ID: 1129502140

View in Genome Browser
Species Human (GRCh38)
Location 15:76049500-76049522
Sequence TTGTTGATGAATAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 282}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129502140_1129502144 6 Left 1129502140 15:76049500-76049522 CCTTCTTCCCTATTCATCAACAA 0: 1
1: 0
2: 5
3: 26
4: 282
Right 1129502144 15:76049529-76049551 CTGGAAAGTCTGTTTCTTTGAGG 0: 1
1: 0
2: 1
3: 31
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129502140 Original CRISPR TTGTTGATGAATAGGGAAGA AGG (reversed) Intronic
902681466 1:18046835-18046857 TAGTTGATGAAAAAGTAAGAAGG + Intergenic
902725658 1:18334441-18334463 TTGTTTATGAAATGGGAATATGG + Intronic
905286119 1:36881515-36881537 TTGTTGATGAATTGGGGTGTGGG - Intronic
905384858 1:37595608-37595630 TTGGGGATGAAAAGGGAAAAAGG - Intronic
905806422 1:40880814-40880836 TTGTTAGTGAATAGAGGAGAGGG + Intergenic
907790366 1:57657961-57657983 TTGTTGAAGAAAAGGAAGGATGG - Intronic
908343740 1:63209675-63209697 ATGTTGCTGAATAGTGGAGAAGG - Intergenic
909218720 1:72926857-72926879 TTCCTAAGGAATAGGGAAGAAGG - Intergenic
909754846 1:79212314-79212336 TTATTGATAAATAGTGCAGATGG + Intergenic
909988282 1:82189571-82189593 CTGGTGATGAGGAGGGAAGAGGG - Intergenic
911883779 1:103271981-103272003 TAGTTGATCACTAGGGATGATGG - Intergenic
913358022 1:117945409-117945431 TTATGGATAAATGGGGAAGATGG - Intronic
916091137 1:161308779-161308801 ATCTTGATGTATAAGGAAGAGGG - Intronic
917196261 1:172469106-172469128 CTGTTGATGAAAATGGAATATGG + Intergenic
919059755 1:192617207-192617229 TTGTAAATGAATGGGAAAGAAGG - Intergenic
919421812 1:197379081-197379103 TTGTTTGTGGATAGGAAAGATGG + Intronic
919944166 1:202307678-202307700 TTGTTGGTGGATAGAGAGGATGG - Intronic
922682760 1:227614502-227614524 TTTTTTATAAATAGGGAAGAAGG - Intronic
923300807 1:232638856-232638878 TTGCTGAAGAATAGGGAGCAAGG - Intergenic
1064008387 10:11715624-11715646 TTGGTGATGAATGGGGGAGGAGG + Intergenic
1064806340 10:19138122-19138144 CTGTTGATGAACATGGCAGAAGG - Intronic
1065563650 10:26987992-26988014 TTGTGTATGAATAGGGAGAAAGG + Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1067165735 10:43865129-43865151 TTGTTTTTCAATAAGGAAGATGG - Intergenic
1068919927 10:62472836-62472858 TTGTTGATGAATGGGTAATATGG + Intronic
1069203291 10:65650820-65650842 TTGTTTAGGAATAAGGAAAAAGG - Intergenic
1070985915 10:80689755-80689777 ATGTTTATGAATGGGCAAGAAGG + Intergenic
1071380949 10:85058988-85059010 CTGTTGTTGAGTAGGGGAGAAGG + Intergenic
1073716076 10:106108877-106108899 CTCTTAATAAATAGGGAAGAGGG - Intergenic
1074156403 10:110804061-110804083 TTGTTGAAGGAAAGGGAAGGGGG - Intronic
1075290024 10:121221250-121221272 TTGTTAATGAGAAGGGAAGGAGG - Intergenic
1078237104 11:9495602-9495624 TTACTGATAAATAGTGAAGATGG - Intronic
1078683207 11:13500229-13500251 TTGTGGATGGAGAGGGAAAATGG + Intergenic
1079815229 11:25048202-25048224 TTGTTGGTCTATAGGGTAGAAGG - Intronic
1080456637 11:32425477-32425499 TTGTTTAGGAGTAGGAAAGAGGG + Intronic
1083194388 11:61075340-61075362 TTGTTGATGAATGATAAAGAAGG + Intergenic
1083557886 11:63646732-63646754 TTGTTGATGAATTGGGATGTGGG - Intronic
1085695335 11:78699668-78699690 TAGTTGATGTTTAGTGAAGAAGG - Intronic
1086751039 11:90493798-90493820 TTGTTGATCAAGGGGGATGAAGG + Intergenic
1087675159 11:101153186-101153208 TTGTGGAAGAATAGAGAAGAAGG - Intergenic
1087883340 11:103446059-103446081 TTGTTGTTGTTTAGGGAGGAGGG + Intronic
1088883754 11:113991526-113991548 TTGTTGATGGATAGAGATTAGGG + Intergenic
1090735086 11:129605877-129605899 TTGAGGCTAAATAGGGAAGAAGG - Intergenic
1090747611 11:129719971-129719993 TTATTGATGACTAGGAAGGAAGG - Intergenic
1090924245 11:131235628-131235650 TATGTGATGAATAGTGAAGAGGG - Intergenic
1091275011 11:134344188-134344210 TTGTTGATGCAGAGGGAAGAGGG + Intronic
1093517857 12:20012182-20012204 TTGATGATTAATAAGTAAGATGG + Intergenic
1094436305 12:30424338-30424360 TTGCTGTTGAATAGGAAAGTAGG + Intergenic
1096066086 12:48741937-48741959 TTGATGAAGAATAGGGTAGTTGG - Intergenic
1096709918 12:53447881-53447903 TTGAGGAGGAACAGGGAAGAAGG + Intergenic
1100107711 12:91197112-91197134 TTATTGATTAATAGGAATGAAGG + Intergenic
1100128113 12:91455482-91455504 TTGGTGATGAAAATGGAAAATGG - Intergenic
1102579097 12:113874693-113874715 ATGATGATGGATAGGGAAGGCGG + Intronic
1102620344 12:114189590-114189612 ATGTTCAAGAATGGGGAAGAGGG - Intergenic
1102833345 12:116028572-116028594 TTGATGTTGAATAGGGGTGAAGG - Intronic
1103454859 12:121057278-121057300 TTGTTTCTGTATTGGGAAGAAGG - Intergenic
1106190223 13:27445907-27445929 TTGGGAATGAAAAGGGAAGAGGG + Intronic
1107889848 13:44904595-44904617 TTGGTAATGAGTATGGAAGATGG - Intergenic
1108292066 13:48971921-48971943 TTGGTGATGAAGAGGAGAGATGG - Intergenic
1108376671 13:49820453-49820475 TTGTAGATGGAAAGTGAAGAAGG + Intergenic
1108782102 13:53848928-53848950 ATGTTGATGAAAAGGGAAGATGG + Intergenic
1109714532 13:66204352-66204374 TTGGAGATGAATAAGGAAGTTGG - Intergenic
1109766349 13:66904626-66904648 TCATTGATGAATAGGAAACATGG - Intronic
1110938914 13:81324307-81324329 TAGTTGTTGAATAGGGTGGAAGG + Intergenic
1111461312 13:88546049-88546071 TTGTTGATGGCTAGGGAAAGAGG + Intergenic
1111481641 13:88835055-88835077 GTGTTGATGAATATGAAAAAAGG + Intergenic
1112772765 13:102809741-102809763 TTGGAGATGAATAGTGATGATGG - Intronic
1114251752 14:20967884-20967906 TGGTTGATGAAGGTGGAAGAAGG + Intergenic
1114577019 14:23724816-23724838 ATTTTGATGTATAGTGAAGATGG + Intergenic
1115503325 14:34068520-34068542 TTGTTTATGAATAAGAAAGTGGG - Intronic
1119256905 14:73206397-73206419 TGGTTGGTGAATATGGCAGAAGG + Exonic
1119584880 14:75823872-75823894 TTGTTGAATAAGAGGGCAGAAGG - Intronic
1119851930 14:77872486-77872508 TTCTTGAAGAAGAGGGAAGTGGG + Intronic
1120838053 14:89058596-89058618 TTGCTGTTTAATAGGGAAGTTGG + Intergenic
1120874918 14:89367156-89367178 CTGTTGAAAATTAGGGAAGATGG - Intronic
1121070182 14:91012206-91012228 TTATTGAGGAATAGGGAATAAGG - Intronic
1121631682 14:95425660-95425682 ATGTTAATTAATGGGGAAGATGG + Intronic
1122002838 14:98676715-98676737 TTGTTTATGAATAGAGAAAGAGG - Intergenic
1122680702 14:103459933-103459955 CTGGTGATGAATATGGAAAAGGG - Intronic
1123777719 15:23597229-23597251 TTGCTGTTGAATAGGAAAGCAGG - Intronic
1123949315 15:25255142-25255164 TTGTTGCTCCATAGGTAAGATGG - Intergenic
1124062682 15:26308475-26308497 TTGCTGTTGAATGGGGAAGTGGG + Intergenic
1124694643 15:31853814-31853836 TTGTTGAAGAAGAAGGATGAGGG - Intronic
1126853935 15:52819050-52819072 TTGTTGATGAATTGGAAATGTGG + Intergenic
1127899637 15:63331410-63331432 TTGTTTCTGAATAGGAAAGAAGG + Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1129874692 15:78965990-78966012 TTGGTGTTGAATAAGGCAGAGGG + Intronic
1130367473 15:83253447-83253469 TTGATAATGAATGGGAAAGAAGG + Intergenic
1130380959 15:83372036-83372058 TGGTAGTTGAATGGGGAAGAAGG + Intergenic
1130391965 15:83464670-83464692 TTGCTGATGAATTGGGAATAAGG - Intronic
1131031862 15:89193124-89193146 TTTTTGAAGCAAAGGGAAGAGGG - Intronic
1131966863 15:97853415-97853437 TTCTTCATTAAAAGGGAAGAAGG - Intergenic
1134263264 16:12671181-12671203 ATGTTAATGAATGGGGAAAATGG - Intronic
1134750587 16:16621772-16621794 TTGTTGTTGAATGGGAAAGTGGG + Intergenic
1134787833 16:16961121-16961143 CTGTTGTTGAATAGGCAGGAGGG - Intergenic
1134994867 16:18731814-18731836 TTGTTGTTGAATGGGAAAGTGGG - Intergenic
1135759440 16:25125499-25125521 TTGGAGAGGGATAGGGAAGAGGG - Intronic
1137494035 16:48955620-48955642 TGGTTAATGAATAGGGAAATGGG + Intergenic
1139133666 16:64176668-64176690 TTGTTCCTGAGAAGGGAAGAGGG - Intergenic
1141327501 16:83075500-83075522 TTGTGGATGCAAAGGGAACAGGG + Intronic
1143476668 17:7207189-7207211 GTGAAGATGAATAGGCAAGAGGG + Intronic
1145886818 17:28387824-28387846 TTGGTGGGAAATAGGGAAGAAGG + Intronic
1148946852 17:51270166-51270188 TTCTTAAAGAAAAGGGAAGAAGG - Intronic
1149941853 17:60878626-60878648 TTGTAGATGAACAGGTAAGGGGG - Intronic
1150518064 17:65835609-65835631 TTTTTGAAGAATAGTGAAGTTGG - Intronic
1150965552 17:69963937-69963959 TTGTTAAAGAGTAAGGAAGATGG - Intergenic
1153292922 18:3519469-3519491 TTGTTGAAGATGAGGGAATAGGG - Intronic
1154020274 18:10658514-10658536 TGGTTGACAAAAAGGGAAGATGG + Intergenic
1155448907 18:25943103-25943125 TTGATAAAGAAAAGGGAAGATGG - Intergenic
1156399555 18:36728194-36728216 CTGTTGCTGAGTGGGGAAGAGGG + Intronic
1158092308 18:53728414-53728436 TTGCTGAAGAAGAAGGAAGAGGG + Intergenic
1159201799 18:65195942-65195964 TTGTTGTAGATTAGGGAAGATGG - Intergenic
1159869957 18:73750075-73750097 TTGTTGATGAAAACGGAGGAAGG + Intergenic
1161754900 19:6125441-6125463 TTGTTAATGAATAAAGAAGTTGG - Intronic
1162475515 19:10897147-10897169 TTGGTGAGGAATAGGGATGCTGG + Intronic
1165649449 19:37472871-37472893 TTGAAGATGAATAGAGAAAAAGG + Intronic
1167116114 19:47489936-47489958 TTTCTGATGAATAGGGCAGCAGG - Intronic
1167145117 19:47676615-47676637 CTGATGATGAAGAGGGAAGGCGG - Intronic
925381971 2:3434760-3434782 TTTTTGATGAATTGGGATTAGGG + Intronic
925791630 2:7494396-7494418 TTGTAGAAGAATATGGGAGAAGG + Intergenic
926525649 2:13976669-13976691 ATGTAGATAAATAAGGAAGAAGG + Intergenic
928461130 2:31473684-31473706 TTGTTGATGAATAAGATACAGGG + Intergenic
929706113 2:44213926-44213948 TTCTTTATGAATGAGGAAGAAGG - Intronic
930854315 2:55996316-55996338 TTGATGATGAATAATGAATATGG + Intergenic
932602021 2:73134031-73134053 TTCCTGAGGGATAGGGAAGAGGG + Intronic
934618737 2:95791378-95791400 GTGCTGACAAATAGGGAAGAGGG + Intergenic
934642156 2:96033179-96033201 GTGCTGACAAATAGGGAAGAGGG - Intronic
934670919 2:96212156-96212178 TTGTTAATGAAGATGGAAAAAGG - Intergenic
934695907 2:96400012-96400034 CTGTTGCTGAGGAGGGAAGAGGG - Intergenic
934745428 2:96756486-96756508 GTGTGGATGATGAGGGAAGAAGG - Intergenic
935224573 2:101042173-101042195 ATGTTGATGAGGAGGAAAGAAGG + Intronic
935327455 2:101949609-101949631 TTGTTTTTGAATATGGAATAAGG - Intergenic
935849711 2:107205145-107205167 TTGAAGAAGAATACGGAAGAAGG + Intergenic
936659674 2:114528819-114528841 TTGATGATGAATCAGGAAGAAGG - Intronic
937570964 2:123360844-123360866 TTGCTGATGAAAATGGGAGAAGG - Intergenic
937818362 2:126279078-126279100 TTCTTGATAAATAGGAAAGATGG + Intergenic
938090941 2:128434346-128434368 TTGTTGCTGGTTAGGGAAGGAGG + Intergenic
938878011 2:135554181-135554203 TTGCTGAGGACTGGGGAAGAGGG - Intronic
938954285 2:136283913-136283935 TTGCTGATGTATGGGGGAGATGG - Intergenic
939442030 2:142261784-142261806 TTGTTGATGTGTAAGGAAGAAGG + Intergenic
939607652 2:144272441-144272463 TTGTTGCTGCTTAGGGAATATGG - Intronic
939854315 2:147339622-147339644 TTGTTTGTGAATTGGGAAGCTGG - Intergenic
940963378 2:159810640-159810662 ATCTTGATGAATATGTAAGACGG + Exonic
941341625 2:164312388-164312410 TTGTTCATTAATACGGAAGTGGG + Intergenic
942474044 2:176296618-176296640 TTGTTTTTTAATGGGGAAGAGGG - Intronic
943016558 2:182517573-182517595 CTGTGGTTGAATAGGGAAGGTGG + Intronic
944116564 2:196193216-196193238 TTGTTATTGAAGGGGGAAGAGGG - Intergenic
944297239 2:198080203-198080225 TTGTGTATGTATTGGGAAGATGG - Intronic
945364690 2:208937531-208937553 ATGTTGAAGAATAGGAAACATGG - Intergenic
946030807 2:216703311-216703333 TTGTTGGTGAATGAGGAAGGAGG + Intergenic
1168736839 20:147639-147661 TTCTTGTTGAATAAGTAAGAGGG + Intergenic
1169571844 20:6914767-6914789 TTGTTGCTGGAGAAGGAAGAGGG + Intergenic
1170412191 20:16103896-16103918 ATGTTGAAGGATAGAGAAGAGGG + Intergenic
1170662707 20:18358593-18358615 TTCTTGGTGAATTGGGAACAGGG - Intergenic
1171287685 20:23955405-23955427 TTGTGTATAAATAGGGCAGAAGG - Intergenic
1173517707 20:43676920-43676942 TTGTTTTTAAATAGAGAAGAGGG + Intronic
1174465228 20:50712138-50712160 TTCTTGATGAAGAGGGAGGTGGG + Intergenic
1174628764 20:51938161-51938183 TTGTCTCTGAAGAGGGAAGATGG - Intergenic
1174874579 20:54212858-54212880 ATTTTGATGAATATGGAAGTTGG - Intronic
1175413439 20:58786166-58786188 TTGTTGATTACTAGGGATGTGGG + Intergenic
1175705438 20:61173206-61173228 TGGTTGATGGATAGTGGAGATGG - Intergenic
1176983390 21:15408601-15408623 TTGTTGGAGAGTAAGGAAGATGG + Intergenic
1177492830 21:21849658-21849680 TTTTTGAAGAATAGAGAAGATGG - Intergenic
1182791109 22:32953830-32953852 ATGTTGATGAAGAAGGAGGAGGG - Intronic
1183757782 22:39785974-39785996 TTCTTGATGAATAGGAAAGAAGG - Intronic
1185164011 22:49247212-49247234 TTGCTGGGGAATAGGAAAGATGG + Intergenic
949480129 3:4485862-4485884 CTGGTGAGGAATAGGGTAGAGGG - Intergenic
951374541 3:21897254-21897276 TTATTGATAAACAGGCAAGAGGG + Intronic
954913775 3:54131604-54131626 TTGTTCATGAATAATGAAGTGGG - Intronic
955271138 3:57500505-57500527 TAGTTAAAGAATAGGGAACAGGG - Intronic
955719342 3:61865092-61865114 TTGCTGATTAATGGGGATGATGG + Intronic
956105574 3:65814225-65814247 ATGTAGATGAATATGAAAGAAGG - Intronic
957746030 3:84344605-84344627 TTGTTGATGTATAGGAATGCTGG + Intergenic
958925311 3:100150789-100150811 CTGATGCTGAAGAGGGAAGAGGG - Intronic
961414149 3:126745195-126745217 TTATTAAAGAAGAGGGAAGAGGG + Intronic
962299274 3:134223557-134223579 TTGTTTATAAAAAGGGAGGAGGG + Intronic
962672081 3:137718628-137718650 TTGTTGGTGTATAGGAATGATGG + Intergenic
964506232 3:157403026-157403048 TTTTTGATAAATAATGAAGAAGG + Intronic
964822980 3:160794304-160794326 TAGTTGATGAGTGGGGAAAAGGG + Intronic
965991599 3:174825659-174825681 TGTTTAAGGAATAGGGAAGAAGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
969547220 4:7838417-7838439 TTGTTCAAGCATAGGCAAGATGG - Intronic
969851992 4:9964822-9964844 TTGTTGATGGAGAGGCAAGAGGG - Intronic
970013066 4:11481833-11481855 ATGTTGAAGAATAGGGAAATGGG - Intergenic
970633741 4:17983571-17983593 TTGTTGGTGTATAGGAATGAGGG + Intronic
970676599 4:18457435-18457457 TTGTTGAAAAATAGGAAAGGAGG - Intergenic
970748654 4:19331347-19331369 TTGTAGATGTATAGGAAAGAAGG + Intergenic
971556533 4:28019461-28019483 TTGTGGATGAATTGGAAATAGGG - Intergenic
971864357 4:32150187-32150209 TTGTTGAAGAGTAGTGAAAATGG + Intergenic
972310145 4:37873827-37873849 TTGTTGATGAATATTGAGGTTGG + Intergenic
974677414 4:65111443-65111465 TTGTTGACGAACAAGGAAGCAGG + Intergenic
977041091 4:92020035-92020057 CTGTTCTTAAATAGGGAAGAAGG - Intergenic
977444267 4:97109565-97109587 TTGTAGAAGAATATGGAAGAAGG + Intergenic
977791358 4:101107531-101107553 CTGGTGATGATGAGGGAAGAAGG - Intronic
977922190 4:102658033-102658055 TGGTTGTTGAATAGGGAAGAAGG - Intronic
978035137 4:103983901-103983923 TTGGAGATGGAGAGGGAAGAGGG + Intergenic
978398323 4:108306043-108306065 ATGTTGATGATTAGGGGAGTGGG - Intergenic
978573647 4:110166759-110166781 GGGTTGATGAAAAAGGAAGACGG - Intronic
978975957 4:114872922-114872944 TTGTTGTTGAAAAGGGCAAAAGG - Intronic
979806110 4:124973357-124973379 TTGATCATGATTAGGCAAGAAGG + Intergenic
980389691 4:132126991-132127013 GTGTTTATGAATAGGGAAAGAGG - Intergenic
980988454 4:139718048-139718070 TTTCTGATGAGTAGGGATGATGG + Exonic
981691201 4:147511613-147511635 GTGATGATGAATAGGAAAAAGGG - Intronic
982118841 4:152119743-152119765 TTGATGATGAAGAGGCACGAGGG - Intergenic
984165094 4:176296617-176296639 AGGGTGAGGAATAGGGAAGAAGG + Intergenic
984623120 4:181975736-181975758 TTGTGGATAAATATGGAAGCCGG + Intergenic
985350059 4:189050648-189050670 GTGTGGATGAATAGGGAACGTGG - Intergenic
987535367 5:19180467-19180489 CTGATGATGAATAGGTAAAAAGG + Intergenic
989295553 5:39821623-39821645 CTGTTTGTGACTAGGGAAGATGG + Intergenic
991079778 5:62585844-62585866 TTGTTGATGAATTGAGTAAATGG + Intronic
991585327 5:68196204-68196226 TGGTTGATGGTTAGGGGAGAGGG - Intronic
993574781 5:89587396-89587418 TTGTAAATCAAAAGGGAAGAAGG - Intergenic
994108738 5:95976262-95976284 TTGTTGATACTTAGGTAAGATGG + Intergenic
994819062 5:104624930-104624952 CTGCTGTTGAATTGGGAAGAAGG + Intergenic
995119305 5:108519085-108519107 TTGATAAGGAAAAGGGAAGATGG - Intergenic
995954841 5:117764645-117764667 TTCTAAATGAATAGGGAAAATGG - Intergenic
996417822 5:123229178-123229200 ATGTTGAAGGTTAGGGAAGATGG - Intergenic
998031342 5:138871546-138871568 CTGCTGCTGAAAAGGGAAGAGGG - Exonic
998267676 5:140678291-140678313 TTCTGGATGAATAGGGAAAATGG - Intronic
999589569 5:153130360-153130382 TTGGTGAGGAAAAGGGAAGATGG - Intergenic
1000096244 5:157973364-157973386 TTGTTGGAAAAAAGGGAAGAAGG - Intergenic
1000312591 5:160059611-160059633 TTGTTGTGGCTTAGGGAAGAGGG + Intronic
1000466370 5:161582743-161582765 TTGTTGATCACCAGGGCAGAGGG - Intronic
1002288354 5:178180608-178180630 TTGACGAAGAAAAGGGAAGATGG - Intergenic
1002624038 5:180511946-180511968 CTTTTGATGGAAAGGGAAGAAGG - Intronic
1003033789 6:2624896-2624918 TTGTTGTTGAATGGGGAATCTGG + Intronic
1003294436 6:4811896-4811918 GAGCTGATGAATGGGGAAGAGGG - Intronic
1004144742 6:13054874-13054896 TTGAGGATGTAGAGGGAAGAAGG - Intronic
1004629912 6:17411389-17411411 TTGCTGGTGAATATGGAAAATGG - Intronic
1005295398 6:24420804-24420826 TTGTTCATGAAATGGCAAGAAGG + Intronic
1007465141 6:42046394-42046416 TGGTAGATGAGTAAGGAAGATGG - Intronic
1007572102 6:42900239-42900261 TTGTTGGGGAAATGGGAAGAGGG - Intergenic
1008162348 6:48093789-48093811 TGGTCCATGAATAGGGATGATGG + Intergenic
1008422008 6:51311998-51312020 TTTTTGTTGAATAGAGAAGCAGG - Intergenic
1008838713 6:55870348-55870370 TTGTTGAAGAAGAGAGAAAAAGG + Intronic
1009550368 6:65084878-65084900 TTGTGGAGGAATAAGAAAGAGGG + Intronic
1009809397 6:68640627-68640649 TGGTTGAGGAAAAGGAAAGAGGG - Intronic
1010828905 6:80507349-80507371 TTGTTGATGCCTAGGGAGGAAGG + Intergenic
1011513026 6:88122432-88122454 TTGTAGATGAATAGGGCACAGGG + Intergenic
1012304741 6:97640410-97640432 TTATGCATGAATAGGGAATATGG + Intergenic
1012326415 6:97924800-97924822 TCATTGATGAAAAGGGAAGTAGG - Intergenic
1012995274 6:105966685-105966707 CTGATGATGAAGTGGGAAGATGG - Intergenic
1013420103 6:109959705-109959727 TTGATGCTGAAGAGGCAAGAAGG - Intergenic
1014801037 6:125778177-125778199 TTGGTGATAATTAGGGTAGAAGG - Intergenic
1015321270 6:131878080-131878102 TTTTTGATGAAAAGGACAGAAGG - Intronic
1017358688 6:153541273-153541295 TTGTTGATTGATAGGGATAAGGG - Intergenic
1017752982 6:157505701-157505723 TTGTTCATGGATAGGGAGGCAGG + Intronic
1017945809 6:159095546-159095568 TTGTCAAAGAACAGGGAAGAAGG + Intergenic
1018138948 6:160807491-160807513 TTGTTACTTAATAGAGAAGAAGG + Intergenic
1018258174 6:161942923-161942945 AAGATGATGATTAGGGAAGATGG + Intronic
1019923110 7:4175192-4175214 ATGTTGATGAATGTTGAAGACGG + Intronic
1020442760 7:8235944-8235966 TTGTTGATGATTTGGGGAGAAGG + Exonic
1020712326 7:11623449-11623471 TAGATGATGAATAAGGAAGGAGG - Intronic
1021048408 7:15952247-15952269 TTTTATATGAATAGGAAAGAAGG - Intergenic
1029191613 7:98776078-98776100 TGTTTGATGAAGGGGGAAGAGGG + Intergenic
1030015439 7:105215386-105215408 TTGATGATGAAAATGGAAAATGG + Intronic
1030814456 7:114017939-114017961 TAGCTGATGAATAGTTAAGATGG + Intronic
1030946086 7:115722481-115722503 TTGTAGATAAACAGGAAAGAGGG + Intergenic
1032538565 7:132684883-132684905 TGGTGGATGAGTGGGGAAGAGGG - Intronic
1033543678 7:142380766-142380788 GTGTTGATGAAAGGGGAACAGGG - Intergenic
1033642147 7:143271564-143271586 TTATTGATCAGAAGGGAAGAGGG - Intergenic
1033975812 7:147099192-147099214 TCTGGGATGAATAGGGAAGACGG + Intronic
1034186614 7:149182850-149182872 TTATTAATGAAAAGGGAAGTAGG - Intergenic
1034294987 7:149964243-149964265 TTTTTGATGAATAAGGAATAGGG + Intergenic
1034811074 7:154132703-154132725 TTTTTGATGAATAAGGAATAGGG - Intronic
1038988765 8:32843128-32843150 TTGTTGAGGGATATAGAAGACGG + Intergenic
1039842205 8:41302277-41302299 TTGTGGATGAAGATGGAAGCTGG - Intronic
1039873998 8:41569944-41569966 TTGATCATGAATAGGGCAGGTGG + Intergenic
1040022933 8:42756689-42756711 TTGATGATCAAAAGGGAAAAAGG + Exonic
1041012810 8:53560277-53560299 CTGTTGATGAGTGGGGGAGATGG - Intergenic
1041594895 8:59637925-59637947 TTGTAGAATAATAGGGAAGATGG + Intergenic
1041601075 8:59717902-59717924 TTGGCAAGGAATAGGGAAGATGG - Intergenic
1042322051 8:67486366-67486388 TTGCAGATCAATAGGGAAAATGG + Intronic
1043663744 8:82781857-82781879 TAGCTGATAAATTGGGAAGATGG - Intergenic
1045643493 8:104278260-104278282 TTGCTGTTGAATAGGAAAGCAGG - Intergenic
1046304219 8:112341548-112341570 GTGGTGCTGAATAAGGAAGATGG + Exonic
1046468634 8:114638502-114638524 TTATTAATGAATAAGGAAGAGGG + Intergenic
1046486435 8:114894399-114894421 TTGTTGGGGAATAGGGGACAAGG + Intergenic
1046699742 8:117386768-117386790 TTGTTGATCCAAAGGGAAGATGG - Intergenic
1047266474 8:123314308-123314330 CTGTGGATGAATAGGCAAAAGGG + Intergenic
1047647686 8:126886163-126886185 GTGTTTAAGAAGAGGGAAGAAGG - Intergenic
1047678808 8:127232499-127232521 TTGTTGATAGATAGGGAAATAGG - Intergenic
1048164355 8:132049083-132049105 TTGTTAATGAAGAGGGGAAAGGG + Intronic
1048909699 8:139123301-139123323 TAATTGATGGAAAGGGAAGATGG + Intergenic
1050266467 9:3895692-3895714 ATGAAGATGAACAGGGAAGATGG - Intronic
1050932789 9:11350677-11350699 TTGTTCATAAATAGTGCAGATGG - Intergenic
1051577422 9:18632906-18632928 TTGTTGAGGAAGAGGGTATATGG - Intronic
1051784051 9:20722306-20722328 TTGTGGATGTCTAGAGAAGAGGG - Intronic
1052791884 9:32882869-32882891 TTAATGACTAATAGGGAAGAGGG - Intergenic
1053408352 9:37897895-37897917 TAGATGATAAATAGGGAGGAGGG - Intronic
1054748637 9:68881745-68881767 TTGTCTAGGAATAAGGAAGAAGG - Intronic
1056339763 9:85615262-85615284 TTGCTGAAGACTAGGGAAAATGG - Intronic
1056782833 9:89564206-89564228 TTTTTGTTGAATGGGGAATAAGG + Intergenic
1057784436 9:98075981-98076003 TTGTTGATGAATACTAGAGAAGG + Intronic
1057936134 9:99240402-99240424 TTGTACCTGAATAGGGAATAGGG - Intergenic
1058920321 9:109608284-109608306 TTGTTGAATAATAGGAAAAAAGG - Intergenic
1059073072 9:111159985-111160007 TTGTTGTTGAGTTGGCAAGATGG - Intergenic
1060675880 9:125514154-125514176 TAGGTGAAGAAGAGGGAAGAGGG - Intronic
1060899478 9:127245046-127245068 TTAGTGATAAAGAGGGAAGACGG - Intronic
1062132199 9:134903772-134903794 GTGTTGAAGAAAATGGAAGATGG + Intergenic
1062195614 9:135272306-135272328 TTGTTGTTTCATAGGTAAGACGG - Intergenic
1186380175 X:9049508-9049530 AAGGTGATGAAGAGGGAAGATGG - Intronic
1187346985 X:18474438-18474460 TTGTTGAGGATGAGGGAAAATGG - Intronic
1187430955 X:19224290-19224312 TTGTTGAGGATTAGAGAAGCAGG + Intergenic
1187770798 X:22693352-22693374 TTGTTGATAAATATTGAAGCTGG - Intergenic
1187830290 X:23374250-23374272 TTCTTGTTGAAAAGGGAGGAGGG - Intronic
1189953887 X:46259091-46259113 TTGATAAAGAAAAGGGAAGATGG - Intergenic
1193075925 X:77355551-77355573 GTGGTTTTGAATAGGGAAGAGGG + Intergenic
1194967347 X:100303728-100303750 TTGCTGAAAAAAAGGGAAGAAGG - Intronic
1196294177 X:113979909-113979931 TTGCTGTTGAATGGGAAAGAGGG + Intergenic
1197074240 X:122336387-122336409 TAGTGGATCACTAGGGAAGATGG + Intergenic
1199593322 X:149488054-149488076 TTATTGATGAGTGGGTAAGAGGG - Intronic
1199598696 X:149527377-149527399 TTATTGATGAGTGGGTAAGAGGG + Intronic
1199974902 X:152888505-152888527 TTGTTGATGTAAAGGGAAGAAGG + Intergenic