ID: 1129494529

View in Genome Browser
Species Human (GRCh38)
Location 15:75965351-75965373
Sequence GGGTTTATGCAAATAGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 361}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129494529 Original CRISPR GGGTTTATGCAAATAGAAAA AGG Intronic
901379478 1:8863378-8863400 GGGGTTATGGAACCAGAAAATGG - Intronic
904930446 1:34082614-34082636 CGGTTTTGTCAAATAGAAAAGGG + Intronic
906441376 1:45848700-45848722 GGATTTATGAAAATAGTTAAGGG + Intronic
908605756 1:65795351-65795373 AGGTTTTTGGAAATAGAAATGGG - Intronic
909353027 1:74675755-74675777 TCATTTTTGCAAATAGAAAATGG + Intergenic
910794748 1:91086472-91086494 AGGTTTAAGCAAAGTGAAAAGGG + Intergenic
911295040 1:96104806-96104828 TGACATATGCAAATAGAAAAGGG + Intergenic
911518076 1:98893099-98893121 GTGGTTCTGCAAAAAGAAAAAGG + Exonic
911600915 1:99847555-99847577 TGGTTTTTGCAACTATAAAATGG - Intergenic
912163710 1:107017661-107017683 GGCTTCATGCAAATTTAAAATGG - Intergenic
912461572 1:109836112-109836134 AGGTTTAAGCAAAGTGAAAAGGG + Intergenic
913454546 1:119017936-119017958 GGGTCTATGCAAATCCTAAAAGG - Intergenic
915671647 1:157494189-157494211 GGGAAGATGCAAATAGAAAGGGG - Intergenic
916324883 1:163545958-163545980 CGGTTTTGTCAAATAGAAAAGGG - Intergenic
916864196 1:168837660-168837682 CGGTTTTGTCAAATAGAAAAGGG + Intergenic
917753406 1:178075360-178075382 GGGTTGGTGGAAATAGAACAAGG + Intergenic
917986784 1:180327664-180327686 GGGTTTAAGTAAAAGGAAAAAGG - Intronic
918338215 1:183543174-183543196 GGTTTCATGTAAACAGAAAAGGG + Intronic
919140826 1:193569441-193569463 AGTTTTATACAAATATAAAAAGG + Intergenic
921109171 1:212015248-212015270 GGGTTTTGTCGAATAGAAAAGGG + Intronic
921223680 1:212995507-212995529 GGCTTTATGCAACTACAGAATGG - Intronic
921344589 1:214169174-214169196 GGGTTTTAGCAAATTGGAAAAGG - Intergenic
921574861 1:216822993-216823015 GAGTTTACCCAATTAGAAAAGGG + Intronic
924483435 1:244457060-244457082 AGGTTTAAGCAAAGTGAAAAAGG + Intronic
1063729848 10:8684310-8684332 GGGTTTATGGAAGTTGACAAAGG - Intergenic
1063960833 10:11304309-11304331 GGGTTTTTGTAAATGGAAGAAGG - Intronic
1064307357 10:14179482-14179504 GGGTTGAGGCAGAGAGAAAAAGG - Intronic
1064702973 10:18040795-18040817 AGGTTTATGGCAATAGAAAATGG - Intronic
1065777952 10:29139733-29139755 GGGTTTGTTGACATAGAAAAGGG - Intergenic
1066390946 10:34976822-34976844 CGGTTTTGTCAAATAGAAAAGGG + Intergenic
1067973344 10:50995660-50995682 GGGTGTATGCAAAAAGAGTAAGG - Intronic
1068193034 10:53678518-53678540 GAGTTTATGCAAATCTAAATGGG + Intergenic
1068946104 10:62730382-62730404 GCCTTTGTGCAAATAGAAGAAGG + Intergenic
1070524082 10:77280029-77280051 TGGTTTATGGAAAGAGCAAATGG - Intronic
1070578130 10:77696001-77696023 GGCTTAATTGAAATAGAAAATGG + Intergenic
1071311302 10:84347234-84347256 TGGTTTTGTCAAATAGAAAAGGG - Intronic
1071552142 10:86574488-86574510 GCTTTTTTGCACATAGAAAATGG - Intergenic
1071857356 10:89639282-89639304 GGGTTAATGCCAATTGTAAAAGG - Intronic
1072497030 10:95972064-95972086 AGGTTTATGAAAAAAGTAAAAGG + Exonic
1072898851 10:99389914-99389936 GGGTTTGTGCAAATATACCAAGG + Intronic
1075539168 10:123297893-123297915 GGGTTTTTGTAAAAAGTAAATGG - Intergenic
1075615492 10:123888128-123888150 GGGTTTATGCAAGGAGCCAAGGG - Intronic
1077927017 11:6691216-6691238 AGGTTTAAGCAAGTTGAAAAGGG + Intergenic
1078185074 11:9045204-9045226 GTTTTTATGCACATATAAAAAGG - Intronic
1078483672 11:11702606-11702628 TGGTTAATGTAAACAGAAAAGGG - Intergenic
1078796945 11:14601569-14601591 GGCTTAATGTAAATAGAACAAGG + Intronic
1079704082 11:23591318-23591340 GGGTTTTTGAAAATGGAACATGG - Intergenic
1080498783 11:32848461-32848483 AGGGTTATGGAAATAGATAATGG + Intronic
1080636435 11:34127742-34127764 GGGCTTCTGCAAATGGAAACTGG + Intronic
1080978617 11:37373882-37373904 GGGTTTATGCAAACCTAAATAGG + Intergenic
1082244973 11:49911548-49911570 CGGTTTTGTCAAATAGAAAAGGG - Intergenic
1082890664 11:58135248-58135270 GTTTTTATTCAACTAGAAAATGG + Intronic
1082973928 11:59053795-59053817 GCACCTATGCAAATAGAAAAGGG + Intergenic
1082978339 11:59097605-59097627 GCACCTATGCAAATAGAAAAGGG + Intergenic
1083120920 11:60510710-60510732 CGGTTTTGTCAAATAGAAAAGGG + Intergenic
1083738222 11:64693909-64693931 TGGATTTTGAAAATAGAAAATGG + Intronic
1083825013 11:65196276-65196298 GGATTTAAGAAAAAAGAAAATGG - Intronic
1087100318 11:94357445-94357467 GGATATATGCATATATAAAAGGG - Intergenic
1089050770 11:115543899-115543921 GGGAGTAGGCAAATACAAAAGGG - Intergenic
1089409044 11:118223136-118223158 TGGTTTAAGCAAGTTGAAAAGGG + Intronic
1089706865 11:120284385-120284407 GGCTTTATGCAAATAGAGTGTGG + Intronic
1090099337 11:123777729-123777751 GGGTATATGCAAATGCAAATTGG + Intergenic
1090360494 11:126169095-126169117 GGATTCATGCAAAGAGGAAAAGG + Intergenic
1090407519 11:126486007-126486029 GGGTTTAACCAAATATAAACAGG - Intronic
1090501288 11:127263947-127263969 AGGTTTCTGGAAATAGGAAAAGG + Intergenic
1090686776 11:129129574-129129596 CGGTTTTGTCAAATAGAAAAGGG + Intronic
1091614601 12:2039939-2039961 GGATTTATGCAAAGAGGAGATGG + Intronic
1092060771 12:5548582-5548604 GGGTTTATGCAATTAAATAGTGG + Intronic
1094459525 12:30679436-30679458 CTGTTTCTGCCAATAGAAAAAGG + Intronic
1094787379 12:33864261-33864283 GGGTTTATTCAAAGAAATAATGG - Intergenic
1095207246 12:39452624-39452646 AGGTTTATGGAAAGAGAATATGG - Intergenic
1095452700 12:42349860-42349882 CGGTTTTGTCAAATAGAAAAGGG - Intronic
1096146282 12:49281263-49281285 GGGGTTCTGCAAATTCAAAAGGG - Intergenic
1096257436 12:50072129-50072151 GGGTCTCTGCAAATGGAGAAGGG + Intronic
1096453973 12:51770197-51770219 GGGCTGATGCCAAGAGAAAATGG - Intronic
1096826993 12:54287213-54287235 GGTTTAATGAAAATAGAAATGGG + Intergenic
1096999303 12:55863041-55863063 CGGTTTTGTCAAATAGAAAAGGG - Intergenic
1098392034 12:69979733-69979755 CAGTTTATCCAAATATAAAATGG - Intergenic
1100014571 12:89993615-89993637 TGGTTTATGCATCTATAAAATGG + Intergenic
1100294843 12:93251171-93251193 AGGTTTAAGCAAATTAAAAAAGG - Intergenic
1101115468 12:101527382-101527404 GTGTTTATGTGTATAGAAAAAGG - Intergenic
1102655130 12:114476241-114476263 GTCTTTATGCAATTAGAAGAAGG + Intergenic
1103627310 12:122229778-122229800 ATTTGTATGCAAATAGAAAATGG - Exonic
1104611972 12:130236259-130236281 GCGTCTTTGCAACTAGAAAAGGG + Intergenic
1105346252 13:19575249-19575271 GGGTTGAAGAAAATAGAAAAAGG + Intergenic
1107042882 13:35967367-35967389 CGGTTTTGTCAAATAGAAAAGGG + Intronic
1107280892 13:38733578-38733600 TGGTTTTTGCAATTAAAAAAAGG + Intronic
1107657643 13:42608208-42608230 GGATATATCCAGATAGAAAATGG + Intergenic
1108974091 13:56415538-56415560 GTGTATATGCAAATACAAATTGG - Intergenic
1109617277 13:64851744-64851766 AGGTTTATGTAATTAAAAAATGG - Intergenic
1109637623 13:65143680-65143702 GGATTTAAGCAAAAAGCAAAGGG - Intergenic
1109758090 13:66788235-66788257 GGGTTAATGCCATTATAAAAAGG - Intronic
1110366655 13:74694341-74694363 GGTTTTAGGGAAATAGGAAAGGG - Intergenic
1111371121 13:87319032-87319054 GGGTACAGGTAAATAGAAAAAGG + Intergenic
1111450020 13:88402791-88402813 TGATATATGCAAACAGAAAAAGG - Intergenic
1111841113 13:93452717-93452739 GTGTTTATTCAAACAGAACATGG + Intronic
1111883342 13:93986590-93986612 TTGTTTATGCAAGTAGATAATGG - Intronic
1112665177 13:101562018-101562040 GTGTTTATGCAAAAATAAAATGG + Intronic
1112687520 13:101848199-101848221 GGGTTGATGAAAAGATAAAATGG - Intronic
1112989668 13:105496676-105496698 GTGTTTATGCATATAGACACTGG + Intergenic
1113329219 13:109311924-109311946 CGGTTTTGTCAAATAGAAAAGGG + Intergenic
1113659325 13:112094680-112094702 TGGTTTCTTCAAATGGAAAATGG + Intergenic
1113700682 13:112385184-112385206 AGGTTTAAGCAAAGTGAAAAGGG - Intronic
1114137358 14:19866814-19866836 CGGTTTTGTCAAATAGAAAAGGG + Intergenic
1114578784 14:23737087-23737109 CGGTTTTGTCAAATAGAAAAGGG + Intergenic
1115124890 14:29980439-29980461 GGTTTTTTACAAATAGAAATTGG - Intronic
1116729056 14:48598747-48598769 CGGTTTTGTCAAATAGAAAAGGG + Intergenic
1118253168 14:64182839-64182861 CGGTTTTGTCAAATAGAAAAGGG - Intronic
1119175335 14:72564444-72564466 AGGTTTATACAAAGAGAAAGAGG - Intronic
1121272222 14:92645407-92645429 GGGTTTATTCAGCTATAAAAAGG + Intronic
1124439676 15:29676902-29676924 GGGTCTCTGCAAATGGAAACTGG + Intergenic
1126210656 15:46097890-46097912 CGGTTTTGTCAAATAGAAAAGGG - Intergenic
1127134358 15:55904277-55904299 AGGTGTATGGAAATAGAACAAGG - Intronic
1128191735 15:65706915-65706937 AGGTATATTCAAATATAAAAAGG - Intronic
1128351284 15:66891648-66891670 AGGTTTAAGCAAAGGGAAAAGGG - Intergenic
1128503090 15:68243172-68243194 AGGTTTAAGCAAAGTGAAAAGGG + Intronic
1129494529 15:75965351-75965373 GGGTTTATGCAAATAGAAAAAGG + Intronic
1129917232 15:79284206-79284228 AGGTTTATGGAACTAGCAAATGG + Intergenic
1131714172 15:95090521-95090543 TGGAGTATGCAAATATAAAATGG - Intergenic
1132460470 16:51438-51460 AGGTTTCTAAAAATAGAAAATGG - Intronic
1133762546 16:8811213-8811235 GGGTTTATGGAAATAAGATATGG + Intronic
1135348139 16:21706659-21706681 GATTTTAAGCAAATTGAAAAGGG - Intronic
1136155255 16:28377683-28377705 CGGTTTTGTCAAATAGAAAAGGG + Intergenic
1136207828 16:28737606-28737628 CGGTTTTGTCAAATAGAAAAGGG - Intergenic
1138793678 16:59941081-59941103 AGGTATATGCAAATATAAATTGG - Intergenic
1140574800 16:76154835-76154857 GTTTATATGCAATTAGAAAATGG + Intergenic
1140647643 16:77050343-77050365 TGATTTATACAAATATAAAATGG - Intergenic
1141885153 16:86886496-86886518 GTGTGTATAGAAATAGAAAATGG - Intergenic
1141965003 16:87436116-87436138 GGGTTTATGAAAAAAGTAAAAGG + Intronic
1142011856 16:87719209-87719231 TGGTTTTGTCAAATAGAAAAGGG + Intronic
1143884893 17:10057789-10057811 GGGTTTTGTCGAATAGAAAAGGG + Intronic
1145806274 17:27734471-27734493 TGATTCATGTAAATAGAAAATGG + Intergenic
1145953741 17:28840390-28840412 GTGTTTATGGAAAGAGAAAATGG - Intronic
1146154039 17:30504561-30504583 TGATTCATGTAAATAGAAAATGG + Intronic
1146874740 17:36399775-36399797 TGATTTTTGTAAATAGAAAATGG + Intronic
1147064643 17:37913106-37913128 TGATTTTTGTAAATAGAAAATGG - Intergenic
1147920868 17:43916217-43916239 GGGTTTATGCAAATCATCAAAGG + Intergenic
1148192823 17:45691796-45691818 GGGTTTAGGTATTTAGAAAAGGG + Intergenic
1148662895 17:49350024-49350046 GGATGTTTCCAAATAGAAAAAGG + Intronic
1148717117 17:49723636-49723658 AGGTTGTTGCAAACAGAAAAGGG + Intronic
1149496421 17:57120965-57120987 GAGTTTGCACAAATAGAAAATGG - Exonic
1149593101 17:57846456-57846478 GGGTTTTGTCGAATAGAAAAGGG + Intronic
1150061598 17:62073159-62073181 CGGTTTTGTCAAATAGAAAAGGG + Intergenic
1150780212 17:68116070-68116092 CGGTTTTGTCAAATAGAAAAGGG - Intergenic
1151061794 17:71103143-71103165 TGTTTTATGCAAATGGAAACTGG + Intergenic
1155674654 18:28415840-28415862 GTGTTTAATTAAATAGAAAAAGG + Intergenic
1156451422 18:37268438-37268460 GGCTTTATGCAAATTAGAAAAGG + Intronic
1156602666 18:38627977-38627999 GTGTTTCTGCATAAAGAAAATGG + Intergenic
1157262126 18:46185008-46185030 GGTTTTATGTAGAAAGAAAAGGG + Intronic
1157523090 18:48358712-48358734 GGGTTTATGCTAATAAATATAGG + Intronic
1157857619 18:51117009-51117031 CGGTTTTGTCAAATAGAAAAGGG - Intergenic
1159094694 18:63889174-63889196 GTAATTATGCAAATTGAAAAGGG + Intronic
1159133339 18:64306729-64306751 GTGTGAATGCAAATAGGAAAAGG + Intergenic
1159324290 18:66894460-66894482 CGGTTTTGTCAAATAGAAAAGGG + Intergenic
1159653218 18:71001683-71001705 ATGTTTATCCAAATAGAAAATGG + Intergenic
1160496378 18:79378411-79378433 GTGATTTTGCAAATAGAAAAAGG - Intergenic
1161733536 19:5977186-5977208 GCATTTGTGCAACTAGAAAAGGG + Intronic
1164105422 19:22105579-22105601 CGGTTTTGTCAAATAGAAAAGGG + Intergenic
1164168392 19:22702692-22702714 TGGTTTTGTCAAATAGAAAAGGG - Intergenic
1165021978 19:32932412-32932434 AGTTTTATATAAATAGAAAAAGG + Intronic
1165851306 19:38851772-38851794 GGGTTTATGGCAATACAAGAGGG + Intronic
925407433 2:3615592-3615614 CGGTTTTGTCAAATAGAAAAGGG - Intronic
926252683 2:11164987-11165009 TGGTTTTGTCAAATAGAAAAGGG - Intronic
927334908 2:21910786-21910808 AAGTTTATGCAAAGAGGAAACGG + Intergenic
927627667 2:24739968-24739990 GGGTTTATTAAAAAAAAAAAGGG - Intronic
928359306 2:30649830-30649852 GGCTTGCTGCAAAAAGAAAATGG - Intergenic
928687138 2:33761317-33761339 CGGTTTTGTCAAATAGAAAAGGG - Intergenic
928895711 2:36260500-36260522 GGGAATCTGCAAAGAGAAAACGG - Intergenic
929090521 2:38212664-38212686 TTGTTGATGGAAATAGAAAATGG + Intergenic
929814385 2:45219696-45219718 GGGGTCATGCAGCTAGAAAATGG - Intergenic
930490920 2:52070687-52070709 GGGTTAATCTAAAGAGAAAATGG - Intergenic
930979318 2:57503477-57503499 GGATTAAAGGAAATAGAAAATGG + Intergenic
932373220 2:71210536-71210558 GAGCTTAAGCAAACAGAAAATGG + Intronic
933171433 2:79130222-79130244 GGGTTGATTGAAATGGAAAATGG - Intergenic
933854085 2:86396494-86396516 TTGTCTATGCAAATAGAAACGGG - Intergenic
935412781 2:102783286-102783308 TGGTTTTTTCAAATAGAAACTGG + Intronic
936044510 2:109176250-109176272 GAGTTTAATAAAATAGAAAAGGG + Intronic
936158191 2:110063850-110063872 CGGTTTTGTCAAATAGAAAAAGG - Intergenic
936186500 2:110307592-110307614 CGGTTTTGTCAAATAGAAAAAGG + Intergenic
936920151 2:117680177-117680199 GTGTGTATGCAAATAGAAGAGGG - Intergenic
938253479 2:129833853-129833875 GGGTTTTGTCGAATAGAAAAGGG + Intergenic
938578444 2:132624920-132624942 AAGTATATGCAAAGAGAAAAGGG - Intronic
938920943 2:135994123-135994145 GAGTTTATGCAAATAATACATGG + Intergenic
939031873 2:137086398-137086420 GGGTGTGGGCAGATAGAAAATGG - Intronic
939400143 2:141682144-141682166 GAGTTTAGGGATATAGAAAATGG + Intronic
939456951 2:142449593-142449615 GGTTTTATGCATATAGTAAGGGG - Intergenic
939519834 2:143215812-143215834 CAGTATATGCAAATAGGAAAAGG + Intronic
939575880 2:143893903-143893925 GGGTCAATGCAAAGAGAAAGGGG - Intergenic
939584152 2:143986700-143986722 GGGTTTATGCATTTTGAAAGAGG - Intronic
939825966 2:147015834-147015856 GTTTTTATGCAAATAGGAAAAGG + Intergenic
940033884 2:149292987-149293009 TGTTTTATTCAAATATAAAATGG + Intergenic
940633334 2:156265579-156265601 GGGTTGTTGCAAATAGATTAAGG - Intergenic
941451029 2:165660359-165660381 TGGCTCATCCAAATAGAAAATGG + Intronic
942412583 2:175726719-175726741 AGGTTTTTGCAAATTGGAAATGG - Intergenic
942808260 2:179962162-179962184 TGTTTTATGCATATAAAAAAGGG + Intronic
945323737 2:208458405-208458427 GATCTTATACAAATAGAAAATGG + Intronic
945487061 2:210408333-210408355 TGGTTAATGCAAATCTAAAATGG - Intergenic
945720931 2:213417491-213417513 GGATTTATGTAAATATTAAATGG + Intronic
947113781 2:226747724-226747746 GGGTGTCTGCAAAGAGAAATTGG - Intronic
948589118 2:239038363-239038385 CGGTTTTGTCAAATAGAAAAGGG - Intergenic
1170420464 20:16187272-16187294 TGGTTGATCCATATAGAAAATGG + Intergenic
1170877122 20:20260682-20260704 GTGTTTAGGCAAAAATAAAAAGG - Intronic
1172191429 20:33064103-33064125 GGGTTTGGGAAAATATAAAAAGG + Intronic
1173406492 20:42770867-42770889 GGGTTTCTGCATGTATAAAATGG + Intronic
1173441188 20:43077692-43077714 GGGTATATGCAGAGGGAAAAAGG + Intronic
1174760891 20:53206465-53206487 GGGTTAAAACAAATAGAGAAGGG + Intronic
1175743713 20:61438520-61438542 GGGTTTGTAAAAGTAGAAAATGG + Intronic
1176656938 21:9595663-9595685 GGGTTGTCGCAAATAGAAAGAGG + Intergenic
1178385527 21:32145945-32145967 GGGTTTTTAGAAATAGAAGAGGG - Intergenic
1181325809 22:22044925-22044947 GGGTCTCTGCAAAGAGAAAAAGG - Intergenic
1184591615 22:45487581-45487603 AGGTTTAAGCAAGTTGAAAAGGG + Intergenic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
951305815 3:21060235-21060257 AAGTGGATGCAAATAGAAAAGGG + Intergenic
951332483 3:21383264-21383286 GGAATTATGCAACTGGAAAAAGG - Intergenic
951645724 3:24889026-24889048 GGAATTTTGCAAATAGAAGATGG + Intergenic
952893944 3:38064464-38064486 CGGTTTTGTCAAATAGAAAAGGG - Intronic
953084952 3:39656186-39656208 CGGTTTTGTCAAATAGAAAAGGG + Intergenic
955644001 3:61117148-61117170 AGATTAATACAAATAGAAAATGG + Intronic
957057325 3:75453621-75453643 GTGTTTATGCAAAAAGAAGTTGG - Intergenic
958691946 3:97480685-97480707 CGGTTTTGTCAAATAGAAAAGGG - Intronic
958968360 3:100584321-100584343 AGGTTTAAGCAAGTTGAAAAGGG - Intergenic
959026624 3:101247248-101247270 GGGTGTATGAAAACTGAAAAAGG + Intronic
959707195 3:109349094-109349116 GGGTTAATGCCATTATAAAAGGG - Intergenic
960196864 3:114779168-114779190 GTGTTAAAGCAAATAGAACAAGG - Intronic
961912272 3:130330264-130330286 AGGTTTATGCCAAGGGAAAAAGG + Intergenic
962151461 3:132897777-132897799 GGGTTAAAGAAAATAGAAACTGG + Intergenic
962688902 3:137873067-137873089 CGGTTTTGTCAAATAGAAAAGGG + Intergenic
962761896 3:138521825-138521847 CGGTTTTGTCAAATAGAAAAGGG + Intronic
963584553 3:147168785-147168807 GGTTTTATTTAAATAAAAAATGG - Intergenic
964331135 3:155604588-155604610 GGTTTAATACAAATAGAAAAAGG - Intronic
964599533 3:158481799-158481821 GAGTTCATCCAAATAGAAAATGG - Intronic
964603426 3:158530098-158530120 GAGTTCAGGCAAGTAGAAAATGG - Intronic
965249852 3:166328767-166328789 GGGTTTATGCAAATGTATACAGG + Intergenic
965576281 3:170221851-170221873 CGATTTATGCAATTAGAAGAAGG + Intergenic
965841053 3:172906159-172906181 GGCTTAAAGTAAATAGAAAAAGG - Intronic
966935209 3:184703192-184703214 AGGTTTAAGCAAAGTGAAAAGGG - Intergenic
967421917 3:189282727-189282749 GGTTTTATGCGAAAAGAAAAGGG - Intronic
967894740 3:194386663-194386685 AGGTTTATGCAGAAAGAAAAAGG + Intergenic
969832693 4:9810686-9810708 GGGATTATGGAATGAGAAAAAGG + Intronic
970294442 4:14613732-14613754 GGGTTTATGCAAAGTGTAATGGG - Intergenic
971404794 4:26312468-26312490 GGGTTGATGTACATAGAATAGGG - Intronic
971981694 4:33759343-33759365 AAATTTATACAAATAGAAAAAGG - Intergenic
972676202 4:41261922-41261944 GGGTAAATGCAAATACAAATCGG + Exonic
973003613 4:44983235-44983257 GAGCTTATGCCAATAGCAAAAGG - Intergenic
975720092 4:77240857-77240879 GGGTTAATGTAAATGGAAAATGG + Intronic
975795878 4:78007019-78007041 CGGTTTTGTCAAATAGAAAAGGG - Intergenic
975966912 4:79985036-79985058 AGCTTTCGGCAAATAGAAAAAGG + Intronic
976255682 4:83098208-83098230 AGGTTTAAGCAAAGTGAAAAGGG + Intronic
976293350 4:83444814-83444836 GGATTTATGCAGAAAGCAAAGGG + Intronic
976626142 4:87184952-87184974 TTATTTATGCCAATAGAAAATGG - Intronic
977928224 4:102725325-102725347 GGGTTCCTGCAAAGAGCAAAGGG - Intronic
979482931 4:121238883-121238905 CGGTTTTGTCAAATAGAAAAGGG + Intergenic
979702600 4:123685297-123685319 CGGTTTTGTCAAATAGAAAAGGG + Intergenic
981254477 4:142645403-142645425 GGTTTTATACTAAAAGAAAAAGG - Intronic
981433049 4:144684752-144684774 TGGTATATGGAAATAAAAAATGG - Intronic
981470473 4:145128590-145128612 GGGTTTTTGGAACTACAAAATGG - Exonic
981993763 4:150954307-150954329 CGGTTTTGTCAAATAGAAAAGGG + Intronic
982716524 4:158814636-158814658 GGGTTTAATCAATGAGAAAAGGG + Intronic
983131131 4:164021407-164021429 GGGGTTAAGTAAATAAAAAATGG - Intronic
983820622 4:172189405-172189427 GGGTTTCTGAGAATACAAAAGGG - Intronic
983965948 4:173810120-173810142 GGGTTTTTGCAGCTGGAAAAGGG + Intergenic
985245336 4:187974847-187974869 CGGTTTTGTCAAATAGAAAAGGG + Intergenic
985339308 4:188931827-188931849 AGGTTTAAGCAAGTTGAAAAGGG + Intergenic
985349168 4:189039282-189039304 TGGTTTTTGAATATAGAAAAAGG + Intergenic
985418772 4:189762235-189762257 GGGTTGTCGCAAATAGAAAGAGG - Intergenic
986246708 5:6013807-6013829 GGGTTAATGCCATTATAAAACGG - Intergenic
986556570 5:9015938-9015960 GTGATAATGCAAATAGGAAAAGG - Intergenic
986578750 5:9241603-9241625 GGATTTATGCAGATATAAAATGG - Intronic
987950661 5:24670646-24670668 AGGTTTGTCCAAATAGAAGATGG + Intergenic
988252164 5:28773196-28773218 GTGTTTATGCAAACATAATATGG + Intergenic
989372394 5:40722978-40723000 CGGTTTTGTCAAATAGAAAAGGG + Intronic
989633604 5:43511570-43511592 CGGTTTTGTCAAATAGAAAAAGG + Intronic
989975083 5:50575649-50575671 GAGTTTATCCAAACATAAAAAGG + Intergenic
990446821 5:55901008-55901030 AGGTGTAAGCAAATAGAGAAAGG - Intronic
990501009 5:56397662-56397684 CGGTTTTGTCAAATAGAAAAGGG - Intergenic
991248374 5:64532340-64532362 GGGTTTATGAAAACAGACACTGG - Intronic
992415708 5:76550806-76550828 CGGTTTTGTCAAATAGAAAAGGG - Intronic
992467415 5:77020635-77020657 GGGTTGATGCAAATTGCAATTGG - Intergenic
994320613 5:98390640-98390662 ATGCTTATGCAAACAGAAAAAGG - Intergenic
994544862 5:101152820-101152842 GGGTTTATTCAAATAATATAAGG - Intergenic
994569239 5:101492382-101492404 GAGTATATTCAAATAGAAAGAGG - Intergenic
996657832 5:125962719-125962741 GCTTTTAAGCAAATAGAAGAAGG + Intergenic
996699988 5:126440910-126440932 TGTTTTATGCAATTAAAAAAAGG - Intronic
996954694 5:129168934-129168956 GTGTTTATGCAAATCTGAAAAGG - Intergenic
997074793 5:130660679-130660701 GGTTTTATACACCTAGAAAATGG - Intergenic
997826530 5:137111681-137111703 GGGGTTATGGAAGTAGAGAAAGG - Intronic
998733148 5:145104189-145104211 AGGTTTATGCAACTAGAAGGTGG + Intergenic
998781438 5:145661152-145661174 TAGTTTCTGGAAATAGAAAAAGG + Intronic
999216505 5:149940140-149940162 AGGATTATGCAGATAGAAAGTGG - Intronic
999586787 5:153098203-153098225 GGGTTTGTGAAAAGAGAATAGGG + Intergenic
999597594 5:153222556-153222578 GGGTTTTTGTAAAAATAAAATGG - Intergenic
1003843808 6:10151151-10151173 AGGTTTATGCAATTTCAAAAAGG - Intronic
1004300660 6:14454406-14454428 GGGTGTATGAAAATAATAAAGGG - Intergenic
1005414412 6:25586001-25586023 CGGTTTTGTCAAATAGAAAAGGG - Intronic
1006902162 6:37510253-37510275 GGGTTCATGCCATTATAAAAGGG - Intergenic
1007190156 6:40008464-40008486 GGGTTTAAAAAAATAGAATAAGG - Intergenic
1007754527 6:44090345-44090367 GGGTCCATGAAAATGGAAAAGGG + Intergenic
1008970269 6:57359130-57359152 GGGTTTTGGCAAATAGAGTATGG + Intronic
1009159237 6:60260954-60260976 GGGTTTTGGCAAATAGAGTATGG + Intergenic
1009492221 6:64305511-64305533 GTCTTTATGCCAATACAAAAAGG - Intronic
1009622583 6:66096598-66096620 CGGTTTTGTCAAATAGAAAAGGG - Intergenic
1009643344 6:66365132-66365154 GGGCATATGGAAAGAGAAAAGGG + Intergenic
1011446158 6:87443263-87443285 GAGTTTAAACAAATAGTAAAAGG - Intronic
1011474107 6:87735796-87735818 CGGTTTTGTCAAATAGAAAAGGG - Intergenic
1012932655 6:105332920-105332942 GGGATAATGCAAATAGCCAAAGG + Intronic
1012950219 6:105510224-105510246 GGGTTTATGCAGAAAGAAGAGGG + Intergenic
1014530260 6:122550644-122550666 CAGTTCATTCAAATAGAAAAGGG - Intronic
1014721888 6:124926950-124926972 AGGATTTTGCAAATAGATAAGGG + Intergenic
1014809642 6:125870911-125870933 GGATTTATGCAGAAAGAAATGGG + Intronic
1015704472 6:136072987-136073009 GGGTTTCTCCAAAAAGAGAAGGG - Intronic
1015937264 6:138416161-138416183 GGGTTTATACAACTAGATAAAGG + Exonic
1016106926 6:140174496-140174518 CGTTTTAAGTAAATAGAAAAAGG - Intergenic
1018478597 6:164167933-164167955 GGGTTTACGCAAAAACAAATGGG + Intergenic
1018528062 6:164736003-164736025 CGGTTTTGTCAAATAGAAAAGGG - Intergenic
1018619790 6:165719014-165719036 GGGGTTTTGGAAATTGAAAATGG + Intronic
1022736163 7:33078097-33078119 GGGTTTGTGCAAGTAGAAGATGG + Intergenic
1023204780 7:37736259-37736281 GAATATATGCAAATGGAAAAAGG + Intronic
1023427020 7:40048476-40048498 GGTTTTATGTAAATAAAATACGG + Intronic
1026527124 7:71163791-71163813 GAGTTGATGCAGATCGAAAAGGG + Intronic
1027760014 7:82265750-82265772 GGGTATAGGCAAACAGAAAATGG - Intronic
1029004783 7:97197434-97197456 GGGTAAATTCCAATAGAAAATGG + Intergenic
1030077768 7:105751255-105751277 GGAGTTATGCATATAGGAAAAGG + Intronic
1031576319 7:123419414-123419436 AGGTTTATGAAAATTGGAAAAGG + Intergenic
1032856480 7:135837882-135837904 GCATTTATGAAAATAGAACAGGG + Intergenic
1034083248 7:148300080-148300102 GGGCGTATGGAAATGGAAAAGGG + Intronic
1034569351 7:151942656-151942678 ATGTTTATGAAAAGAGAAAAAGG + Intergenic
1034824741 7:154251471-154251493 GGATATATGCATATATAAAAGGG + Intronic
1038820682 8:30949283-30949305 TGGTTTATACCAAAAGAAAATGG - Intergenic
1039753105 8:40496279-40496301 CGGTTTTGTCAAATAGAAAAGGG - Intergenic
1039806611 8:41005328-41005350 GGTTTTATGGAAGGAGAAAAGGG + Intergenic
1040616191 8:49041347-49041369 CGGTTTTGTCAAATAGAAAAGGG - Intergenic
1041262020 8:56029255-56029277 GGATTTTTGAAAATAGAAATAGG - Intergenic
1041534088 8:58906363-58906385 ACATTTCTGCAAATAGAAAAGGG + Intronic
1042290609 8:67167177-67167199 CGGTTTTGTCAAATAGAAAAGGG - Intronic
1042565381 8:70105201-70105223 GGGTTTATGCCTTTATAAAAAGG + Intergenic
1043397863 8:79856208-79856230 GGGTTTATGGAGATAGAAGTGGG + Intergenic
1043958424 8:86389609-86389631 GGGTTTTGTCGAATAGAAAAGGG - Intronic
1044048969 8:87475580-87475602 GGTTTTATGCATTTAGGAAAAGG + Intronic
1044918845 8:97146847-97146869 GGGTTTCAGAAAAAAGAAAATGG + Intronic
1046216909 8:111160723-111160745 GGGATTATGGAAATTGAAATAGG + Intergenic
1046414253 8:113890632-113890654 TGGTTTAAGTAAATATAAAATGG + Intergenic
1046422039 8:113999232-113999254 GTGTATGTGAAAATAGAAAATGG - Intergenic
1048088727 8:131214521-131214543 GGATTTCTGCAAGTAGATAAAGG + Intergenic
1050680625 9:8107096-8107118 GGGTTTATGAAAATAGTAAGAGG + Intergenic
1051087527 9:13367718-13367740 GGGTTATTGTAAATATAAAATGG + Intergenic
1051216674 9:14804999-14805021 GGGTTGATTATAATAGAAAATGG + Exonic
1052349457 9:27443670-27443692 GGGTGTATGAGAATAGAAGACGG - Intronic
1052888020 9:33667899-33667921 CGGTTTTGTCAAATAGAAAAGGG + Intergenic
1053604602 9:39644688-39644710 AGGTTTATGCAAGAAGAAGATGG - Intergenic
1053862417 9:42400707-42400729 AGGTTTATGCAAGAAGAAGATGG - Intergenic
1054248940 9:62697726-62697748 AGGTTTATGCAAGAAGAAGATGG + Intergenic
1054563050 9:66732259-66732281 AGGTTTATGCAAGAAGAAGATGG + Intergenic
1055298053 9:74853398-74853420 CGGTTTTGTCAAATAGAAAAAGG + Intronic
1056077520 9:83056795-83056817 TGGTTTGTGCAAAAAGAAAAAGG - Intronic
1056339963 9:85618607-85618629 GGGTTTATTCCAAATGAAAAAGG + Intronic
1060080230 9:120636975-120636997 GGGTTTTGTCCAATAGAAAAGGG + Intronic
1060316551 9:122516622-122516644 GAATTTATGCAGATAGAAATAGG + Intergenic
1060831419 9:126720054-126720076 GGGTATAGGCAAAAAGAAAGGGG - Intergenic
1060900350 9:127251838-127251860 GCTTTTAGGCAGATAGAAAAAGG - Intronic
1061633854 9:131892826-131892848 TGGTTTTTCCAAAAAGAAAAAGG + Intronic
1061771598 9:132927987-132928009 GTGGTTATACAAGTAGAAAAGGG - Intronic
1062150765 9:135017842-135017864 AGGTTTCTGCAAATATAGAAAGG - Intergenic
1203634646 Un_KI270750v1:99135-99157 GGGTTGTCGCAAATAGAAAGAGG + Intergenic
1186032857 X:5389277-5389299 GGGTCTATTCAAAGACAAAATGG - Intergenic
1186817461 X:13252092-13252114 GGTTTTATGTAGATAAAAAACGG - Intergenic
1188686882 X:33080314-33080336 GGGTTTAAGCAAAGTGAAAAGGG - Intronic
1189648146 X:43157074-43157096 TGGTTTGTGGAAAGAGAAAAGGG + Intergenic
1189985165 X:46546864-46546886 GTGTTTATGCAGAAAGAGAAGGG + Intergenic
1190477866 X:50846038-50846060 AGGTTTAAGCAAAGTGAAAAGGG - Intergenic
1191679249 X:63825248-63825270 CGGTTTTGTCAAATAGAAAAGGG - Intergenic
1192350541 X:70352459-70352481 GGGTTTCTGTAACTATAAAATGG + Intronic
1192359847 X:70432560-70432582 GGGTCTGTGAAAATAGGAAAAGG - Exonic
1192530128 X:71876699-71876721 CGGTTTTGTCAAATAGAAAAGGG - Intergenic
1194198476 X:90926215-90926237 GGGTTTATGTATATATGAAAGGG + Intergenic
1195048071 X:101072331-101072353 AGGTTTAAGCAAAATGAAAAGGG + Intergenic
1195864944 X:109421573-109421595 GGGCTGTTGGAAATAGAAAAGGG + Intronic
1195889048 X:109671617-109671639 CGGTTTTGTCAAATAGAAAAGGG + Intronic
1196693690 X:118588244-118588266 TGGTTTTTGTAAATAGTAAATGG - Exonic
1196872087 X:120121944-120121966 GAGTTTTTGCGAATAGAAAATGG + Intergenic
1199036649 X:143058625-143058647 TGGTTAATGGAAATAGTAAAAGG + Intergenic
1199036934 X:143063102-143063124 GAGTATATGCACCTAGAAAAGGG + Intergenic
1199389016 X:147258068-147258090 GGGTGTATGGAAGCAGAAAATGG - Intergenic
1200020623 X:153203055-153203077 GTCTTTCTGCAAAGAGAAAAAGG + Intergenic
1200543263 Y:4486613-4486635 GGGTTTATGTATATATGAAAGGG - Intergenic
1200742160 Y:6865219-6865241 GGGTGTAGGCAAAAAAAAAAGGG + Intergenic
1201336908 Y:12891452-12891474 GGGGAAATGCAAATATAAAAGGG + Intergenic