ID: 1129502144

View in Genome Browser
Species Human (GRCh38)
Location 15:76049529-76049551
Sequence CTGGAAAGTCTGTTTCTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 304}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129502140_1129502144 6 Left 1129502140 15:76049500-76049522 CCTTCTTCCCTATTCATCAACAA 0: 1
1: 0
2: 5
3: 26
4: 282
Right 1129502144 15:76049529-76049551 CTGGAAAGTCTGTTTCTTTGAGG 0: 1
1: 0
2: 1
3: 31
4: 304
1129502141_1129502144 -1 Left 1129502141 15:76049507-76049529 CCCTATTCATCAACAATATCTAC 0: 1
1: 2
2: 1
3: 15
4: 193
Right 1129502144 15:76049529-76049551 CTGGAAAGTCTGTTTCTTTGAGG 0: 1
1: 0
2: 1
3: 31
4: 304
1129502142_1129502144 -2 Left 1129502142 15:76049508-76049530 CCTATTCATCAACAATATCTACT 0: 2
1: 0
2: 2
3: 20
4: 203
Right 1129502144 15:76049529-76049551 CTGGAAAGTCTGTTTCTTTGAGG 0: 1
1: 0
2: 1
3: 31
4: 304
1129502138_1129502144 8 Left 1129502138 15:76049498-76049520 CCCCTTCTTCCCTATTCATCAAC 0: 1
1: 0
2: 2
3: 30
4: 319
Right 1129502144 15:76049529-76049551 CTGGAAAGTCTGTTTCTTTGAGG 0: 1
1: 0
2: 1
3: 31
4: 304
1129502139_1129502144 7 Left 1129502139 15:76049499-76049521 CCCTTCTTCCCTATTCATCAACA 0: 1
1: 0
2: 3
3: 27
4: 326
Right 1129502144 15:76049529-76049551 CTGGAAAGTCTGTTTCTTTGAGG 0: 1
1: 0
2: 1
3: 31
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129502144 Original CRISPR CTGGAAAGTCTGTTTCTTTG AGG Intronic
902681765 1:18048784-18048806 CTGGAAAAGCTGTTTGTTTGTGG - Intergenic
903635793 1:24814471-24814493 CAGGAAAGACTGGTTATTTGTGG + Intronic
903898513 1:26624815-26624837 CTGTAAAGTGGTTTTCTTTGAGG - Intergenic
905554457 1:38871324-38871346 CCTGAAACTCTGTTTCTTTCAGG + Intronic
905589346 1:39149036-39149058 AAGGAAAGTCAGTTTTTTTGAGG + Intronic
906462204 1:46043414-46043436 TTTGAAAGTCTGTTTCATTGGGG - Exonic
907763310 1:57383353-57383375 CTACAAAGTCTGATTCATTGTGG - Intronic
910262220 1:85303753-85303775 CTGGGAAGCCTGGTTCCTTGTGG + Intergenic
910526747 1:88187540-88187562 CTAGGAATTCTGTTCCTTTGGGG - Intergenic
912077863 1:105899182-105899204 CTGGAGAATCTTTTTCTTTTAGG - Intergenic
912652719 1:111454167-111454189 ATGTAAAGCCTGTTTCTTTAAGG - Intronic
913448645 1:118976457-118976479 CGGTAAAGTCTGGTTTTTTGGGG + Intronic
913561992 1:120030750-120030772 CTGAAAAGTCTGTTTTTGGGAGG - Intronic
913594781 1:120364663-120364685 CTGAAAAGTCTTTTTCTTTTTGG + Intergenic
913636133 1:120762843-120762865 CTGAAAAGTCTGTTTTTGGGAGG + Intergenic
914092486 1:144514323-144514345 CTGAAAAGTCTTTTTCTTTTTGG - Intergenic
914251264 1:145923799-145923821 CTGGTATGTCTGTTATTTTGTGG - Intergenic
914282576 1:146190144-146190166 CTGAAAAGTCTGTTTTTGGGAGG - Intronic
914306044 1:146419552-146419574 CTGAAAAGTCTTTTTCTTTTTGG + Intergenic
914324592 1:146599515-146599537 TTGGAAAGTTTTCTTCTTTGTGG + Intergenic
914543606 1:148640860-148640882 CTGAAAAGTCTGTTTTTGGGAGG - Intronic
914596007 1:149153260-149153282 CTGAAAAGTCTTTTTCTTTTTGG - Intergenic
914623016 1:149430149-149430171 CTGAAAAGTCTGTTTTTGGGAGG + Intergenic
914928433 1:151908696-151908718 CTGGAAAAAGTGTTTCTTTGCGG + Intronic
917195411 1:172459481-172459503 ATGGAAAGTGTGTCTCATTGTGG - Intronic
917736505 1:177925993-177926015 CTAGAAAGTCTCTTTCTTTTTGG - Intronic
918721614 1:187859300-187859322 CTGTTAAGTCTGTTTCTTCCAGG + Intergenic
918972760 1:191440902-191440924 GTGGATTATCTGTTTCTTTGGGG + Intergenic
921987693 1:221330022-221330044 CTGAAAACTGTGTTTCTTTAGGG - Intergenic
923305672 1:232686118-232686140 CTGGACACTTGGTTTCTTTGGGG - Intergenic
924304046 1:242668604-242668626 CTGGGAAGTTTGCTACTTTGGGG + Intergenic
1063543616 10:6958870-6958892 CTGGAGAGGCTTTTGCTTTGTGG + Intergenic
1063600957 10:7481005-7481027 CTGGAAATGCTTTTACTTTGGGG - Intergenic
1065087040 10:22188857-22188879 CTCAAAAGTCTTTTTTTTTGCGG - Intergenic
1065785044 10:29204986-29205008 ATGAAAACTCTGTTTCTTTGTGG + Intergenic
1066339553 10:34517300-34517322 AGGGAAACACTGTTTCTTTGAGG - Intronic
1068527818 10:58150707-58150729 TTGGAAAATGTGTTTCTTTTTGG + Intergenic
1069328827 10:67265543-67265565 GTTTAAAGTCTGTTTCTATGGGG + Intronic
1070376370 10:75835186-75835208 ATGGGAAGGCTGTTTCTTTTGGG + Intronic
1070678707 10:78433935-78433957 CTGCAAGGTCTGGTTCTTTCTGG - Intergenic
1071877216 10:89854261-89854283 CTGGAATTTTTTTTTCTTTGTGG - Intergenic
1072049824 10:91692245-91692267 TTGGAAAGTCTTTATCTTTCTGG + Intergenic
1072550135 10:96470992-96471014 TTGGGAAGTCTTTTTTTTTGAGG + Intronic
1073690646 10:105805294-105805316 CTGGATGGGCTGTTTCTTTGGGG + Intergenic
1073769165 10:106716531-106716553 CTGGCAAGTCTGTGTCTTGAGGG + Intronic
1074286578 10:112103474-112103496 CTCTCAAGTCTGTTTCTTTTTGG - Intergenic
1074894973 10:117768573-117768595 CTAGCAAGTCTTTTTCTGTGGGG + Intergenic
1077339404 11:2019302-2019324 CTGGAAGGTGTGTGTCTATGGGG - Intergenic
1077455894 11:2680321-2680343 CTGGAAAGACTTTTTTTTTGAGG - Intronic
1079007861 11:16804854-16804876 CAGCACAGTCTGTTTGTTTGTGG - Intronic
1079929049 11:26534826-26534848 CTCAAAAGTCTGATTATTTGAGG - Intronic
1081169844 11:39853303-39853325 CAGGAAAGTCTTTTTCTATTGGG + Intergenic
1082263645 11:50097051-50097073 ATGGAATGTCAGTTTCCTTGGGG - Intergenic
1083575139 11:63785090-63785112 CTTGAAGTTCTGTTTCTGTGGGG - Intergenic
1085619039 11:78023377-78023399 ATGGACAGTCTGTCTATTTGGGG + Intronic
1086864312 11:91960766-91960788 CTGGCAATTCAGTTTTTTTGGGG - Intergenic
1086934658 11:92731498-92731520 TTGTAAAGTCTGTATCTCTGTGG - Intronic
1088586030 11:111360639-111360661 CAGGAAAGTCTGATTCTAGGGGG + Intronic
1089916767 11:122164662-122164684 CTGGAAAGTCTCCATCTCTGTGG - Intergenic
1090490418 11:127155693-127155715 CTGGGAAGTATCTTGCTTTGAGG - Intergenic
1090688434 11:129151086-129151108 CTTTAAAGTCTGTTTTTTTCTGG - Intronic
1202822389 11_KI270721v1_random:74491-74513 CTGGAAGGTGTGTGTCTATGGGG - Intergenic
1092100398 12:5878819-5878841 CTGGACAGTGTGTTTCTTCAGGG - Intronic
1093429306 12:19065970-19065992 CTACAAAGAGTGTTTCTTTGTGG - Intergenic
1094017107 12:25876749-25876771 CTTGAAAGCCTGTTACTTGGAGG - Intergenic
1094120027 12:26962392-26962414 CTGAAGAGACTGTTTATTTGGGG + Intronic
1094129259 12:27057478-27057500 ATGGATATTCTCTTTCTTTGAGG - Intronic
1094391222 12:29952448-29952470 CTGGACACTCTATTTCTTTGGGG + Intergenic
1096209253 12:49750457-49750479 CTGGAAAGTGTCTTTGTTTAAGG - Intronic
1097424598 12:59427765-59427787 CTGGAAAATCTGGTTTTCTGTGG + Intergenic
1098002602 12:65960990-65961012 CTGAAAATTCTGTTTCCTTCCGG + Intronic
1099842743 12:87986642-87986664 GAGGAAAGTGTTTTTCTTTGAGG - Intronic
1099847107 12:88041463-88041485 ATGGAAATTCTGATTTTTTGAGG + Intronic
1100994336 12:100286573-100286595 CTGAAATGACTGTTTCTGTGAGG + Intronic
1101602644 12:106224032-106224054 CTGGAAAGTTTCTTTTGTTGGGG - Intergenic
1102688750 12:114744077-114744099 CTCCAATATCTGTTTCTTTGGGG + Intergenic
1103127100 12:118433101-118433123 CTGGAAAGTGTGTTTTGTTTGGG + Intergenic
1103226688 12:119293739-119293761 GTAGAACTTCTGTTTCTTTGGGG + Intergenic
1104633652 12:130424773-130424795 CTGAAAAGTCTCTTCCTGTGGGG + Intronic
1104673704 12:130698164-130698186 CTTGAAAGTCTTTATCTCTGGGG - Intronic
1106609754 13:31267109-31267131 TTGAAAATTCTTTTTCTTTGAGG - Intronic
1106800370 13:33250240-33250262 AAGGAAAGTCAGTTACTTTGGGG + Intronic
1110677469 13:78266519-78266541 CTGGATGGTCTGATACTTTGGGG + Intergenic
1111984096 13:95048077-95048099 ATGTAAATTCTATTTCTTTGTGG - Intronic
1113469485 13:110534274-110534296 CTGTCAGGTCTGTTTCTCTGGGG + Intronic
1114168488 14:20246716-20246738 ATGGGTACTCTGTTTCTTTGGGG + Intergenic
1114455328 14:22849945-22849967 CTGGAAAGTCTGTCAGATTGTGG - Intergenic
1114760837 14:25312052-25312074 CTGGAAAGTCTGCTCCTCCGAGG - Intergenic
1115238635 14:31232908-31232930 CTGGTCAATCTGATTCTTTGGGG - Intergenic
1117534797 14:56693662-56693684 TTTGAAACTCTGTTTCTTTCTGG + Intronic
1117576864 14:57107463-57107485 CTGTAAATTCTGTTGATTTGGGG - Intergenic
1117756015 14:58974983-58975005 CTGCAAAGTCTTTTTCGTTAAGG + Intergenic
1117889295 14:60400343-60400365 CTGGTATGTCTGTTATTTTGTGG + Intronic
1119532860 14:75375138-75375160 CTGGAAACTCTGCATATTTGTGG + Intergenic
1119596847 14:75942998-75943020 CTGGAAATTCTGTCTTTTTTTGG - Intronic
1119971397 14:78974650-78974672 CTTGACAGTCTCTTTGTTTGTGG + Intronic
1120187260 14:81406622-81406644 ATGGAAAGCCTGTGTCTTAGGGG - Intronic
1120259477 14:82163347-82163369 CTGTAAAATCTGTTTCTGTCTGG + Intergenic
1120670994 14:87362457-87362479 TTGGTAGGTCTCTTTCTTTGGGG + Intergenic
1122022343 14:98848561-98848583 CTGGAACCCCTGTTTCTATGGGG + Intergenic
1125033827 15:35100386-35100408 CTGCAAAGTTGATTTCTTTGGGG + Intergenic
1125308417 15:38349996-38350018 CTGGGAAGGTTGGTTCTTTGAGG - Intronic
1126608385 15:50503738-50503760 CTAGAAATTCTGTTTCCTTCTGG - Exonic
1127286567 15:57538585-57538607 CAGGGAAGTCTGTTTCCTGGTGG + Intronic
1127590676 15:60419219-60419241 CTTCAAAATCTGTTTCTTTTGGG - Intergenic
1129057864 15:72834892-72834914 CTGGAATGTTGGTTTCTTTGGGG + Intergenic
1129098672 15:73237073-73237095 CTAGAAAGTCAGTTACATTGGGG - Intronic
1129454184 15:75667654-75667676 CTGGGCAGTCAGGTTCTTTGGGG + Intergenic
1129502144 15:76049529-76049551 CTGGAAAGTCTGTTTCTTTGAGG + Intronic
1130060250 15:80564397-80564419 CTGGAAAGAAGGTTACTTTGTGG - Intronic
1130867845 15:87947583-87947605 CTGGAAACTCTGTTTCTGGGTGG - Intronic
1130916336 15:88307975-88307997 CTGGAATGGATGTTTCTTTGAGG - Intergenic
1132242702 15:100271290-100271312 ATGGTAATTCTGTTTCATTGAGG + Intronic
1133315180 16:4878524-4878546 ATGGAAACTGTGCTTCTTTGAGG + Intronic
1134887336 16:17805288-17805310 CAGGATACTCTGTTTCTCTGTGG + Intergenic
1135020982 16:18962631-18962653 CCAGCAAGTCTGTGTCTTTGTGG + Intergenic
1136566172 16:31072058-31072080 CTAGTAAGCTTGTTTCTTTGTGG - Intronic
1136676910 16:31918762-31918784 CTGCAGAGTCTGTTTCCTTTGGG + Intergenic
1137989853 16:53143125-53143147 CTCGAAACACTGTTGCTTTGAGG + Intronic
1138080733 16:54088608-54088630 TTGGAATATCTGTTTATTTGTGG - Intronic
1138408601 16:56819811-56819833 TTTGAAAGTCTCTCTCTTTGGGG + Intronic
1138679911 16:58676984-58677006 CTGTAATTTCTGTATCTTTGAGG - Intronic
1139139215 16:64240656-64240678 TTGCAAAATCTGTTTCTTTCAGG + Intergenic
1139351438 16:66338683-66338705 CTGCACAGTCTGTATCTTTTGGG - Intergenic
1139750861 16:69107999-69108021 CAGGAAAGTGTGTTTGTTTTGGG + Intronic
1139819701 16:69711538-69711560 CTGGAAGTTCTGTTACTTTAGGG + Intronic
1140008971 16:71111332-71111354 TTGGAAAGTTTTCTTCTTTGTGG - Intronic
1140824752 16:78695601-78695623 CTGGCAAGTCGGAGTCTTTGTGG + Intronic
1141222472 16:82083951-82083973 TTGGAAAATCTTTCTCTTTGAGG + Intronic
1141839433 16:86565485-86565507 CCGGACAGTTTGTTTATTTGTGG - Intergenic
1142189077 16:88709303-88709325 CTGGAAGTTCTGATTCTGTGGGG + Intronic
1142478340 17:202890-202912 CCTGAAAGTCTGTGACTTTGTGG - Intergenic
1143992669 17:10979839-10979861 CTGGGAAGGCTGTTTCTCAGTGG - Intergenic
1144426939 17:15152037-15152059 CTGGAAAGTCTGTGGGTTTGGGG - Intergenic
1148474405 17:47917600-47917622 CTGGAATGTTTGTTTGTTTTAGG + Intronic
1149424267 17:56539886-56539908 CTGGAATGTATGGTTCATTGGGG + Intergenic
1150022358 17:61630271-61630293 CTGGTAAGTGTGTTTTTCTGAGG + Intergenic
1151633289 17:75326058-75326080 CTGGATATCCCGTTTCTTTGTGG - Intronic
1153154765 18:2135609-2135631 ATGGAAAGGGTGTTTCATTGAGG - Intergenic
1156396418 18:36703946-36703968 CAGTAATGTCTGTTTCTTTGGGG + Intronic
1157462759 18:47915755-47915777 CTGGAAATGTTGTTTTTTTGGGG - Intronic
1158674597 18:59506762-59506784 GTGGAAAGTGTGTTTCTATCTGG + Intronic
1158975397 18:62706837-62706859 CTGAAAAGTCTTTTTATTTTAGG + Intergenic
1159274679 18:66201445-66201467 GTGTCAATTCTGTTTCTTTGTGG + Intergenic
1160451940 18:78972413-78972435 CAAGAAAGTCAGTTTCTTTGGGG + Intergenic
1161371800 19:3916444-3916466 CTGATAATTCTGTTTTTTTGAGG + Intronic
1165166272 19:33859453-33859475 TTAGGAAGTCAGTTTCTTTGGGG - Intergenic
1167778777 19:51581634-51581656 CTGGATTGTTTGTTTCTTTTGGG + Intronic
925603477 2:5634008-5634030 CTGAAAAGTCCTTTTCTTTTTGG + Intergenic
926554144 2:14337031-14337053 CTGGACAGCCTATTTCTCTGAGG + Intergenic
926830407 2:16956129-16956151 TTGAAAAGTGTGCTTCTTTGTGG - Intergenic
927336858 2:21935047-21935069 CTATTAATTCTGTTTCTTTGAGG + Intergenic
927846697 2:26476022-26476044 CTGGAACGCCTGCTTCTCTGTGG + Exonic
928257182 2:29732941-29732963 CTCAAAAGTCTTTATCTTTGGGG - Intronic
931861981 2:66364758-66364780 TTGCCAAGTCTTTTTCTTTGGGG + Intergenic
932686456 2:73874806-73874828 CTGGAAAGTGGGTTTGTGTGGGG - Intergenic
932970180 2:76531660-76531682 CTGGAAAATATATTTCTTTTTGG - Intergenic
934584916 2:95483373-95483395 CTGGACAGTCTGTTAATTTGGGG + Intergenic
934594537 2:95593343-95593365 CTGGACAGTCTGTTAATTTGGGG - Intronic
934788236 2:97032293-97032315 CTGGACAGTCTGTTAATTTGGGG + Intergenic
935390640 2:102548924-102548946 CTATAAAATATGTTTCTTTGTGG + Intergenic
935433832 2:103006946-103006968 CTGGAGAATCAGTGTCTTTGTGG - Intergenic
935693481 2:105750515-105750537 CTGGGATCTCTGTTTATTTGGGG + Intronic
936028591 2:109053430-109053452 CTGGATGTTCTGTTTCTATGGGG - Intergenic
937852422 2:126647677-126647699 CTGGAGTGTCTGTTTCAGTGAGG + Intergenic
938305259 2:130248903-130248925 CTGAATAGACTGTTTCTTAGAGG + Intergenic
938448759 2:131398304-131398326 CTGAATAGACTGTTTCTTAGAGG - Intergenic
941973998 2:171383551-171383573 ATGGAAAGTGTGTTTCTTACTGG + Intronic
942102771 2:172602397-172602419 CAGGAAATTCAGTTTCTTTGGGG + Intronic
942143199 2:172998721-172998743 CTGGAAATTTGGTTTATTTGAGG - Intronic
942536039 2:176965235-176965257 CTGGGTTGTCTGTTTCCTTGTGG - Intergenic
942637467 2:178023312-178023334 CTCTAAAGTGTGTTTTTTTGGGG - Intronic
942979044 2:182056589-182056611 ATCAAAAGTCTGTATCTTTGGGG + Intronic
943805841 2:192124634-192124656 GTGTACAGTCTGTTTCTCTGAGG - Intronic
943980386 2:194542150-194542172 ATGTATATTCTGTTTCTTTGGGG + Intergenic
944173794 2:196807002-196807024 GTTGAAAGTATGGTTCTTTGGGG - Intronic
947481949 2:230509043-230509065 CTAGAAAATCTTTTCCTTTGTGG + Intronic
947748420 2:232521035-232521057 CTGCGATGTCTGTATCTTTGGGG + Intronic
948498440 2:238371124-238371146 ATTGAAAGTCTGTTTTTTAGAGG + Intronic
1169799724 20:9502596-9502618 CTGGAAACTCTGTTTCCTCATGG + Intergenic
1170006143 20:11671275-11671297 CTGCTAGTTCTGTTTCTTTGTGG + Intergenic
1170878428 20:20272739-20272761 CAGGAAGATCTGTTTCTCTGAGG + Intronic
1170936656 20:20816015-20816037 CTGGCAAAGCTGTCTCTTTGGGG - Intergenic
1172818426 20:37709874-37709896 CTGGAAAGTCTGTTTCTGAAGGG - Intronic
1173468200 20:43301263-43301285 CAGGAAAGTCTTTTTCTTCCTGG - Intergenic
1173578645 20:44130437-44130459 CAAGAAAGTCTGGTTCTCTGGGG + Intronic
1175601220 20:60274825-60274847 ATTGAAACTCTGTTTCTCTGGGG - Intergenic
1176965016 21:15202706-15202728 CTGGAGTTTCTGTTTCTTCGTGG + Intergenic
1177889693 21:26790578-26790600 CTGCTAAGTCTATTTCTTTGAGG + Intergenic
1178416331 21:32408187-32408209 CTGAAAGGTTGGTTTCTTTGAGG + Intergenic
1178859872 21:36279729-36279751 CTTGTCAGTTTGTTTCTTTGTGG + Intronic
1179574297 21:42297870-42297892 ATGGAAAGGCTGTGTTTTTGCGG + Intergenic
1180063767 21:45402746-45402768 CTGGCACGTCCGTCTCTTTGGGG + Intergenic
1181902598 22:26168965-26168987 CTAGAAAGTCTGTAACTCTGTGG - Intergenic
951044891 3:18027226-18027248 CTTGTAAGTCTGTGTGTTTGCGG + Intronic
955003270 3:54946530-54946552 CTGGAAGGGCTGTTTCTAAGAGG - Intronic
957401408 3:79720117-79720139 CTGGAAAGTCTGATTCATTGAGG - Intronic
957412094 3:79855774-79855796 CTGGAGCATCTATTTCTTTGTGG - Intergenic
959605531 3:108237286-108237308 CTGGAAAGTCTGAGTATTTAAGG + Intergenic
959885930 3:111499671-111499693 CTTGATTTTCTGTTTCTTTGGGG - Intronic
960785502 3:121369495-121369517 CTTAAAGGTCTCTTTCTTTGGGG + Intronic
961093799 3:124137934-124137956 CTGTAAAGTATGTGTTTTTGTGG + Intronic
962182740 3:133225470-133225492 CTGGGAAGTGTTCTTCTTTGGGG - Intronic
963672171 3:148265156-148265178 CAGGAAAGTCTGTATCTTTTAGG + Intergenic
965250289 3:166334069-166334091 CTAGAATATCTGCTTCTTTGGGG - Intergenic
966373781 3:179275062-179275084 CTGGAAAGTTGCTTTCTTTAAGG + Intergenic
966412885 3:179661509-179661531 CTGGCTGGGCTGTTTCTTTGGGG + Intronic
966869345 3:184279877-184279899 TTGGGAAGTCAGTTTGTTTGGGG + Intronic
966910776 3:184558763-184558785 CTGGAAACACTGTCTGTTTGGGG - Intronic
967082511 3:186063310-186063332 CTAGAATGTCAGTTTCTTGGAGG - Intronic
967556167 3:190861747-190861769 ATGGAAAGACTGTGTGTTTGAGG - Intronic
967622209 3:191647903-191647925 TTGGAAATACTGTTCCTTTGAGG + Intergenic
968430381 4:554974-554996 AGGGAAAGTTTGTCTCTTTGGGG - Intergenic
969962652 4:10961059-10961081 CTGGTTTGTCTGTTTCTGTGAGG + Intergenic
970771518 4:19618828-19618850 GTGGAAATTCTATTTCTATGAGG + Intergenic
971662625 4:29439657-29439679 CTCTTAAGTCTGCTTCTTTGCGG + Intergenic
971694613 4:29883289-29883311 GTGGAAATTATTTTTCTTTGTGG - Intergenic
972878974 4:43400015-43400037 CTGGAAAGTCTCCTGCTCTGAGG + Intergenic
975922168 4:79405116-79405138 GTGTAAAGTATGTTTCTTGGAGG + Intergenic
976604959 4:86974069-86974091 CTGGTAATTCTTTTTCTTTTGGG + Intronic
976833094 4:89337529-89337551 CTGGACAATAAGTTTCTTTGAGG - Intergenic
977007886 4:91594941-91594963 CTTGAAAGTGTATTTGTTTGAGG - Intronic
977265831 4:94852857-94852879 CTGGAAAGAACATTTCTTTGGGG + Intronic
978272342 4:106906148-106906170 CTGGAAAATTTGATTCTTTCAGG - Intergenic
980091307 4:128445843-128445865 CTGGCAAAACTGCTTCTTTGGGG + Intergenic
980556613 4:134414667-134414689 CTGGATAGTCTCTTTCCTTGTGG - Intergenic
981875347 4:149536360-149536382 GGGGAAAGTCTGTGTCTGTGGGG - Intergenic
982767010 4:159360499-159360521 CTTGAATGTCAGTTTCTCTGAGG - Intergenic
983441060 4:167785373-167785395 CTGCATAGACTGTTTCTTTTTGG - Intergenic
984153629 4:176166055-176166077 TGTAAAAGTCTGTTTCTTTGTGG + Intronic
984960988 4:185098569-185098591 GAGGAAAGACTGTTTCTTTCAGG + Intergenic
985543328 5:497129-497151 GTGGAAAGACTGTCTCTCTGAGG - Intronic
986033171 5:3912008-3912030 CTAAAAAGTCTGTGTCCTTGAGG - Intergenic
986269401 5:6218002-6218024 CTGGAAAGCCTGTGTCCCTGAGG + Intergenic
987244396 5:16033825-16033847 CTGTAAGGTCTGTTCCTCTGAGG - Intergenic
987762499 5:22183875-22183897 CTGTCAAGTCTCTTGCTTTGGGG - Intronic
990365628 5:55067274-55067296 CTGGAATGTCTGTATCTAGGAGG - Intergenic
991627564 5:68619921-68619943 CTGAAATCTCTGTTTCTTTTAGG + Intergenic
992136751 5:73753430-73753452 GGGGAAAGACTGTTTCTTTATGG + Intronic
993699518 5:91101433-91101455 CTTGAAAATGTGTTTATTTGTGG + Intronic
994697857 5:103095551-103095573 CTGGACAGTATGTTTGTTTTTGG + Intronic
995411289 5:111859816-111859838 ATGGCAATTCTGTTTCTTGGGGG + Intronic
995910762 5:117183851-117183873 ATAGAAAGTTTGTTTATTTGGGG - Intergenic
996192672 5:120564586-120564608 GTGGAAAGTCTGTGTACTTGGGG - Intronic
997098865 5:130945743-130945765 CTGCTAAGTCAATTTCTTTGAGG + Intergenic
997843452 5:137263609-137263631 CTGCACAGTGTCTTTCTTTGTGG + Intronic
998516430 5:142758678-142758700 CTGGAAACTCTGAGTCTATGTGG + Intergenic
998545709 5:143025706-143025728 ATGGAAGGAGTGTTTCTTTGTGG - Intronic
999004854 5:147964343-147964365 CTGGATAGACTTGTTCTTTGTGG - Intergenic
999461327 5:151759517-151759539 CTGCAAAGTAGGTTTCTTGGAGG - Intronic
999490922 5:152050876-152050898 CTGGTAAGTCTGTTTGTTCTAGG + Intergenic
1000626410 5:163544432-163544454 CTGGAAATTCTGCATATTTGAGG + Intergenic
1001960376 5:175876955-175876977 ATGGAAAGCCTGTTCCTTTTTGG + Intronic
1002643724 5:180642743-180642765 CTGGGAATTCTCATTCTTTGTGG - Intronic
1003292889 6:4795439-4795461 TTGGAAATTCTGTTTTTTTCTGG + Intronic
1003933862 6:10955563-10955585 CTGGAATGTCTGCATGTTTGAGG + Intronic
1004078092 6:12363848-12363870 CTGGAAAATCTGTGGTTTTGGGG - Intergenic
1004409555 6:15368014-15368036 CTGTAAAGGCTTTTTCTTGGTGG + Intronic
1006081672 6:31571523-31571545 CTGGAATGTGTGTTTATTTGGGG + Intergenic
1006936378 6:37721511-37721533 CTGGAAGGTGTGCTTCATTGGGG + Intergenic
1007960203 6:45951883-45951905 CTGGAGAGTGTGTGTGTTTGGGG - Intronic
1008194339 6:48499688-48499710 CTAGAAAGTGTGGTTCATTGTGG - Intergenic
1008396381 6:51012534-51012556 CTGGAAAGTTGTTTTCTATGGGG - Intergenic
1008694681 6:54021036-54021058 TTGGAAAATCTATATCTTTGAGG + Intronic
1011714632 6:90092467-90092489 TGGGAAAGTCTGTATCTCTGTGG - Intronic
1012270842 6:97208588-97208610 CTGGAAAGTTTATTTCCTTTCGG - Intronic
1012590813 6:100977937-100977959 CTTGAAAGTCTGTTTATCTCTGG + Intergenic
1013581642 6:111540876-111540898 TTGGAAAGGCAGTTACTTTGGGG + Intergenic
1014365407 6:120534666-120534688 CTAGCAAGTATGTTTCTGTGTGG + Intergenic
1014542570 6:122694592-122694614 GTGAAAAATCTGGTTCTTTGTGG + Intronic
1017078153 6:150639028-150639050 CTGGAAAGCCCATTTCTTTTGGG + Intronic
1018765386 6:166928924-166928946 CTGGAAGGTCAGTTTCTGTCAGG - Intronic
1020473418 7:8565988-8566010 TTGGAAATTCTGTTGGTTTGGGG + Intronic
1020541496 7:9464322-9464344 CTGGAGAGTATTTTTGTTTGTGG + Intergenic
1022591560 7:31668704-31668726 CTGGATAGGAGGTTTCTTTGGGG + Intergenic
1023121100 7:36909768-36909790 ATGGAAAGTCTTTTTCTTCAAGG + Intronic
1023827825 7:44021307-44021329 CTGGAAAGTCAGATTCTGTGTGG - Intergenic
1025980304 7:66399873-66399895 CAGGAATGTCAGTTTCCTTGGGG - Intronic
1028586435 7:92456680-92456702 CTGGAAATCCAGTTTTTTTGTGG - Exonic
1029756127 7:102574730-102574752 CTGGAAAGTCAGATTCTGTGTGG - Intronic
1029774067 7:102673802-102673824 CTGGAAAGTCAGATTCTGTGTGG - Intergenic
1029873251 7:103718534-103718556 CTGGTGATTCTGTTTCTTTCTGG + Intronic
1030911643 7:115257478-115257500 CTGCATGGTCTGTTTCCTTGAGG + Intergenic
1031010559 7:116522418-116522440 CTGGAAAGTCCTTTTCTTGCTGG + Intergenic
1031367374 7:120918910-120918932 ATGGAAAGTCTTTATATTTGAGG + Intergenic
1031463239 7:122077818-122077840 ATGGTAAGTCTGTTCATTTGAGG - Exonic
1031595820 7:123648438-123648460 CTGGAAAGGCCTTTTCTCTGAGG - Intergenic
1032713700 7:134486102-134486124 CTTGAAAGTCTGTCTCCCTGAGG + Intergenic
1033994415 7:147328169-147328191 TTGGAAACTCATTTTCTTTGTGG - Intronic
1038441786 8:27575688-27575710 CTGGATGGTCAGTTTCTTGGGGG + Intergenic
1039037211 8:33372861-33372883 AAGGAAAGTCTGTTGCTTTAAGG - Intronic
1040883114 8:52229977-52229999 TTGGAGATTCTTTTTCTTTGGGG + Intronic
1042237741 8:66630364-66630386 CTGGAAAGTCTACTTTTTGGAGG - Exonic
1042343508 8:67704594-67704616 CTGGTAAGACTGGTTCATTGTGG + Intronic
1042786553 8:72553333-72553355 TTGGAAAGTTTTTTTATTTGTGG - Intronic
1044133228 8:88552680-88552702 GTTGAAAGTCAGTTTCATTGTGG - Intergenic
1044191963 8:89330087-89330109 CTGCAATATCTGTGTCTTTGTGG + Intergenic
1044941503 8:97348646-97348668 CTGGAGCCTCTGTTTCTTTCTGG - Intergenic
1046665691 8:117000014-117000036 GTGGAAAATCTGGTCCTTTGAGG + Intronic
1047353908 8:124102066-124102088 CTCTAAAGTCTGTTACGTTGAGG - Intronic
1048202828 8:132390975-132390997 CTGGAAAGCCTGTCTCCTTTGGG + Intronic
1048296211 8:133216210-133216232 GTGGAAAGATTGTTTCTTAGAGG - Intronic
1048671218 8:136723260-136723282 CTGGAAAATATGTGTTTTTGTGG - Intergenic
1049552359 8:143266516-143266538 CTGGAATGTTTGTTTTCTTGCGG + Intronic
1050188903 9:3004414-3004436 CTGGATAAGCTGTATCTTTGAGG + Intergenic
1050266462 9:3895621-3895643 CTGAAAAGTTTGTTTCAATGAGG + Intronic
1051153113 9:14107065-14107087 CTTAAAAATCTGTTTCATTGAGG - Intronic
1051732079 9:20154786-20154808 CTGGAAAGTCTGGATCCCTGAGG - Intergenic
1051890939 9:21942319-21942341 CTGGTAAGGCTGTTTCCTTCTGG + Intronic
1055647686 9:78376447-78376469 CTGGCCAGTCTTTGTCTTTGAGG + Intergenic
1055671035 9:78606379-78606401 TGGAAAAGTCTGTTTTTTTGAGG + Intergenic
1055775448 9:79762649-79762671 CTGAAAACTCTGATTCTTTTTGG + Intergenic
1056306908 9:85299488-85299510 CTGGAATGCCCGTTCCTTTGTGG + Intergenic
1056943737 9:90976412-90976434 CAGGGAAGTCTGTTTCTGTCTGG - Intergenic
1058869387 9:109189341-109189363 TTGGAAAGAGTGTTTCTTTGTGG + Intronic
1059133537 9:111780946-111780968 ATGGAAAGCAAGTTTCTTTGTGG - Exonic
1059952707 9:119483306-119483328 TTGGAAAATCTTTTCCTTTGTGG - Intergenic
1060265417 9:122109064-122109086 TTGGAAAGGCTGTATTTTTGAGG - Intergenic
1060330737 9:122666953-122666975 CAGAAATTTCTGTTTCTTTGGGG - Intergenic
1060773993 9:126355636-126355658 CTGGAAAATCCCTCTCTTTGGGG - Intronic
1062350827 9:136137875-136137897 CTGCAGAGTCTTGTTCTTTGGGG + Intergenic
1062689237 9:137832952-137832974 CTCTGAACTCTGTTTCTTTGGGG + Intronic
1186044311 X:5518398-5518420 CTGGAAAGTCTGGACCTTTTGGG - Intergenic
1188198834 X:27274807-27274829 CTGGATAGTCTCTTGCTGTGAGG - Intergenic
1190442124 X:50485187-50485209 CATGAAAGTCTGTTTTTTGGGGG + Intergenic
1191181972 X:57574015-57574037 CTGGAAGGTCTCCTGCTTTGAGG - Intergenic
1191786935 X:64926053-64926075 TTGTAAAGTCAGTTTCTCTGAGG + Intronic
1192694189 X:73397748-73397770 CTGTAAAGGATGTTTATTTGTGG + Intergenic
1194393583 X:93351320-93351342 CTGGTAAGATAGTTTCTTTGAGG + Intergenic
1194946405 X:100073759-100073781 CTGGAAAGTCTCTTGAGTTGAGG + Intergenic
1195355721 X:104038207-104038229 CTGGAAAGACTGGCTCTTTTAGG - Intergenic
1197003860 X:121472793-121472815 CTTGTAAACCTGTTTCTTTGTGG + Intergenic
1197380709 X:125735803-125735825 CTGGACAGTCTGGATGTTTGTGG + Intergenic
1197805792 X:130397371-130397393 CTTGAAATGCTGTTTCTGTGTGG + Intergenic
1198801647 X:140453833-140453855 CTTCAAAGTCAGTTCCTTTGAGG + Intergenic
1199491101 X:148401752-148401774 CTGAAAAGTTTGTTCCTTGGAGG + Intergenic
1200036801 X:153336270-153336292 CAGGAAAGTCTGTCTCTCTTGGG - Intronic