGG - Intergenic
1119851566 14:77870245-77870267 ATCCTGGTTCTGCTTCTTACTGG - Intronic
1120067329 14:80058298-80058320 ATCCTGGTTTTGCTGCTTACTGG - Intergenic
1120085213 14:80264147-80264169 ATCTTGATTTTGCTGCTTACTGG + Intronic
1120566404 14:86063832-86063854 ATGTTTCTTTTCCTACTTACTGG + Intergenic
1120687766 14:87558025-87558047 ATCTTTGTTCTGTTCTTTGCTGG + Intergenic
1120815548 14:88853604-88853626 ATTCTTGTTCTGCCACTTACTGG - Intronic
1120951402 14:90045272-90045294 ATCTCAGCTCTGCCACTTACTGG + Intergenic
1121584784 14:95055770-95055792 ATCCTGGCTCTGCTCCTTACAGG + Intergenic
1121884464 14:97530702-97530724 ATTTTAGATCTGCCACTTACTGG + Intergenic
1124901548 15:33827781-33827803 ATCCTGGTTCTGCCACTTACTGG + Intronic
1125098826 15:35886293-35886315 ATCTTGGTTCTGCTACTGACTGG + Intergenic
1125753093 15:42043711-42043733 ATCTTGGCTCTGGCACTTACTGG + Intronic
1126444203 15:48723634-48723656 ATCTTTATTCTGTCACCTACTGG - Intronic
1126446303 15:48748772-48748794 ATATTGTTTCTGCTGCTTACTGG + Intronic
1127332259 15:57950783-57950805 ATGTTTATTCTGCTAGTCACTGG - Intergenic
1127698771 15:61476799-61476821 GTCCTTGTTTTACTACTTACTGG - Intergenic
1128353267 15:66906212-66906234 ATCCTTCCTCTGCTACTTACTGG + Intergenic
1128581843 15:68816325-68816347 ATCCTGGTTCTGCCACTCACTGG + Intronic
1128715190 15:69902891-69902913 ATCTCTGTGCTGCTACTTCCTGG - Intergenic
1128896453 15:71377945-71377967 ATTTATGTTCTGCTATTTTCAGG - Intronic
1129274445 15:74435791-74435813 ATCTTCGTTCTACCATTTACCGG - Intergenic
1129484867 15:75860997-75861019 ATCTTTGTTCTGCTACTTACTGG + Intronic
1129667147 15:77585589-77585611 ATCCTCACTCTGCTACTTACTGG + Intergenic
1129765273 15:78161221-78161243 ATCTCATCTCTGCTACTTACTGG + Intronic
1129915014 15:79261164-79261186 ATCGTGGATCTGCTACTTGCTGG + Intergenic
1131027640 15:89158272-89158294 CTCTTAGCTCTTCTACTTACTGG - Intronic
1131955816 15:97734973-97734995 ATCTTGGTTCTGCCATTTACAGG - Intergenic
1131990315 15:98086764-98086786 ATCCTGGCTTTGCTACTTACGGG - Intergenic
1133785739 16:8971633-8971655 ATCTTGGTGTTGCTTCTTACTGG - Intergenic
1135796170 16:25444952-25444974 ATCCTGGCTCTGCCACTTACTGG - Intergenic
1135898944 16:26438094-26438116 GTCTTTGCTTTGCCACTTACTGG + Intergenic
1136090434 16:27915881-27915903 ATTCTGGTTCTGCCACTTACCGG + Intronic
1136349182 16:29695950-29695972 ATCTTTGTTCTGCTGCTGCGTGG + Intronic
1137559962 16:49496172-49496194 ATCTTGGCTCTGCCACTTACTGG + Intronic
1138070618 16:53989579-53989601 ATCTGTGCTCTCCCACTTACTGG + Intronic
1138276529 16:55738838-55738860 AGCCTGGCTCTGCTACTTACTGG - Intergenic
1138282454 16:55782196-55782218 AGCCTGGCTCTGCTACTTACTGG - Intergenic
1138286494 16:55814447-55814469 AGCCTGGCTCTGCTACTTACTGG + Intronic
1138742724 16:59329553-59329575 ATCTTTATTTTGCTACCAACTGG - Intergenic
1139220753 16:65179085-65179107 ATCTTGGCTCTGCCACTAACAGG + Intergenic
1141763019 16:86041050-86041072 ATCTATGTTGTGCCACTTAATGG - Intergenic
1143035777 17:3996520-3996542 ATCTTTGTTCTGCTTCCTTTAGG + Intergenic
1143427640 17:6852915-6852937 CTCTTTGTCTTGGTACTTACTGG + Intergenic
1143760641 17:9101343-9101365 CTCTTTGTTCCTCTACTGACTGG + Intronic
1144173215 17:12680224-12680246 ATTTTTATTCAGCTACTTAGTGG + Intronic
1144403261 17:14927245-14927267 ACCCTAGTTCTTCTACTTACTGG + Intergenic
1145786577 17:27597667-27597689 ATCTCCATTCTGCCACTTACAGG - Intronic
1146570434 17:33948052-33948074 ATCCTGATTCTGCCACTTACAGG - Intronic
1146583254 17:34058952-34058974 ATCTTGGTTCTGCCATTTGCTGG - Intronic
1147127442 17:38381590-38381612 ATCCTGGTTCTGCAACTCACTGG - Intronic
1147266759 17:39238960-39238982 ATCTCAGTTCTGCTACTTGCTGG - Intergenic
1147936390 17:44013700-44013722 GTCTGGGTTCTGCCACTTACTGG - Intronic
1148901437 17:50881309-50881331 ATCTCAGCTCTGCCACTTACTGG - Intergenic
1149089403 17:52760539-52760561 ATCTTGACTCTGCTACTTATTGG + Intergenic
1149445145 17:56707702-56707724 ATCTTACTTCTGCTCCTTCCGGG + Intergenic
1151276597 17:73039050-73039072 ATCTTGGCTCAGCTACTTACTGG + Intronic
1153095243 18:1393781-1393803 GTCCTGGTTCTTCTACTTACTGG - Intergenic
1154258218 18:12804375-12804397 TTCTTTGTTCTGCTAATTTTGGG - Intronic
1155867999 18:30990654-30990676 GTCTTGATTCTGCCACTTACAGG - Exonic
1157029845 18:43892704-43892726 ATCTTGGTTCTGGTGCTTTCCGG + Intergenic
1157413189 18:47480894-47480916 ATCTCTGCTCTGCTGCTTCCTGG + Intergenic
1157853699 18:51083816-51083838 ATCTTTGTTCTGCTGTTTGAGGG + Exonic
1158128837 18:54130562-54130584 GTGTTTGTTCTGATACTTTCTGG - Intergenic
1158269050 18:55693096-55693118 ATCTCAGTTTAGCTACTTACAGG - Intergenic
1158303334 18:56077167-56077189 ATTTTTGTTTTGCTGCTTAATGG + Intergenic
1159008621 18:63037429-63037451 TTTTTTGTTCTGCTTCTTAAAGG - Intergenic
1159026540 18:63187622-63187644 TTCTTTATTCAGCTATTTACTGG - Intronic
1159491281 18:69138360-69138382 ATCTTATCTCTGCTACTTACTGG - Intergenic
1160055119 18:75471787-75471809 ATCTTTCTTATACTACTTGCAGG - Intergenic
1160475333 18:79179754-79179776 ATGTTTGTTCTGCTATTGCCTGG + Intronic
1164186463 19:22873349-22873371 ATCTCAGTTCTGCTATTTATGGG + Intergenic
1164551624 19:29217106-29217128 ATCAGTGTTCTGCTACTCTCCGG - Intergenic
1166726716 19:45032878-45032900 ATCCTGGCTCTGCTGCTTACTGG + Intronic
1167247892 19:48384756-48384778 ATCATTGCTCTGCTGCTTGCTGG - Intronic
926743725 2:16133581-16133603 ATCTTGGTTCCGACACTTACCGG + Intergenic
927123167 2:19988114-19988136 ATCCTTGTTCCGCCACTTACTGG + Intronic
927219363 2:20693041-20693063 ATCTTGGTTCTGCCATTTATTGG + Intronic
927493736 2:23538132-23538154 ATCCTAGTTCTGCTACTTATTGG - Intronic
927763061 2:25778040-25778062 ATCTTGGCTGTGCTCCTTACTGG - Intronic
928126570 2:28620641-28620663 CTCTCTGGGCTGCTACTTACTGG - Exonic
928611249 2:32994395-32994417 ATCTTGGTTCTACCACTTACTGG - Intronic
929568251 2:43003798-43003820 ATCTCTCTTCTACTACATACAGG + Intergenic
930784036 2:55253074-55253096 ATCCTGGCTATGCTACTTACTGG + Intronic
932124780 2:69133902-69133924 ATCATGGTTCTGCTGCTTACAGG + Intronic
932286301 2:70534969-70534991 ATCCTTATTCTGCTACTTGCTGG + Intronic
934480585 2:94638439-94638461 ATTTCTGTTCTTCTTCTTACGGG + Intergenic
935282621 2:101532311-101532333 ATCCTGGTTCTGCCATTTACAGG - Intergenic
935724663 2:106012905-106012927 ATCTTTTTTCTTCTAATTAATGG - Intergenic
938618047 2:133020184-133020206 ATCTTTGTTCAGCTAAAGACAGG + Intronic
939558672 2:143708084-143708106 GTCTTGGCTCTGCCACTTACTGG + Intronic
940448133 2:153802961-153802983 ATCTTGATTCTGCTACTTTCTGG + Intergenic
941135446 2:161711778-161711800 ATCTTAGCTATGCTACTTACTGG + Intronic
941383657 2:164826608-164826630 ATCTGTGCTCTGCCACTTACTGG - Intronic
941501385 2:166281932-166281954 ATTATGGCTCTGCTACTTACTGG + Intronic
941807509 2:169723838-169723860 AGCTTTATTCTGCTACTCCCCGG - Intronic
942297991 2:174535772-174535794 ATCCCTGTTCTGCCACTTAATGG - Intergenic
942373728 2:175313765-175313787 ATGTTTGTTGTGCAACTTAATGG + Intergenic
942562634 2:177236599-177236621 GTCTTTGTTCAGCCACTTTCTGG - Intronic
943184734 2:184593068-184593090 TTCTTTCTTCTCCCACTTACCGG + Intergenic
943209291 2:184942134-184942156 ATCTCTAGTCTGCTAGTTACAGG + Intergenic
943541129 2:189215913-189215935 ATTTTTGCTGTGCTAGTTACAGG - Intergenic
944529529 2:200653550-200653572 ATCCTTGTTCTGCCATTTATTGG - Intronic
944542557 2:200767507-200767529 TTCTTTGTACTTCTCCTTACAGG - Intergenic
944788270 2:203096215-203096237 ATTTTGGTTCTGCAGCTTACTGG - Intronic
945276270 2:207990565-207990587 GTCTTTGTTCTCCTCATTACAGG + Intronic
945302009 2:208223298-208223320 ACCTCTGTTCTGCTACTTACTGG + Intergenic
945653016 2:212588412-212588434 ATCCTGGTTCTGGTACCTACTGG + Intergenic
946042750 2:216796540-216796562 GTCTTTCTTCTGCTACTTGGAGG - Intergenic
946070179 2:217028130-217028152 GTCTTTGTTCTACCACCTACTGG - Intergenic
946639082 2:221764059-221764081 ATCTTAATTCTGTCACTTACTGG + Intergenic
946649844 2:221880317-221880339 ATCCTGGCTCTGCTACTCACTGG + Intergenic
948329859 2:237156370-237156392 GTCTTTGTTTTGCTTCCTACGGG + Intergenic
1168936913 20:1673541-1673563 CTCTTTGTTCTGCTGCCTAAAGG - Intergenic
1169815977 20:9656629-9656651 ACCTTTGTTCTTCTACTTAATGG + Intronic
1169870614 20:10244528-10244550 ATCTTGGCTCTGCCACTCACTGG - Intronic
1170218399 20:13916254-13916276 CTCTTTGCTTTGCTACTTCCTGG - Intronic
1170236971 20:14117607-14117629 ATCTTTTTTCCTCTACTTTCAGG + Intronic
1170655130 20:18279493-18279515 ATTTGAGTTCTGCAACTTACTGG + Intergenic
1171994238 20:31719943-31719965 ATATTTGTTCAGCTGATTACAGG - Intronic
1172231382 20:33338839-33338861 ATCTTGGTTCTGCTGCCTCCTGG - Intergenic
1172373163 20:34412028-34412050 ATTACAGTTCTGCTACTTACTGG + Intronic
1172817070 20:37695669-37695691 GTCTCTGTTTTGCTACTAACTGG + Intronic
1174072840 20:47910705-47910727 ATCTCAGTTCTGCCACTCACTGG - Intergenic
1174529398 20:51199094-51199116 AAGTTTGTTTTGCTACTCACAGG + Intergenic
1174570309 20:51496714-51496736 ATCCTGGTTCTGCCACTTATTGG - Intronic
1174742617 20:53030162-53030184 ATCTTAGCTCTGGTACTTCCTGG - Intronic
1177185758 21:17794207-17794229 ATCCTTGATCTGCTACTGATTGG + Intronic
1178081235 21:29067611-29067633 AACTTTGTTCTGGTATTTGCTGG - Exonic
1179158939 21:38876058-38876080 ATCTATGTTCTTTTTCTTACTGG - Intergenic
1182067506 22:27441225-27441247 ATCCTTGTTCTGCCTCCTACAGG + Intergenic
1182759989 22:32714734-32714756 GGCTTTGTGCTGCTACTTCCTGG + Intronic
1182798661 22:33011825-33011847 ATCTTGGTTGTGAAACTTACTGG + Intronic
1183625957 22:39001891-39001913 ATCCTGCTTCTGCCACTTACTGG + Intergenic
1183737674 22:39652943-39652965 ATCCTGGTTCTGCTATTGACTGG + Intronic
949711783 3:6879205-6879227 ATTTTTAATCTACTACTTACTGG - Intronic
949829592 3:8199627-8199649 ATCCCAGTTCTACTACTTACTGG + Intergenic
950275882 3:11660221-11660243 ATCTTGGTTCTGCCACAGACTGG + Intronic
950657824 3:14447984-14448006 ATCCCAGTTCTGCCACTTACTGG + Intronic
951789226 3:26461164-26461186 ATTTTTGTACTGCCAGTTACAGG + Intergenic
952706440 3:36381878-36381900 ATTTTTTTCCTGTTACTTACTGG + Intronic
956005090 3:64770161-64770183 ATCTTGGCTCTGCCACTCACTGG - Intergenic
956069632 3:65434148-65434170 ATCTGTGCTCTGCTACTTAGTGG + Intronic
956316098 3:67938697-67938719 ATCTTGGTTCCACTACTTCCTGG + Intergenic
956591687 3:70922084-70922106 ATCTTAGCTCTGCTTCTCACTGG - Intergenic
957740193 3:84255996-84256018 AACTATGTTTTGCTACTTATGGG + Intergenic
957951641 3:87135314-87135336 ATCCTGATTCTGCCACTTACCGG - Intergenic
957969952 3:87370386-87370408 TTCTGTGTTCTGATACTTCCAGG + Intergenic
958138408 3:89527829-89527851 CTCTTTGCTCTACTGCTTACAGG + Intergenic
958962122 3:100520838-100520860 CTCTTTGTTCTCCTACCTCCTGG - Intronic
959075510 3:101745121-101745143 ATCTCTGTTTTGCTATTGACAGG + Intronic
959095879 3:101955133-101955155 CTCCTTGTTCTGCTATTTCCTGG + Intergenic
959582987 3:108001002-108001024 ATATTTGCTCAGATACTTACAGG - Intergenic
960719045 3:120607388-120607410 ATCTTTGCTCTGCCACTTACTGG + Intergenic
961122170 3:124382064-124382086 ATCCTGGTTCTGCCACTTACTGG + Intronic
961772443 3:129259946-129259968 ATCTTGGTTCTGCCACTTACTGG + Intronic
962389732 3:134961094-134961116 TTCTTTCTTCAGCTACTTATTGG + Intronic
963983290 3:151563979-151564001 ATCTTAGTTCTGCCTCTTGCTGG - Intergenic
964996117 3:162883278-162883300 AACTTTGATCTGTCACTTACAGG + Intergenic
966054641 3:175670173-175670195 ATCCTAGTTTTGCTACTTTCTGG - Intronic
966187111 3:177237455-177237477 ATCTTGGCTCTGCCTCTTACTGG + Intergenic
966339964 3:178914765-178914787 ATCTTGTGTCTGCCACTTACTGG - Intergenic
966540913 3:181088682-181088704 ATCTCAGTTCTGCCATTTACTGG + Intergenic
966780156 3:183577420-183577442 ATCCCTGCTCTGCCACTTACTGG - Intergenic
966784783 3:183613395-183613417 ATCCCAGTTCTGCTACTTACTGG - Intergenic
968630019 4:1645513-1645535 ATCTTTGTTCTCCAGCTTCCTGG - Intronic
969519152 4:7665759-7665781 GTCTTTGCTCTGGTACTTAGTGG - Intronic
971025677 4:22586402-22586424 ATATTTTTCCTACTACTTACGGG - Intergenic
971524134 4:27594595-27594617 ATCTTGGTTCTACCACTTACTGG + Intergenic
971646425 4:29211385-29211407 ATTATTGCTCTGCCACTTACTGG + Intergenic
971959254 4:33463742-33463764 ATCTTTCTTCTCCTGCTTAAAGG + Intergenic
972156923 4:36174789-36174811 ATTCTTGTTCTGCTACTAATTGG - Intronic
973561013 4:52135385-52135407 GTCTTTCTTCAGCTTCTTACTGG + Intergenic
975273632 4:72467968-72467990 TTCTTTGCTCTGATACATACAGG - Intronic
976078974 4:81333117-81333139 ATCTCAGTTCTGCCACTTTCTGG + Intergenic
976523251 4:86055066-86055088 CTCTTTGTTTTTCTACTTCCAGG + Intronic
977304995 4:95312603-95312625 ATCTTTATTTTGGTACTTATTGG - Intronic
977415699 4:96730195-96730217 ATGCTTGCTCTGGTACTTACTGG + Intergenic
977604503 4:98968815-98968837 ATCCTAGCTCTGCTGCTTACTGG - Intergenic
977772063 4:100871259-100871281 ATATGTGTTCTGCTACTAAGAGG + Intronic
977947398 4:102929325-102929347 ATCTTGGCTCCCCTACTTACTGG + Intronic
979081033 4:116341947-116341969 GTATGTGTTCTACTACTTACAGG + Intergenic
979589093 4:122457802-122457824 ATCCTTCTTCTGCCCCTTACTGG - Intergenic
980971238 4:139569047-139569069 ATATTTGTGCTGCTACTTTGAGG + Intronic
981041557 4:140227640-140227662 ATCCTTGTTCTGCAACTTACTGG + Intergenic
981546254 4:145897114-145897136 ATCTCAGTTCTGCCACTAACTGG - Intronic
981825910 4:148941190-148941212 ATCTTTTTTCCTCTAATTACAGG + Intergenic
983436445 4:167721578-167721600 ATCTTTATTTTGGTATTTACAGG + Intergenic
984281849 4:177679813-177679835 ATCTTAGCTCTGCTACTTTCTGG - Intergenic
986652775 5:9980696-9980718 AACTTTGTGCTTCTACTCACAGG - Intergenic
986698377 5:10378398-10378420 ATCCTGGTTCTGCCACTAACTGG - Intronic
986937498 5:12907623-12907645 TTTATTGTTCTGCTACTGACTGG + Intergenic
987653390 5:20774274-20774296 ATGTTCGTTCTCCTACTTCCAGG + Intergenic
987871241 5:23620270-23620292 ATCTTTATTATCCTACTGACTGG + Intergenic
988742184 5:34087204-34087226 ATGTTCGTTCTCCTACTTCCAGG - Intronic
989971132 5:50526044-50526066 ATCTTATTTCTGGTACCTACAGG - Intergenic
990739758 5:58900509-58900531 ATCTTTGTTCTGCTAATTCCTGG - Intergenic
990942986 5:61222235-61222257 ATCCTTGTTCTGCTACCTGCTGG + Intergenic
991024583 5:62016145-62016167 GTCTTGGCTCTGCCACTTACTGG - Intergenic
991677698 5:69105064-69105086 ATTTTTGTTCTCCTTCTTATTGG - Intronic
992018351 5:72598162-72598184 GTCTTTATCCCGCTACTTACTGG - Intergenic
992765408 5:79994279-79994301 ATCTTGGTTCTACCACCTACTGG - Intronic
993817189 5:92564750-92564772 ATCTTTGTGCTTCTTCTTCCAGG - Intergenic
994680006 5:102874939-102874961 ATCCTTGTTCTCCTATTTACCGG - Intronic
996893555 5:128453373-128453395 ATCTTTCCTCTGCTACTACCCGG + Intronic
997669757 5:135661119-135661141 ATCTTAGTGCTGCTTCCTACAGG + Intergenic
998808130 5:145938547-145938569 TTCCTTGTTCTACTACTTTCTGG - Intronic
1000118547 5:158175755-158175777 ATCTTTGTTTTCCTTCTTTCTGG - Intergenic
1000724835 5:164757042-164757064 ATTTTTGTTCTGAAAATTACTGG - Intergenic
1000790918 5:165606049-165606071 TTCCTTTTTCTTCTACTTACAGG + Intergenic
1001082864 5:168679830-168679852 ATCCTAGCTCTGCCACTTACTGG + Intronic
1001712190 5:173787826-173787848 ATTTTAGCTCTGCTACTTACTGG + Intergenic
1002027268 5:176404119-176404141 ATCCTGGTTCTGCCACTTCCTGG - Intronic
1002600439 5:180351673-180351695 GTTTTTGTTCTGCTTCTTAAAGG - Intronic
1003361212 6:5427437-5427459 TCCTTTGTTCTGCTACTTTAAGG - Intronic
1003378520 6:5601621-5601643 ACCTTGGCTCTGCCACTTACTGG + Intronic
1004052765 6:12104283-12104305 TTCTTTGTTTTGTTACTTTCTGG + Intronic
1004174086 6:13323862-13323884 ATCCTAGCTCTGCCACTTACAGG + Intronic
1004253574 6:14042704-14042726 ATTTCAGTTCTGCCACTTACTGG - Intergenic
1004566735 6:16805002-16805024 ATCTTGGTTCCTCTCCTTACTGG - Intergenic
1004971101 6:20911265-20911287 TTCTTGGTTCTACTACTTAGTGG - Intronic
1005927209 6:30453519-30453541 AAATTTGTTCTGCTGCTTCCAGG - Intergenic
1007026610 6:38582480-38582502 ATCTCAGCTCTGCTACTTCCTGG - Intronic
1007492187 6:42231842-42231864 ATCTCAGTTCTGCTCTTTACTGG + Intronic
1007737797 6:43992731-43992753 ATCGGGTTTCTGCTACTTACTGG - Intergenic
1008373123 6:50759196-50759218 ATCTTTGTTGAGCTATTGACTGG + Intronic
1009707594 6:67273511-67273533 ATCTTTGAAGTGCTACTTAAAGG + Intergenic
1009983367 6:70752554-70752576 ATTTTTTTCCTGCTACTTACTGG + Intronic
1010046292 6:71447766-71447788 ATTCTGGTTCTGCTACTCACCGG + Intergenic
1010748616 6:79592874-79592896 TTCTGAGCTCTGCTACTTACTGG - Intergenic
1011323117 6:86118969-86118991 TTTTTTGTTCTGCTACTAATTGG + Intergenic
1011361762 6:86533624-86533646 ATCTTAGTTCTTCTACTGAGTGG + Intergenic
1011813168 6:91156195-91156217 ATTTTTGTTCATCTACTTAAAGG - Intergenic
1013138964 6:107311713-107311735 ATCTTAGATCTGCTACTTTATGG + Intronic
1015022823 6:128497184-128497206 ATTAGTGTTCTGCTACTGACTGG - Intronic
1015977135 6:138801781-138801803 ATTTTTCTTCATCTACTTACTGG - Intronic
1016109900 6:140210098-140210120 GTCTTTATTCTGCAACTTCCTGG + Intergenic
1016375542 6:143416907-143416929 ATTCTGGTTCTGCTACTCACTGG + Intergenic
1016405599 6:143726203-143726225 AACTTTTCTCTGCTACTTGCAGG - Intronic
1016697469 6:147014924-147014946 ATCTTTGTTTTGTTTCTTTCAGG - Intergenic
1016708491 6:147142104-147142126 ACCTTAGTTCTGCAACTTAATGG - Intergenic
1018267238 6:162038552-162038574 ACTTTTGTTATGATACTTACAGG - Intronic
1018668388 6:166160529-166160551 ATCCTGGTTCTGCCACTTACTGG - Intronic
1020818866 7:12940284-12940306 GTCTCTATTCTGTTACTTACAGG + Intergenic
1021846844 7:24771541-24771563 ATCCTGGTTCTGCCACTTACTGG + Intergenic
1022041064 7:26581906-26581928 ACCTTTGTTAGGCTTCTTACAGG + Intergenic
1022219769 7:28301738-28301760 ATGTTTGTTCTGTTGTTTACAGG + Intronic
1022412950 7:30153538-30153560 ATCCTGGCTCTGCCACTTACTGG + Intronic
1023534461 7:41193739-41193761 ATCTCTGCTCAGCTACTTAGTGG - Intergenic
1024341126 7:48261547-48261569 ATATTTTTTCTTCTACTTTCTGG + Intronic
1024499701 7:50091894-50091916 ATCCTAATTCTGCCACTTACTGG + Intronic
1025749077 7:64275674-64275696 ATCCTGGTTCTGCCACTTATGGG + Intergenic
1026148451 7:67768514-67768536 ATCTCAGCTCTGCTACTTCCTGG - Intergenic
1026291314 7:69008705-69008727 ATCTTGGTTCTGCCACTGATAGG + Intergenic
1030275325 7:107714726-107714748 GTCCTCATTCTGCTACTTACTGG + Intronic
1030387675 7:108885268-108885290 ATCTTTGTGTTTCTACTTCCTGG + Intergenic
1031455384 7:121972856-121972878 ATCTTTGATTTGCCACTTGCTGG + Intronic
1032148866 7:129410266-129410288 ATCTTCCTTCTGTTTCTTACGGG + Intronic
1032188401 7:129747673-129747695 ATCTTGGTTCTGCTGTTTAATGG - Intronic
1032595342 7:133234073-133234095 ATCCTTTTTCTGCCACTTACTGG - Intergenic
1033637614 7:143226557-143226579 AACTTTGTTTTGCTGCTTACAGG - Intergenic
1035895981 8:3402474-3402496 CTCTTTCTTCTGCTTCTAACAGG - Intronic
1036469949 8:9044010-9044032 ATCTTGGTTCTGAGACTTACTGG + Intronic
1037192580 8:16144592-16144614 TATTTTGCTCTGCTACTTACTGG + Intronic
1037227317 8:16608458-16608480 CTCTTTGTTTTGTGACTTACAGG - Intergenic
1038793098 8:30686050-30686072 ATCCTAGCTCTGCAACTTACCGG + Intronic
1039104484 8:33975295-33975317 ATCTTTGCTCTGCAACTAATTGG - Intergenic
1040495727 8:47963807-47963829 ATCTTGGTTTTGCTGATTACTGG + Intronic
1043321908 8:78997713-78997735 ATATTTGTTCTTCTACTTCATGG - Intergenic
1044557186 8:93576062-93576084 GTCTTTCTTCTGCTACTCATAGG - Intergenic
1045609743 8:103824992-103825014 ATCTAGGGTCTGCTGCTTACTGG + Intronic
1045892938 8:107179363-107179385 ATCTTTACTCTGCCACATACTGG - Intergenic
1047159707 8:122364151-122364173 AGCTTGGTTCTTCTACCTACAGG + Intergenic
1047281197 8:123447590-123447612 ATCCTGGCTCTACTACTTACTGG - Intronic
1047594061 8:126358635-126358657 ATCTCAGCTCTGCTACTTGCTGG - Intergenic
1047722326 8:127652616-127652638 ATCCTGGTTCTGCAATTTACTGG + Intergenic
1048126976 8:131646536-131646558 ATCTTGGTTCCACTACTTACTGG - Intergenic
1049951743 9:651442-651464 AACTTTCTTCTGTGACTTACTGG + Intronic
1050336765 9:4597132-4597154 ATCCTAGTTCTGCCATTTACAGG - Intronic
1050463412 9:5896137-5896159 ATGTTGGTTCTGCCACTTGCTGG + Intronic
1050895278 9:10879033-10879055 ATTTTTGTCCTGCCACTGACTGG + Intergenic
1051689885 9:19699959-19699981 AGATTTGTTTTGCTGCTTACTGG + Intronic
1052245204 9:26325904-26325926 TTCTTAGCTCTGCTACTTGCTGG + Intergenic
1052843303 9:33312245-33312267 ATCCTGGTTCTGTCACTTACTGG + Intronic
1053036236 9:34828786-34828808 TTCTTTGTTCCTCTATTTACTGG + Intergenic
1053372588 9:37575567-37575589 ATCACAGTTCTGCCACTTACTGG - Intronic
1053396820 9:37782893-37782915 ATCTTTGCTCTAGCACTTACTGG - Intronic
1053677249 9:40445497-40445519 ATTTCTGTTCTTCTTCTTACAGG - Intergenic
1053927006 9:43071652-43071674 ATTTCTGTTCTTCTCCTTACAGG - Intergenic
1054286470 9:63179423-63179445 ATTTCTGTTCTTCTTCTTACAGG + Intergenic
1054290322 9:63281024-63281046 ATTTCTGTTCTTCTTCTTACAGG - Intergenic
1054388345 9:64585561-64585583 ATTTCTGTTCTTCTTCTTACAGG - Intergenic
1054507373 9:65930798-65930820 ATTTCTGTTCTTCTTCTTACAGG + Intergenic
1054892538 9:70267638-70267660 ATCGTTTTTCTGGCACTTACTGG + Intronic
1055122514 9:72678172-72678194 ATCTTGGTTATGCCACTTATTGG + Intronic
1058150497 9:101458640-101458662 TTCTTTGTTCTAATACTTCCTGG + Intergenic
1058733532 9:107873487-107873509 ATCTTGGTTCTGCCACTACCAGG + Intergenic
1059203679 9:112443403-112443425 ATCTTGGTTCTGCCACCTGCTGG - Intronic
1059295585 9:113267416-113267438 ATCTTCCTTCTGTTTCTTACGGG + Exonic
1059515209 9:114888253-114888275 ATCTATTTTCTGCAACTTTCAGG + Intergenic
1059640261 9:116209870-116209892 ATCCTTGTTCTGCTTCACACTGG - Intronic
1059685386 9:116630231-116630253 AGTTTTGTTCTGCTATATACTGG - Intronic
1060649613 9:125314054-125314076 ATCTCTCTTCTGCTACTGCCTGG - Intronic
1061527242 9:131176238-131176260 GTCTGGGTTCTGCTACTTATTGG - Intronic
1186830608 X:13386481-13386503 GTCCTGGTTCTGCTACTAACTGG - Intergenic
1188460113 X:30415783-30415805 ATCTTAGCTCAGCTGCTTACTGG + Intergenic
1188585753 X:31772701-31772723 ATCCTTGTTCTGCTACTTACTGG + Intronic
1188781513 X:34292233-34292255 ATCTTAGTTGTCCTAATTACAGG - Intergenic
1189130418 X:38492299-38492321 AACTTGGTTCTGCCACTTAACGG + Intronic
1189883702 X:45517819-45517841 GTCTTTGTTCAGCTACTAACAGG + Intergenic
1190437454 X:50439733-50439755 ATCTTTGATCTGTTACTCATGGG - Intronic
1192061188 X:67828592-67828614 ATCTTTTTTCTGGTTCTTAGGGG - Intergenic
1193851275 X:86540174-86540196 ATCATTCTTCTGCTACTGAGTGG + Intronic
1195535760 X:106007742-106007764 ACCTTGGTTCTACCACTTACTGG - Intergenic
1196010118 X:110877854-110877876 ATCTTGATTCTGCTGCTTACTGG + Intergenic
1196188181 X:112766680-112766702 ATCCTAGCTCAGCTACTTACAGG - Intergenic
1198373584 X:136015442-136015464 ATCCTGGTTCTACTACTTGCTGG + Intronic
1198815339 X:140583961-140583983 TTCTTAGTTCTGCTATTTATTGG + Intergenic