ID: 1129504021

View in Genome Browser
Species Human (GRCh38)
Location 15:76065958-76065980
Sequence GCCGAGGGGTGCCCCTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 275}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129504010_1129504021 8 Left 1129504010 15:76065927-76065949 CCCTCCTTCCCTGGCCAGAGGAG 0: 1
1: 0
2: 2
3: 50
4: 427
Right 1129504021 15:76065958-76065980 GCCGAGGGGTGCCCCTGCCCAGG 0: 1
1: 0
2: 1
3: 25
4: 275
1129504004_1129504021 29 Left 1129504004 15:76065906-76065928 CCTCACCTCTTCCTATTCTGCCC 0: 1
1: 1
2: 5
3: 49
4: 728
Right 1129504021 15:76065958-76065980 GCCGAGGGGTGCCCCTGCCCAGG 0: 1
1: 0
2: 1
3: 25
4: 275
1129504016_1129504021 -1 Left 1129504016 15:76065936-76065958 CCTGGCCAGAGGAGGGAAGAATG 0: 1
1: 0
2: 3
3: 24
4: 313
Right 1129504021 15:76065958-76065980 GCCGAGGGGTGCCCCTGCCCAGG 0: 1
1: 0
2: 1
3: 25
4: 275
1129504017_1129504021 -6 Left 1129504017 15:76065941-76065963 CCAGAGGAGGGAAGAATGCCGAG 0: 1
1: 0
2: 3
3: 11
4: 174
Right 1129504021 15:76065958-76065980 GCCGAGGGGTGCCCCTGCCCAGG 0: 1
1: 0
2: 1
3: 25
4: 275
1129504014_1129504021 4 Left 1129504014 15:76065931-76065953 CCTTCCCTGGCCAGAGGAGGGAA 0: 1
1: 0
2: 6
3: 39
4: 432
Right 1129504021 15:76065958-76065980 GCCGAGGGGTGCCCCTGCCCAGG 0: 1
1: 0
2: 1
3: 25
4: 275
1129504003_1129504021 30 Left 1129504003 15:76065905-76065927 CCCTCACCTCTTCCTATTCTGCC 0: 1
1: 0
2: 1
3: 75
4: 750
Right 1129504021 15:76065958-76065980 GCCGAGGGGTGCCCCTGCCCAGG 0: 1
1: 0
2: 1
3: 25
4: 275
1129504011_1129504021 7 Left 1129504011 15:76065928-76065950 CCTCCTTCCCTGGCCAGAGGAGG 0: 1
1: 0
2: 2
3: 65
4: 586
Right 1129504021 15:76065958-76065980 GCCGAGGGGTGCCCCTGCCCAGG 0: 1
1: 0
2: 1
3: 25
4: 275
1129504005_1129504021 24 Left 1129504005 15:76065911-76065933 CCTCTTCCTATTCTGCCCCTCCT 0: 1
1: 0
2: 8
3: 102
4: 1091
Right 1129504021 15:76065958-76065980 GCCGAGGGGTGCCCCTGCCCAGG 0: 1
1: 0
2: 1
3: 25
4: 275
1129504006_1129504021 18 Left 1129504006 15:76065917-76065939 CCTATTCTGCCCCTCCTTCCCTG 0: 1
1: 0
2: 9
3: 82
4: 735
Right 1129504021 15:76065958-76065980 GCCGAGGGGTGCCCCTGCCCAGG 0: 1
1: 0
2: 1
3: 25
4: 275
1129504015_1129504021 0 Left 1129504015 15:76065935-76065957 CCCTGGCCAGAGGAGGGAAGAAT 0: 1
1: 0
2: 2
3: 30
4: 310
Right 1129504021 15:76065958-76065980 GCCGAGGGGTGCCCCTGCCCAGG 0: 1
1: 0
2: 1
3: 25
4: 275
1129504009_1129504021 9 Left 1129504009 15:76065926-76065948 CCCCTCCTTCCCTGGCCAGAGGA 0: 1
1: 0
2: 3
3: 49
4: 475
Right 1129504021 15:76065958-76065980 GCCGAGGGGTGCCCCTGCCCAGG 0: 1
1: 0
2: 1
3: 25
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129504021 Original CRISPR GCCGAGGGGTGCCCCTGCCC AGG Intronic
900362903 1:2298528-2298550 GCAGAGGCGGGACCCTGCCCGGG + Intronic
900399583 1:2467512-2467534 CGCGCGGGGTGCCCCTGCTCGGG + Intronic
900400097 1:2469533-2469555 GCCATGGGCTGGCCCTGCCCGGG + Intronic
900610636 1:3543168-3543190 GCCTCAGGGTGCCCCGGCCCTGG - Intronic
900670508 1:3850969-3850991 GCAGAGGGATGCTCCTGCCTGGG + Intronic
900947148 1:5837398-5837420 GCCCAGGGGTCCCCCTACCTGGG + Intergenic
901061344 1:6473378-6473400 GGCGTGGGGGGCTCCTGCCCGGG + Exonic
901401060 1:9015269-9015291 GCCAGGGGGTGCCCAGGCCCCGG - Intronic
901451288 1:9338283-9338305 TTTGTGGGGTGCCCCTGCCCAGG + Intronic
901972807 1:12921147-12921169 CCCAAGGCGTGGCCCTGCCCTGG + Intronic
902012373 1:13280615-13280637 CCCAAGGCGTGGCCCTGCCCTGG - Intergenic
903324272 1:22560850-22560872 GCCGAGGTGTGCCCTCTCCCTGG - Intergenic
904160291 1:28518123-28518145 GCCAAGGGCTCCCCCAGCCCGGG + Intronic
904483163 1:30806705-30806727 GCCGAGGGGTTACCATGCCCAGG + Intergenic
904689328 1:32282111-32282133 GCTGAGGGGCTTCCCTGCCCTGG + Intronic
905106460 1:35566052-35566074 GCCGAGGGGAGCCCACGCCCTGG - Exonic
905351161 1:37347476-37347498 GACCAGTGGTGCCCCTGCCATGG - Intergenic
905358114 1:37398993-37399015 GCCGACTGGTTCCCCTCCCCAGG - Intergenic
906377057 1:45304174-45304196 CCCAAGGGGTGCCGCTGCCGAGG - Intronic
906960577 1:50417259-50417281 GCGGAGGGGTCACCTTGCCCCGG - Intergenic
910968724 1:92832646-92832668 GCCGAGGGGTCCCTGGGCCCCGG + Intronic
912709730 1:111941715-111941737 GCCTAGAGGTTCCCCTTCCCAGG - Intronic
913093298 1:115494410-115494432 GCAGTCGGGTGCCCCTGCACAGG + Intergenic
914386154 1:147172209-147172231 GCCGGGGGGCGCCCCTGACGCGG - Intronic
915320021 1:155051419-155051441 GCAGAGGGCTGCCCGCGCCCAGG - Exonic
915327137 1:155086345-155086367 GCTGCCGCGTGCCCCTGCCCTGG + Intronic
915597771 1:156905229-156905251 GTTGAGTGGTGCCCCTTCCCTGG + Intronic
916179247 1:162069876-162069898 GCTGCGCGGCGCCCCTGCCCGGG - Exonic
918093079 1:181314052-181314074 GGGGGGGGGTGCTCCTGCCCAGG + Intergenic
920401563 1:205679831-205679853 GCCGCGGGGTGCTCAGGCCCAGG - Intronic
922602903 1:226870663-226870685 GCCGGGGGGTGCCCAGGCCAGGG + Intronic
922699511 1:227750625-227750647 GCTGAGGGGTGTCCCTGGGCTGG + Intronic
922843490 1:228664244-228664266 GCCGAGGAGGGCCGATGCCCAGG - Intergenic
923227147 1:231948776-231948798 CCCAAGAGGGGCCCCTGCCCTGG - Intronic
1062823138 10:549614-549636 GGGGAGGGGTGCCCCCGACCAGG + Intronic
1064945543 10:20784280-20784302 GCCGACGGGTGCCGCTGGCTTGG + Exonic
1065340178 10:24697113-24697135 TCCTAGGGGTGGCCCTTCCCTGG + Intronic
1065596674 10:27319880-27319902 GGCGAGGGGAGGCCCAGCCCGGG + Intergenic
1068913818 10:62406959-62406981 GGCAAGGTGAGCCCCTGCCCAGG - Intronic
1069511146 10:69043354-69043376 CCCCAGGGGTGCCCCTCACCAGG - Intergenic
1070153562 10:73819757-73819779 GGCGAGGCGTCCCCTTGCCCCGG - Intronic
1070545817 10:77451647-77451669 GGCCAAGTGTGCCCCTGCCCAGG + Intronic
1070795560 10:79214444-79214466 GCCAATGGGTTCCCCTTCCCAGG - Intronic
1073266392 10:102230750-102230772 GCCCGGGGGGGCCCCCGCCCAGG + Exonic
1074774131 10:116753999-116754021 TACGAGGGCTGCTCCTGCCCTGG - Intergenic
1075280398 10:121133780-121133802 GCCAAGGGTCCCCCCTGCCCAGG - Intergenic
1075741775 10:124700372-124700394 GCCGAGGGGTTCCCTCGGCCTGG - Intronic
1076850581 10:133090611-133090633 GCCATGGGGTGAGCCTGCCCAGG - Intronic
1077076766 11:705728-705750 CCTGAGGGGTGCACCTGGCCCGG + Intronic
1077152111 11:1077135-1077157 TCTGAGGGGGGACCCTGCCCAGG + Intergenic
1077218287 11:1404232-1404254 GCGGAGCTGTGTCCCTGCCCAGG + Intronic
1077369002 11:2172850-2172872 GGAGAGTGATGCCCCTGCCCAGG + Intergenic
1077467890 11:2742282-2742304 GCACAGGGCTTCCCCTGCCCTGG - Intronic
1078547391 11:12256238-12256260 GCCCAGGGGTACTGCTGCCCTGG + Intronic
1079407663 11:20160107-20160129 GCCGTGGGGGCCCCCTGCCTGGG + Exonic
1083302154 11:61744966-61744988 CCCCTGGGGTGCCCCTGCCGAGG + Exonic
1083304189 11:61754219-61754241 GCTTAGGGGTGCCCCTGCCTGGG - Intronic
1083753629 11:64777844-64777866 GCCCAGGGGCGCCTCCGCCCGGG + Intronic
1084336584 11:68461132-68461154 GGCGAGGCGCGCCCCTGACCCGG + Intronic
1084518481 11:69648937-69648959 GCCTAGTGGTGCCTCTGTCCCGG + Intronic
1089307483 11:117535794-117535816 GCCGACAGGTGCTCCAGCCCTGG + Intronic
1089352861 11:117831272-117831294 CCAGAGGGGTGCCCTTGCCCAGG - Intronic
1089523105 11:119078766-119078788 ACTGAGGTGTGCCCTTGCCCCGG + Intronic
1090257863 11:125298421-125298443 GCCGAGGGGTGAGCCAGCCCAGG - Intronic
1090590150 11:128258894-128258916 GCTGAGGTCTGTCCCTGCCCTGG - Intergenic
1091242637 11:134064195-134064217 ACCGAGGGTTGACCCTGGCCGGG + Intergenic
1091589925 12:1836902-1836924 TCCCAGCGGTGCCCCAGCCCTGG - Intronic
1091793387 12:3284009-3284031 ACCGTGGGGCCCCCCTGCCCTGG - Exonic
1096606087 12:52767543-52767565 GCCCTAGGCTGCCCCTGCCCAGG + Intergenic
1097514997 12:60594118-60594140 CTCCAGTGGTGCCCCTGCCCGGG + Intergenic
1101451121 12:104780228-104780250 GGCCAATGGTGCCCCTGCCCAGG + Intergenic
1101839795 12:108320023-108320045 GCCGACAGGTCCCCCAGCCCTGG - Intronic
1102061924 12:109939120-109939142 GCCCTGGGGAGCCCCTCCCCTGG + Intronic
1102348516 12:112175041-112175063 GCCTAGCTGTGCCCCTGCCTGGG + Intronic
1104744581 12:131202886-131202908 GCCGAGGGGTGACCCGGGGCAGG - Intergenic
1104789804 12:131474321-131474343 GCCGAGGGGTGACCCGGGGCAGG + Intergenic
1107863414 13:44682353-44682375 GGTGAGGGGCGCCTCTGCCCGGG - Intergenic
1111935152 13:94550034-94550056 GCCTCGGGGAGCTCCTGCCCAGG + Intergenic
1112652602 13:101415991-101416013 GCCGCGGGATGCCCCTGGGCTGG - Intronic
1113427579 13:110222131-110222153 GCTGAGGGGTGCCAGGGCCCTGG - Intronic
1119261848 14:73242323-73242345 GCCAAGGGGTACCCCTGCCATGG - Intronic
1121648226 14:95535446-95535468 GCCGAGGGGTTCCGCCGCGCCGG + Intronic
1122296298 14:100708307-100708329 GCTAAGGGGTGCCCCTGAGCAGG - Intergenic
1122602980 14:102930429-102930451 GCCGAGGGGCGCTCCAGCCGGGG - Exonic
1122606283 14:102948857-102948879 GCACAGGTGTGCCCCTGGCCTGG - Intronic
1122938809 14:104972106-104972128 GCCGGCAAGTGCCCCTGCCCTGG - Intronic
1122940035 14:104977128-104977150 TGAGAGGGGTGCCCCTGGCCTGG - Intronic
1123009612 14:105341899-105341921 GCGGAGAGGAGCCCCTGCCTAGG + Intronic
1123450881 15:20358235-20358257 GCCCTGGAGTGCCCCTGCCCTGG + Intergenic
1123994932 15:25711831-25711853 GGGTAGGGGAGCCCCTGCCCAGG - Intronic
1126406926 15:48331631-48331653 GCCGAGGGGCGGGCCTGGCCCGG - Exonic
1128535446 15:68486827-68486849 GCAGAGAGTGGCCCCTGCCCAGG + Intergenic
1129117930 15:73375619-73375641 GCAAAGGGAAGCCCCTGCCCTGG + Intergenic
1129504021 15:76065958-76065980 GCCGAGGGGTGCCCCTGCCCAGG + Intronic
1130209781 15:81912480-81912502 GCCCAGGGCTGACCCAGCCCAGG + Intergenic
1130316824 15:82803270-82803292 CCTCAGGGGTGTCCCTGCCCAGG + Intronic
1131054776 15:89368792-89368814 GGGGAGGGAGGCCCCTGCCCTGG - Intergenic
1131179493 15:90230329-90230351 AACGAGGGCCGCCCCTGCCCGGG + Exonic
1131179577 15:90230765-90230787 AAGGAGGGCTGCCCCTGCCCGGG + Intronic
1132407482 15:101552573-101552595 TCCCAGGGGTTCTCCTGCCCAGG + Intergenic
1132554944 16:568274-568296 GCAGATGGGTGGCCCAGCCCGGG - Exonic
1132733929 16:1376310-1376332 GAAGAGGAGTGCCCCAGCCCTGG - Intronic
1132733952 16:1376380-1376402 GAGGAGGAGTGCCCCAGCCCTGG - Intronic
1132745361 16:1434061-1434083 GCTGTGAGCTGCCCCTGCCCGGG - Intergenic
1132814382 16:1818801-1818823 GGCGAGGGGTGGCTCAGCCCTGG - Intronic
1132840824 16:1977807-1977829 GGGGAGGGGCGCCACTGCCCTGG - Intronic
1133021753 16:2969936-2969958 GTCCAGGGCTGCCCCGGCCCTGG + Intronic
1133973554 16:10583945-10583967 GACTAGGGGTGCCCATGCCTGGG + Intergenic
1137387063 16:48051513-48051535 GCCGAGGGATGTCCCTGACATGG + Intergenic
1139435968 16:66936576-66936598 GCCAAGTTGTGCCCTTGCCCAGG - Intronic
1139438344 16:66949620-66949642 GCCAAGTTGTGCCCTTGCCCAGG - Intergenic
1142132836 16:88438666-88438688 GGCGAGGGCTTCCACTGCCCTGG - Exonic
1142319198 16:89370220-89370242 GGCGAGGGGAGCCCATGTCCAGG + Intronic
1144638344 17:16924748-16924770 GCAGAGGGGAACCCCTGCCCGGG - Intergenic
1144829857 17:18125237-18125259 GCCTGGGGCTGGCCCTGCCCTGG + Intronic
1148572090 17:48678363-48678385 GCTGAGGGTTTTCCCTGCCCTGG - Intergenic
1148576093 17:48712346-48712368 GCCGTGGGCTGGCCCTGCCCTGG - Intergenic
1148856082 17:50580015-50580037 GGGGAGGGGTGCACCTGGCCAGG - Intronic
1148874434 17:50678238-50678260 TCCCAGTGGTGGCCCTGCCCTGG - Intronic
1150069330 17:62138474-62138496 GCCAAGGGCTGCCCCTACCTAGG - Intergenic
1150124343 17:62627128-62627150 GCCGAGGAGGACCCCTCCCCCGG - Intergenic
1150675920 17:67245678-67245700 CCGGAGAGGTGCCTCTGCCCTGG + Intronic
1151791424 17:76308097-76308119 TCCTCGGGGCGCCCCTGCCCCGG + Intergenic
1152037334 17:77881352-77881374 GCCCATGGTGGCCCCTGCCCAGG + Intergenic
1152224078 17:79084700-79084722 GCCCAGGCCTGCCTCTGCCCAGG + Intronic
1152337562 17:79707110-79707132 GCCCTGGAGTGCCCCTGCCCTGG - Intergenic
1152379424 17:79934688-79934710 GCCCAGGGGTGCCCCTCCCAAGG - Exonic
1152518334 17:80839017-80839039 GACCATCGGTGCCCCTGCCCTGG - Intronic
1152730475 17:81967376-81967398 GGCGAGGGGGGCCCCTGGGCGGG + Intergenic
1152904478 17:82962851-82962873 CCCGGGTGGTGCCTCTGCCCTGG + Intronic
1153226869 18:2906566-2906588 GCCGCCGGGGACCCCTGCCCGGG - Intronic
1153636327 18:7117062-7117084 GCCTGCGGGTCCCCCTGCCCGGG + Intronic
1156257508 18:35411609-35411631 GCAGAGGGGTGCCATTGCCGAGG - Intergenic
1156488957 18:37485321-37485343 GCCAAGTGGGGCCCCTGTCCCGG + Intronic
1156489692 18:37488869-37488891 GCCCAGGAGAGCCCCTTCCCAGG + Intronic
1160020732 18:75178757-75178779 CCCCAGGGGAGCCCTTGCCCGGG - Intergenic
1160662152 19:306198-306220 GCCGCGGGCTGCCCCAGCCCTGG - Exonic
1160707267 19:535484-535506 GCTGGTGGGTGCCCCTGGCCTGG + Intronic
1160858873 19:1229330-1229352 GGCGGGGGGTGCCCCGGCTCGGG - Exonic
1160933304 19:1580940-1580962 GACGATGGGTCCCCTTGCCCTGG + Intronic
1161265098 19:3360141-3360163 CCCGCGGGGTGCCCCGGCCCGGG + Intronic
1161307648 19:3576807-3576829 CCCGGGACGTGCCCCTGCCCAGG - Intronic
1161328653 19:3675831-3675853 GCTGGGGGGTGCCCCTGGCATGG - Intronic
1161396010 19:4045308-4045330 GGGGAGGGGTGTCCCTGGCCTGG + Exonic
1161404716 19:4084818-4084840 GACAGGGGGTGCCCCTGCCATGG - Intergenic
1161454314 19:4362537-4362559 GCCAAGGGCTGGCCCTGTCCTGG - Intronic
1161592642 19:5135691-5135713 ACCGGGGGAGGCCCCTGCCCTGG - Intronic
1162111910 19:8403999-8404021 CCCGGGGGGTCCGCCTGCCCCGG - Exonic
1162344189 19:10110254-10110276 GCCCGGGGGTCCCCCTGCCCTGG - Intronic
1163715937 19:18872161-18872183 GGTGATGGGTGCCCCCGCCCTGG + Intronic
1164415491 19:28043758-28043780 GCTGAGGACTGCCCCTCCCCAGG + Intergenic
1165327504 19:35122871-35122893 GGGGAGGGGAGCCCCAGCCCCGG - Intronic
1166435778 19:42765694-42765716 CCTGAGAGGTGCTCCTGCCCCGG - Intronic
1166715546 19:44964900-44964922 GCCCTGGGGTCCCACTGCCCAGG - Intronic
1167026311 19:46921587-46921609 GCAGAGCGGTGATCCTGCCCGGG - Exonic
1167291274 19:48626333-48626355 TCCGAGGACTGCCACTGCCCGGG + Exonic
1167579497 19:50333237-50333259 GGGGAGGGGTGACCCAGCCCCGG + Intronic
1168078170 19:53991756-53991778 CCCGAGGGGGGGCCCTGGCCTGG + Intergenic
926596754 2:14797807-14797829 GACCAGTGGTGCCCCTGCCTGGG - Intergenic
929094663 2:38251936-38251958 GCCAAGGGGGTCCCCTACCCAGG + Intergenic
930096535 2:47570560-47570582 GCAGAGGAGCGCCCCTGCCCGGG - Exonic
934559204 2:95303600-95303622 GGCGAGGGATGCCCAGGCCCAGG - Intronic
935622905 2:105144331-105144353 GCCGAGCGGGGCCACCGCCCGGG + Intergenic
936091178 2:109502200-109502222 GCGGTGGGGTGCCCCTTCCGGGG - Intronic
936556713 2:113503164-113503186 GCCGAGTGCTTCCCCTGCTCCGG + Intergenic
937919398 2:127119606-127119628 GGTGAGGGGCGCCTCTGCCCGGG - Intergenic
938953991 2:136281982-136282004 GCCGTGGGATGCTGCTGCCCAGG + Intergenic
941935077 2:170975623-170975645 GCAGAAGGATGCCCGTGCCCAGG - Intergenic
941987621 2:171523574-171523596 ACCGAGGGATGCCTCTGCTCGGG + Intronic
942251043 2:174047940-174047962 GCCCTGGGGTGCCCCGGCCAGGG + Intergenic
943669681 2:190648433-190648455 GTCCAGGTGCGCCCCTGCCCGGG - Intronic
947714242 2:232331880-232331902 GCTCAGAGGTGCCCTTGCCCGGG + Intronic
947720323 2:232366077-232366099 GCTCAGAGGTGCCCTTGCCCGGG + Intergenic
947876875 2:233473581-233473603 CCCCAGGTCTGCCCCTGCCCGGG - Intergenic
948837323 2:240632035-240632057 GCCCAGGTGGGCCCATGCCCAGG + Intergenic
948837430 2:240632415-240632437 GCCCAGGAGTGTCCCTGCCTAGG + Intergenic
948868291 2:240786142-240786164 GCCGAGGGCTCCCCCTGTGCAGG - Intronic
948927977 2:241111616-241111638 CCCGAGAGGAGGCCCTGCCCAGG + Intronic
949022970 2:241751881-241751903 ACCGAGGGCTCCCCCTGCCCAGG - Intronic
949022985 2:241751918-241751940 ACCGAGGGCTCCCCCTGCCCAGG - Intronic
949023000 2:241751955-241751977 ACCGAGGGCTCCCCCTGCCCAGG - Intronic
1169139487 20:3218858-3218880 GCTGAGGGGTGCCCCTGGGCAGG + Intronic
1169262744 20:4149648-4149670 GCTGAGGGAAGCCACTGCCCTGG + Intronic
1170590075 20:17765111-17765133 TTCGAAGGCTGCCCCTGCCCTGG - Intergenic
1171372617 20:24671275-24671297 GCCCAGGGCTGCGCTTGCCCAGG + Intergenic
1172150574 20:32787457-32787479 GCCGAGAGGGGCTCCTGCCCAGG + Intronic
1173202029 20:40961350-40961372 GCCGAGCTGTGGCCCTGCCCTGG - Intergenic
1173222051 20:41138557-41138579 GGCAAGGGGAGTCCCTGCCCTGG - Intronic
1174579585 20:51562382-51562404 GCGGAGGGGCGCCCGCGCCCCGG - Intronic
1174642457 20:52056341-52056363 GGCAAGAGGGGCCCCTGCCCTGG - Intronic
1175266403 20:57706146-57706168 TCTGGGAGGTGCCCCTGCCCTGG - Intronic
1175722265 20:61294418-61294440 GCCGAGTCGGGGCCCTGCCCCGG - Intronic
1175873728 20:62220031-62220053 GCCGGGAGGGGCCCCGGCCCGGG + Exonic
1178555803 21:33588848-33588870 TCCCAGCGGTGACCCTGCCCTGG + Intronic
1180025251 21:45157138-45157160 GCTGAGAGGAGCTCCTGCCCAGG - Intronic
1180141453 21:45895931-45895953 GCCGAGGTCTGCATCTGCCCAGG - Intronic
1181040800 22:20191811-20191833 GTCCAGGGGTGTGCCTGCCCAGG - Intergenic
1181670937 22:24425178-24425200 GCCCCAGGGTGCCCCAGCCCTGG + Intronic
1182760479 22:32718426-32718448 CCCGAGGTGTGCCCCTGACCTGG + Intronic
1183489658 22:38109631-38109653 GGCGAGAGCTGCCCTTGCCCCGG - Intronic
1183965033 22:41436493-41436515 GGCCTGGGGTGCCGCTGCCCTGG + Exonic
1184225929 22:43128875-43128897 GCTCAGGGAGGCCCCTGCCCTGG - Intronic
1185150781 22:49162851-49162873 GCCCTGGGCTGCACCTGCCCAGG - Intergenic
1185255152 22:49827625-49827647 GCCGAGAGGGGCCCGCGCCCAGG - Intergenic
1185329453 22:50245640-50245662 GCGGAGGCATGGCCCTGCCCTGG - Intronic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
949552495 3:5122657-5122679 GCCGAGGGGGGCCCCAACTCAGG - Intronic
952923497 3:38305359-38305381 GCCAAGGGGTGCCCCGCACCAGG + Intronic
953020081 3:39107538-39107560 GCCGAGCGGAGCCGCTGCCATGG - Exonic
955996863 3:64687460-64687482 GCTGCGGGGTGCCCCTGCCCAGG + Intronic
957223659 3:77415535-77415557 GGCCAGCTGTGCCCCTGCCCAGG + Intronic
958407123 3:93764306-93764328 GGTGAGGGGTGTCTCTGCCCGGG - Intergenic
961114441 3:124316621-124316643 GCTCAGGGGTCACCCTGCCCCGG + Intronic
962251990 3:133841213-133841235 GCCCAGGTGTGACCCTGGCCAGG - Intronic
968512287 4:1001019-1001041 GCCCAGGAGTACCCCCGCCCCGG - Intronic
968622320 4:1609348-1609370 GCCCAGGCCTGCACCTGCCCCGG + Intergenic
969439487 4:7208778-7208800 GCAGAGAGCTGCCTCTGCCCCGG + Intronic
969699981 4:8762548-8762570 GCCACAGGGTGCCGCTGCCCAGG + Intergenic
971268710 4:25117322-25117344 TCCGAGGGCTCCCCCTGCCCTGG - Intergenic
971364659 4:25968088-25968110 GAAGAGGGGTGCCTCTTCCCAGG + Intergenic
977719557 4:100223841-100223863 AGCCAGGGGTGCCTCTGCCCAGG - Intergenic
980901608 4:138910635-138910657 GCCGTGGGCTGCACCTGCCGGGG + Intergenic
982288807 4:153759984-153760006 GCGGAGCGGCGGCCCTGCCCGGG + Exonic
985515692 5:343676-343698 GCCCAGGCGTGACCCGGCCCCGG + Intronic
985649095 5:1099091-1099113 TCCCGGTGGTGCCCCTGCCCAGG + Intronic
989368618 5:40681869-40681891 GCCGAGTAGGGCCCCAGCCCCGG - Intronic
991371560 5:65925570-65925592 GCCGCCGGCTGCCCCTCCCCCGG + Intergenic
993641259 5:90409273-90409295 GCCGAGGTGGGGCCCTGACCAGG + Intronic
997302157 5:132813951-132813973 GCCGCGGAGCGCCTCTGCCCCGG + Exonic
998080870 5:139274069-139274091 GCCGAGGGGAACCCCGCCCCGGG - Exonic
1001713852 5:173798704-173798726 TCCGAGAGCTGCCCCAGCCCAGG + Intergenic
1002708594 5:181180184-181180206 GCCCAGGGCTGCCTCTGTCCAGG + Intergenic
1003062454 6:2874407-2874429 GCAGAGGTGTGCTCATGCCCTGG + Intergenic
1004414829 6:15415541-15415563 GGTGAGGGGCGCCTCTGCCCGGG - Intronic
1006797311 6:36739951-36739973 CCTCAGGGGTGCCCCTGCTCTGG - Intergenic
1006903585 6:37518337-37518359 GCTGAGGAGTCCCACTGCCCAGG + Intergenic
1007461887 6:42025232-42025254 GAAGAGAGGTCCCCCTGCCCTGG - Intronic
1011194949 6:84771961-84771983 GCCCAGGGCTCCCCCTGGCCAGG + Intergenic
1011640475 6:89412347-89412369 GCCGAGTGGTGCCCGCGGCCGGG - Intergenic
1012237683 6:96837516-96837538 GCCGAGGGGTTCCCGCCCCCAGG + Intergenic
1017971167 6:159314105-159314127 GCCCACGGGTGCCCCTTACCAGG - Intergenic
1018031566 6:159845503-159845525 CCCGCTGGGTGCCCCTGCCTGGG + Intergenic
1018790183 6:167142319-167142341 TTCCAGGGGTGCCTCTGCCCTGG + Intergenic
1018911068 6:168101200-168101222 GCCCATGGGGGTCCCTGCCCCGG - Intergenic
1018918997 6:168157889-168157911 GCCCAGGGTCCCCCCTGCCCCGG + Intergenic
1019395702 7:816690-816712 GCCCCGGGGTGCCCTTGGCCCGG - Intronic
1019530445 7:1500400-1500422 GCTTTGGGGTGACCCTGCCCTGG - Intronic
1019562679 7:1666202-1666224 ACAGAGGGGTCCCCCGGCCCCGG - Intergenic
1020092680 7:5350190-5350212 TCCGAGGCCTCCCCCTGCCCGGG - Intronic
1020094705 7:5361855-5361877 GCCCCGTGGGGCCCCTGCCCCGG - Intronic
1020101653 7:5397351-5397373 GCCCAGGCCGGCCCCTGCCCGGG + Intronic
1020106010 7:5422647-5422669 GCCGAGGGGGTCTCCTGCTCGGG - Intronic
1020226805 7:6286708-6286730 GCCGAGGGGAGACTGTGCCCTGG - Intergenic
1020259058 7:6520541-6520563 GCCGCGGTGGGGCCCTGCCCTGG - Intronic
1020274207 7:6615224-6615246 GCCTCGGGGCGCCCCTGCCGCGG - Intergenic
1022106227 7:27199731-27199753 GCCGACGGGGGCGCCTCCCCGGG + Exonic
1024223021 7:47303125-47303147 GCCAGGGTGTGACCCTGCCCGGG - Exonic
1025829790 7:65038720-65038742 GCGGCGGGGCGCTCCTGCCCGGG + Intergenic
1025917044 7:65873720-65873742 GCGGCGGGGCGCTCCTGCCCGGG + Intronic
1026479082 7:70763256-70763278 GCAGAGGGGTGGGCCTGCACAGG - Exonic
1028502627 7:91535842-91535864 GCGGTGTGGTGCTCCTGCCCAGG + Intergenic
1029111514 7:98215059-98215081 CCCGTGGGGAGCCCCTGCCTCGG + Exonic
1029487587 7:100852866-100852888 GCTGTGGGGTGCACCTGGCCGGG + Intronic
1032470911 7:132178335-132178357 GCCGAGGGGAGCTCCCACCCAGG - Intronic
1033051399 7:138007472-138007494 GCCGAGGGGTGGCCCTGGGAGGG - Intronic
1036661380 8:10711235-10711257 GCCCCGGGGTGCCCCTGGCCTGG - Intronic
1038436284 8:27539034-27539056 GTGGAGTGGGGCCCCTGCCCAGG + Intronic
1039758151 8:40545077-40545099 GCCTAGAGATGCCCCTGGCCTGG + Intronic
1039843434 8:41309312-41309334 GCCGAGGGCCGCCACTGGCCGGG - Exonic
1041045286 8:53881608-53881630 GCCCCTCGGTGCCCCTGCCCTGG - Intronic
1041244893 8:55880295-55880317 GCCGACGGGTGACCGGGCCCGGG + Intronic
1041569396 8:59320207-59320229 GCACAGGGGTGCACCTGCTCTGG - Intergenic
1048333400 8:133486220-133486242 GCTGAGGTCGGCCCCTGCCCTGG + Intronic
1049575962 8:143389755-143389777 GCCCCTGGGGGCCCCTGCCCTGG + Intergenic
1049623667 8:143610608-143610630 GCCGTGGGGTGATCTTGCCCAGG - Intergenic
1049647011 8:143739999-143740021 GCAGGGGGGTGCCCTGGCCCGGG + Intergenic
1049654863 8:143792975-143792997 GCCTGAGGATGCCCCTGCCCAGG - Exonic
1049778397 8:144416563-144416585 CCCGACGGGTCCCCCAGCCCTGG - Intronic
1049795695 8:144496387-144496409 GCCCGGGGGAGCCCCTGCCCTGG - Intronic
1049896306 9:114174-114196 GCCGAGTGCTTCCCCTGCTCCGG - Intergenic
1050552303 9:6758577-6758599 CCCGAGGGGTGCACCAGGCCCGG - Intronic
1053048205 9:34937067-34937089 GGTGAGGGGCGCCTCTGCCCCGG + Intergenic
1053296897 9:36921911-36921933 TCCGAGGGGGTCCCCTCCCCTGG - Intronic
1053666126 9:40319016-40319038 GCTGGATGGTGCCCCTGCCCTGG + Intronic
1053915711 9:42944063-42944085 GCTGGATGGTGCCCCTGCCCTGG + Intergenic
1054377280 9:64459044-64459066 GCTGGATGGTGCCCCTGCCCTGG + Intergenic
1054518483 9:66057267-66057289 GCTGGATGGTGCCCCTGCCCTGG - Intergenic
1055091226 9:72365801-72365823 GCCCAGGGCTGCCAATGCCCCGG + Intergenic
1057227853 9:93301940-93301962 GCCCAGGTGGGCCTCTGCCCTGG + Intronic
1059404807 9:114093081-114093103 GCCTAGGGCTCCCTCTGCCCTGG - Intronic
1060822898 9:126671796-126671818 GCTGTGGGGGGCCGCTGCCCTGG - Intronic
1061325459 9:129861259-129861281 GCAGAGGGGTCGGCCTGCCCAGG - Intronic
1061889385 9:133609540-133609562 GCCTGGGGGTGCCCCCACCCTGG + Intergenic
1062191471 9:135249937-135249959 GCGGCTGGGAGCCCCTGCCCTGG - Intergenic
1062490571 9:136803140-136803162 GCCCTGGGGGGCCCCAGCCCTGG - Intronic
1062490622 9:136803275-136803297 GCCCTGGGGGGCCCCAGCCCTGG - Intronic
1062529664 9:136994329-136994351 GGGGAGGGGAGCGCCTGCCCCGG + Intergenic
1062668912 9:137694770-137694792 GCCTCGGGGTGCCCTTGACCCGG + Intronic
1186720882 X:12302176-12302198 TGCGAGGGGTCACCCTGCCCTGG + Intronic
1187183539 X:16964987-16965009 GGTGAGGGGCGCCTCTGCCCGGG - Intronic
1197911930 X:131492297-131492319 GCACAGGGGTGCCGTTGCCCCGG + Intergenic
1202028828 Y:20551991-20552013 GGCGAGGAGCGCCTCTGCCCGGG + Intergenic