ID: 1129505133

View in Genome Browser
Species Human (GRCh38)
Location 15:76075132-76075154
Sequence CTGAAGTTCTGGGGAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 600
Summary {0: 1, 1: 0, 2: 3, 3: 61, 4: 535}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129505133 Original CRISPR CTGAAGTTCTGGGGAGAAGA TGG Intronic
900114703 1:1023522-1023544 CTCATGGTCTGGGGAAAAGATGG + Intronic
900526265 1:3130274-3130296 GTGGGGTTCTGGGGAGAAGCTGG + Intronic
900608962 1:3536423-3536445 CTGAAGCTCTGGGGTGCGGAGGG + Intronic
901143332 1:7049906-7049928 CTGATGTTCTGGTGGGAGGAGGG + Intronic
901489897 1:9591337-9591359 CTGAAGTTCTGGTGCGAGGCAGG - Intronic
901549984 1:9989003-9989025 GAGAAATTCTGGGCAGAAGAGGG + Intergenic
902038273 1:13473418-13473440 CTGCAATGCTGGGGAGCAGAGGG + Intergenic
902606774 1:17573442-17573464 CTGGGGTTCTCTGGAGAAGAGGG + Intronic
902704154 1:18192942-18192964 CTGAGGATCTGGGGTGAATAAGG + Intronic
903317074 1:22516387-22516409 CTGGAGTTCTGGGGAAAGGTGGG + Intronic
903326608 1:22572493-22572515 CGGAAGTTCCCGGGAGCAGAGGG - Intronic
903546376 1:24126144-24126166 CTGACGTTCTGGGGCTAAGCTGG - Intronic
903835730 1:26202236-26202258 CTGAACTCCTGGAGAGAAAAAGG + Intronic
904346605 1:29876516-29876538 GTGAAATACTGGGTAGAAGAAGG + Intergenic
904370920 1:30046907-30046929 CTGCAGTTCAGGAGAGAACACGG + Intergenic
904942588 1:34175838-34175860 GTGAGGCACTGGGGAGAAGAGGG - Intronic
905236370 1:36552825-36552847 CTGAAGTTCAGGGGTGAACTTGG - Intergenic
906202084 1:43966824-43966846 CTGAAGTCCTGGGCAGGGGAGGG - Intronic
907350590 1:53826947-53826969 GTGAAGTTCCAGGGAGCAGAAGG - Intronic
908196603 1:61751312-61751334 CATAATTTCTGGGGAGAAGCTGG + Intronic
908694951 1:66829110-66829132 AAGAAGCTCTGGAGAGAAGATGG + Intronic
908702729 1:66919961-66919983 GGGAAATTCTGGGCAGAAGAAGG + Intronic
909185669 1:72482222-72482244 GGGAAATTCTGGGCAGAAGAGGG - Intergenic
909341715 1:74539349-74539371 GTGAAGTTCTGGGGGGAACTAGG + Intronic
909900994 1:81135444-81135466 CTGAAAAGCTGCGGAGAAGATGG + Intergenic
909948686 1:81693149-81693171 GAGAAGTTCAGGGGAGCAGAAGG - Intronic
911701823 1:100962226-100962248 CTAAAGTACTGGGGAGGTGATGG + Intronic
912307584 1:108585628-108585650 AGGAAGGTCTGGGGAGGAGATGG - Intronic
912472677 1:109916368-109916390 CTGATGTTTTTGGGAGAAGGAGG - Intronic
913219193 1:116645844-116645866 CTGAAATGCTGGGGAGAACCAGG + Intronic
914457826 1:147853168-147853190 CTGAAGTTTTTGGGATAATAGGG + Intergenic
915451652 1:156009502-156009524 CTGGATTTCTTGGGAGAGGAGGG + Exonic
915887658 1:159740473-159740495 CAGAGGGTCTGGGGATAAGATGG + Intergenic
916171087 1:162002238-162002260 CTGGAGTCCTGGGGAGAGCAGGG - Intronic
916284643 1:163093354-163093376 CGGAAGTGCTGGGTAGAGGAGGG + Intergenic
917535179 1:175869321-175869343 CTGAACTTCTGGGGAGAAGCAGG - Intergenic
917971859 1:180213530-180213552 CTGAAAATCTGGGGAGCCGATGG - Intergenic
918045626 1:180939305-180939327 CTGAAGTTCTGGAGAGCAGATGG - Intronic
918526231 1:185467593-185467615 CGGAAATACTGGGTAGAAGAAGG - Intergenic
919042057 1:192401685-192401707 CTGACATTCCGGGGAGAAGATGG + Intergenic
919771806 1:201165993-201166015 CTGAAGGTCTGGTGATAAGTCGG - Intronic
920455564 1:206098416-206098438 CAGAAGGTCTGGGTAGTAGACGG - Intronic
920516292 1:206586833-206586855 CTGAAGTTCAGGGATGGAGAAGG - Exonic
922479340 1:225928205-225928227 CTGAAGTTGAGGAGAGGAGAGGG + Intergenic
922621205 1:226989604-226989626 GCGAAGTTCTGGCCAGAAGAGGG + Intergenic
922691875 1:227699480-227699502 CTGAAGTTGGGAGGAGAACAAGG - Intergenic
922876398 1:228943052-228943074 GTGAAATTCTGGGCAGAAAAGGG + Intergenic
922923730 1:229330319-229330341 CTGGAGCTCAGGAGAGAAGATGG + Intronic
923082892 1:230676089-230676111 CTGAAATCCAGGGAAGAAGAAGG - Intronic
923183258 1:231543955-231543977 CAGAAGTACTGGTGGGAAGAAGG + Intronic
924216451 1:241827059-241827081 CAGAAGTATTAGGGAGAAGAGGG + Intergenic
1063437867 10:6049160-6049182 CTGAAGGCCTGAGGAGCAGAGGG + Intronic
1064561830 10:16601221-16601243 CTGAAGTTCTGGAGACATGGAGG - Intronic
1065011792 10:21427557-21427579 CAGAAATACTGGGTAGAAGAGGG - Intergenic
1065025423 10:21535205-21535227 CTGCAGGCCAGGGGAGAAGAGGG - Intronic
1067298613 10:44990468-44990490 CTGAGTTTCTGGGGAGGCGAAGG + Intronic
1067829998 10:49606130-49606152 CTGTATTTCTGTGGAGAAGCAGG - Intergenic
1067842858 10:49695625-49695647 TTGAAGTTCTGGGGTGCAGGAGG - Intronic
1068091812 10:52441197-52441219 CTGAAGTTGAGGGGAGTGGATGG - Intergenic
1068532882 10:58209241-58209263 GTGGAGTCCTGGGGAGAACAAGG + Intronic
1069062505 10:63908875-63908897 CTGAAGGTTTGGGGAGACAAGGG + Intergenic
1072279162 10:93850587-93850609 GGGAAATTCTGGGCAGAAGAGGG + Intergenic
1072511758 10:96133763-96133785 GTGAAGTTCAGGGAAGAACACGG - Intronic
1072763285 10:98075985-98076007 ATGAAGCTCTGAGGAGAAGATGG - Intergenic
1072982162 10:100107896-100107918 CTGAATTTCAGAGGGGAAGAAGG + Intergenic
1073421743 10:103429539-103429561 GTGAAGACATGGGGAGAAGATGG - Intronic
1073622987 10:105068025-105068047 CTGAAATTCTGGAGAGAGTAGGG - Intronic
1073771711 10:106742217-106742239 CTGAAGTACTTGGGACCAGAAGG + Intronic
1075055438 10:119214988-119215010 CTGCAGTTCTGGAGTGAAGACGG + Intronic
1075509976 10:123064230-123064252 CTGGGGTGCTGGGGAGAAGTTGG - Intergenic
1075678964 10:124318829-124318851 TTGAATCTCTGGGGAGCAGAGGG + Intergenic
1075719026 10:124574397-124574419 GTGAAGTTCTGGGGACTCGAGGG - Intronic
1076242351 10:128917793-128917815 CAGGAGTGCTGGGGAGGAGACGG + Intergenic
1076265982 10:129110356-129110378 CTGGAGGTCTGGGCAGGAGAAGG - Intergenic
1076707678 10:132310527-132310549 CTGAAGTTCTAGGGGGATGCTGG + Intronic
1076718182 10:132378430-132378452 CTGAAGTCTCAGGGAGAAGAGGG - Exonic
1076914570 10:133415802-133415824 CTGAGGTCCTGAGGAGTAGAGGG - Intronic
1077024407 11:432846-432868 CTGGAGGACTGGGGAGAAGCAGG + Intronic
1077025410 11:437839-437861 CTGGGGTTCTGGGCAGAGGAGGG - Intronic
1078425933 11:11251419-11251441 TAGCAGTTCTGGGGAGAAGCAGG + Intergenic
1078465335 11:11546055-11546077 CTGAGTGGCTGGGGAGAAGAGGG - Intronic
1079075265 11:17381691-17381713 CTGATGATCTGGGGAGGAGGAGG + Intergenic
1079154338 11:17930504-17930526 CTGCAGCCATGGGGAGAAGATGG + Intronic
1079196300 11:18330536-18330558 CTGAGGTTCTGGTGATAAGTGGG + Intronic
1080863060 11:36167220-36167242 CTGAGGTTCCCGGGAAAAGAAGG - Intronic
1083235564 11:61348630-61348652 GTGAGGTTATGGTGAGAAGATGG + Exonic
1083950195 11:65950318-65950340 CTGGGTTTGTGGGGAGAAGAAGG - Intronic
1085586851 11:77716608-77716630 CTGAAGGTGTGGGGAGATGCTGG + Intronic
1087071110 11:94081855-94081877 GTGAGTTTCTGGGCAGAAGATGG + Intronic
1087144125 11:94795068-94795090 CTGAAAGTCTGGGGAAAAGTAGG - Exonic
1087788851 11:102385603-102385625 GGGAAGTGCTGGGTAGAAGAGGG - Intergenic
1088205429 11:107387096-107387118 CTGGAGTTCTGGGTAGATGCTGG - Intronic
1088474353 11:110219832-110219854 CTGAAGTTCAGGGGAGAATTTGG + Intronic
1088724352 11:112621110-112621132 GAGAAGTTCTGTGGAGAAAATGG + Intergenic
1088830754 11:113534538-113534560 CAGAGGTTGTGGGTAGAAGAAGG + Intergenic
1089048161 11:115521914-115521936 CTGAAGTTGGGGGGAGAAAGGGG + Intergenic
1089507683 11:118974996-118975018 CTGGAGTTCTGGAGAGAAGTGGG + Intronic
1090272439 11:125397687-125397709 CTGAAGTCATGGGGATGAGAAGG + Intronic
1090912591 11:131134467-131134489 CTAAAATTCAGGGGAGCAGAAGG + Intergenic
1090923737 11:131231435-131231457 CTGAGGTTTTGGGGAGCTGAAGG - Intergenic
1091035432 11:132228599-132228621 CATGAGTTCTGGGGAGAAGGTGG - Intronic
1091634284 12:2185610-2185632 GTGAAGACATGGGGAGAAGAGGG + Intronic
1091755064 12:3045982-3046004 CTGAAGATTTGGAGAGATGAAGG - Intergenic
1092152824 12:6262817-6262839 CTGATGGTCTGGAGAGATGAAGG - Intergenic
1093203174 12:16214507-16214529 CCCAACTTCTGGGGAGCAGAAGG + Intronic
1093401773 12:18754487-18754509 AAGAAATTCTGGGCAGAAGAGGG - Intergenic
1095168065 12:38998046-38998068 CTGAAGTTCTGGGTAAATAATGG - Intergenic
1095535758 12:43245023-43245045 CTGAAGATGTGGGGAGATGATGG + Intergenic
1095918676 12:47506980-47507002 CTGGAGTTGTGGGGAGAGGTTGG + Intergenic
1096043515 12:48541751-48541773 CAGATATTGTGGGGAGAAGATGG + Intergenic
1096599909 12:52721876-52721898 CTGAAGTTCTGGGATGGGGATGG + Intergenic
1096843006 12:54390665-54390687 CAGAGGGGCTGGGGAGAAGAGGG - Intronic
1097642490 12:62199154-62199176 CTGGAGTACTGGGGATAAGTAGG + Intronic
1098957944 12:76706841-76706863 CTGTAGTTTTGGGGAGAGGAAGG + Intergenic
1099310380 12:81013111-81013133 CTGAAGTTGTAGGGATAAAAAGG + Intronic
1100991718 12:100258542-100258564 CTTAAGTTTTGGGGTGGAGATGG + Intronic
1101216735 12:102593231-102593253 GGGAAATTCTGGGGAGAAGAGGG - Intergenic
1101325291 12:103710156-103710178 GTCAAGTTCTGGGGAGGAGCTGG - Intronic
1101432770 12:104640814-104640836 GGGAAATTCTGGGCAGAAGAGGG + Intronic
1102301591 12:111775400-111775422 CTGAAGTCCTGGTGAGGAGAGGG - Intronic
1102568110 12:113810333-113810355 CTGAAGATCTGCGGAAAAGAAGG + Intergenic
1102982122 12:117250256-117250278 CTGGAATTCTGGGGAAAGGAGGG - Intronic
1103636353 12:122309786-122309808 CTGAGGAGCTGGGGAGAAGCAGG - Exonic
1103919054 12:124390016-124390038 CTAAAAATCTGGGGAGCAGAAGG + Intronic
1104090501 12:125512928-125512950 CTGATGTCCTGGAGAGGAGAGGG - Intronic
1104099768 12:125596128-125596150 CTGAGTATCTGGGGAGAACATGG - Intronic
1105639682 13:22249644-22249666 GGGAAATTCTGGGCAGAAGAGGG + Intergenic
1105682710 13:22745394-22745416 CGGAAGTGCTGGGTAGAGGAAGG - Intergenic
1106223006 13:27762485-27762507 CTGAAAATCTGGGGAGACCAAGG + Intergenic
1106395177 13:29372875-29372897 CTGAATTTAGTGGGAGAAGAAGG - Intronic
1106532383 13:30605252-30605274 CTGAAGTTCAGGGGAGAGGCTGG + Intronic
1106700964 13:32228335-32228357 TTTAAATTCTGGGGAGAAAATGG - Intronic
1107023378 13:35774857-35774879 CTGGATTTGTGGGGAGCAGAGGG - Intronic
1107042484 13:35964171-35964193 CAGAAGTTCTGCAGAGAAAATGG - Intronic
1107854093 13:44597648-44597670 GGGAAATTCTGGGAAGAAGAGGG - Intergenic
1108487636 13:50942974-50942996 GGGAAATTCTGGGCAGAAGAGGG - Intronic
1108497148 13:51036194-51036216 CAGAGGTTCTTGGGAGAAGGGGG - Intergenic
1108649123 13:52458307-52458329 CTGAAGTTCAGGGGAGGGGTTGG + Intronic
1109798437 13:67345164-67345186 TTTAATTTCTGGGGAGAGGAGGG - Intergenic
1110339220 13:74369559-74369581 TTGAAGTTCCAGGGAGAAGTTGG - Intergenic
1110648370 13:77916083-77916105 CTGAAGTGCTGTGTAGAAGGTGG - Intronic
1111104720 13:83629938-83629960 GGGAAATTCTGGGCAGAAGAGGG - Intergenic
1111235874 13:85406541-85406563 GGGAAATTCTGGGCAGAAGAGGG - Intergenic
1111406322 13:87811270-87811292 GGGAAGTGCTGGGGAGAGGAGGG - Intergenic
1111412156 13:87891304-87891326 CCCAAGTTCTGAGAAGAAGAGGG - Intergenic
1111430550 13:88144427-88144449 GGGAAGTGCTGGGGAGAGGAGGG + Intergenic
1111691810 13:91573076-91573098 CTGATGTTCTGGGAAGAAATGGG + Intronic
1112150285 13:96752443-96752465 ATGAAGTTTTGGAGAGAATATGG - Intronic
1112265573 13:97920359-97920381 CTGGGGGTCGGGGGAGAAGAGGG - Intergenic
1112434986 13:99385430-99385452 CTGATGTTCTTGTGGGAAGAGGG + Exonic
1113252253 13:108466721-108466743 CTGAAGGTTTGGCGAGAAGAAGG + Intergenic
1113373257 13:109741431-109741453 CTGAAGTCATGGGGGGATGAGGG + Intergenic
1114574538 14:23700195-23700217 GGGAAATTCTGGGCAGAAGAGGG - Intergenic
1114574550 14:23700259-23700281 GGGAAATTCTGGGCAGAAGAGGG - Intergenic
1114773300 14:25453360-25453382 CTGAAGTTGTGGGGGAAGGAAGG - Intergenic
1115725167 14:36206544-36206566 CTGAAGTACTTGGGAGTAAAGGG - Intergenic
1116632081 14:47348824-47348846 CTGAATTTTTGAGTAGAAGAGGG + Intronic
1118471215 14:66076978-66077000 CTGAGCTTCTGGGGAGAAATGGG + Intergenic
1119138000 14:72238388-72238410 GGGAAGTACTGGGTAGAAGAGGG - Intronic
1119249855 14:73142683-73142705 CTGAAGTGCTGATGAGTAGAAGG + Intronic
1119844269 14:77816790-77816812 CTGATGTTGTGGGGGGAAGTGGG + Intronic
1120266296 14:82254746-82254768 CTGAAGGTCTGGGAAGAACTTGG - Intergenic
1120465827 14:84855952-84855974 CTGATGTTCTTAGAAGAAGAGGG + Intergenic
1120511541 14:85421661-85421683 CTGTAGTACTGGGGAAAAAAGGG + Intergenic
1121436695 14:93925331-93925353 CAGAAGGCCTGGGGAGAAAAGGG + Exonic
1121666459 14:95676291-95676313 CAGAAATACTGGGTAGAAGAGGG + Intergenic
1121727958 14:96166670-96166692 TTGAAGGTCTGGGGAGAAGGTGG - Intergenic
1121743000 14:96267150-96267172 CTGAAGTAGAGGGAAGAAGAAGG + Intronic
1122209394 14:100165346-100165368 CTGAAGTCAGGGGGAGGAGAGGG - Intergenic
1122449562 14:101794169-101794191 GGGAAGTTCTGGGCAGAAGAGGG - Intronic
1122638525 14:103142567-103142589 CTGAGGATCTGGCGATAAGATGG - Intergenic
1122641630 14:103163442-103163464 GGGAAATTCTGGGCAGAAGAGGG + Intergenic
1122643277 14:103175046-103175068 AGGAAATTCTGGGCAGAAGAGGG + Intergenic
1123765208 15:23471169-23471191 AGGAAATTCTGGGCAGAAGAGGG - Intergenic
1124234916 15:27981830-27981852 CTGAAAGTCTGGGGAGACCAGGG - Intronic
1124553508 15:30705512-30705534 CTGAAGTCGTGGGGAGATGAAGG + Intronic
1124677737 15:31700156-31700178 CTGAAGTCATGGGGAGATGAAGG - Intronic
1125089290 15:35771751-35771773 ATGACGGTCTGGGGAGAACAGGG - Intergenic
1125468139 15:39975360-39975382 GTGAAGTCCTGGGAATAAGAAGG - Intronic
1126673595 15:51137938-51137960 CAGAAGTTCAGGGGAGAAGGAGG + Intergenic
1126928848 15:53624113-53624135 CTGAAGTGATGGCTAGAAGAAGG + Intronic
1127354302 15:58183319-58183341 CTATAGTTCTGGGGAAAAGCAGG - Intronic
1128246470 15:66136012-66136034 CTGAAGTGCAAGGGTGAAGAGGG - Intronic
1128543188 15:68551062-68551084 CTGACTCTCTGGGGGGAAGAGGG + Intergenic
1128891030 15:71331845-71331867 CTGAAGTTCAAGGGACAAGTAGG - Intronic
1129505133 15:76075132-76075154 CTGAAGTTCTGGGGAGAAGATGG + Intronic
1129789965 15:78334482-78334504 CAGGAGTTCTGGGCAGAAGAGGG - Intergenic
1129959494 15:79670439-79670461 CTAAAGTTCAAGGGAAAAGAGGG - Intergenic
1130648303 15:85747489-85747511 CTTAAGTTTTGGGGGAAAGATGG + Intronic
1130763667 15:86848184-86848206 CTGAACTTCTGGTGGGAAAATGG - Intronic
1130826137 15:87548111-87548133 CTGAGGAGATGGGGAGAAGATGG + Intergenic
1130958442 15:88643791-88643813 CTGAAATGCTGGGGACCAGAAGG + Intronic
1131967449 15:97859313-97859335 CCAAAGTTCAGTGGAGAAGATGG - Intergenic
1132092952 15:98960499-98960521 CTCAGGTTCTGAGGAGAGGAAGG + Exonic
1133229663 16:4360541-4360563 CTGAAGATCTGGGGGCAGGAAGG + Exonic
1134434375 16:14242304-14242326 CTGAATGTCTGAGGAGGAGAGGG - Intronic
1135020817 16:18961664-18961686 CTGGAGTTCTAGAGAGAGGATGG - Intergenic
1135254509 16:20930262-20930284 CTGGAGTCCTGGGGAAGAGATGG - Intergenic
1136048820 16:27636309-27636331 CTGAAGCTCTGGGGAGTGGTGGG - Intronic
1137667949 16:50262625-50262647 ATAAAGCTCTGGGGAGAAGCCGG - Intronic
1137822821 16:51462056-51462078 CTGAGGTTCTGGGGACTAGCAGG - Intergenic
1138193953 16:55038716-55038738 CTGCAGTTTGGGGGAGAACAGGG + Intergenic
1139939972 16:70598202-70598224 AGGAAGTTCTGGGGGGCAGACGG - Intronic
1140805774 16:78530707-78530729 GGGAAATTCTGGGCAGAAGAGGG - Intronic
1140833870 16:78775594-78775616 GTGAAGTTGTGGGGAGAGGTGGG - Intronic
1141114540 16:81296984-81297006 CTGAACTGCTGGGCAGAAGGCGG + Intergenic
1141848385 16:86626811-86626833 CTGCAGATGTGGGGAGAAGAGGG - Intergenic
1142178713 16:88656858-88656880 CTGGAGTTGAGGGGTGAAGATGG + Intronic
1142669440 17:1480945-1480967 CAGGAGTGCAGGGGAGAAGAGGG - Intronic
1143483201 17:7238757-7238779 AGGTAGTTGTGGGGAGAAGAGGG - Intronic
1143727708 17:8860771-8860793 CTGAAGCCCTGGGGAGCACATGG - Intronic
1144321482 17:14125668-14125690 CTAATGTTCTGGGTAGTAGATGG + Intronic
1147230121 17:39011647-39011669 GGGAAATTCTGGGCAGAAGAGGG + Intergenic
1148910404 17:50939545-50939567 CTGGAGTTCAGGGGAGAGGGTGG + Intergenic
1149330420 17:55575797-55575819 CTGAAGTTTTGAGGAGAGAAAGG - Intergenic
1149695972 17:58616324-58616346 CTCAAATTATGGGGAGAAGGGGG + Intronic
1150816592 17:68396806-68396828 CAGATATTCTGGGGAGAAGCAGG - Intronic
1151233269 17:72700045-72700067 CAGAAGCTCTTGGGAGACGAAGG + Intronic
1151365856 17:73616139-73616161 CTGATGTTCTGGGGAAGAGGAGG - Intronic
1151543186 17:74775951-74775973 TCGAAGTTCTGGGGAGTGGACGG - Intronic
1152427290 17:80225233-80225255 CTGAGGTCCTGGGCAGGAGAAGG - Intronic
1152934001 17:83125397-83125419 CTGAAGCACTGGGAACAAGAAGG - Intergenic
1155251705 18:23959268-23959290 CTGCACTTCTGGGGAAAACATGG - Intergenic
1155440437 18:25856550-25856572 TTGAAGTTATGAGGAGTAGAAGG - Intergenic
1156286070 18:35697350-35697372 GCGAAGTGCTGGGGAGAAGGAGG + Intronic
1156507565 18:37607983-37608005 CTCAAGTCCTTGGGAGAGGAAGG + Intergenic
1156620941 18:38850838-38850860 CTGAAGTGATGTGGAGAAGGAGG - Intergenic
1157045787 18:44100299-44100321 CTGGAGTGCTGAGGAGGAGATGG + Intergenic
1157154501 18:45252591-45252613 CTGAAGTTCTTGTCAGAATAAGG - Intronic
1158476441 18:57784150-57784172 CTGAAGTTCCTGGGACAGGAAGG + Intronic
1158825049 18:61209124-61209146 CAGAAGGTCTGGTGGGAAGATGG - Intergenic
1159030586 18:63226399-63226421 GGGAAATTCTGGGCAGAAGAGGG - Intronic
1159476512 18:68927730-68927752 GTGAAGTTCATTGGAGAAGAGGG + Intronic
1159611063 18:70526182-70526204 CTGAACCACTGGAGAGAAGACGG + Intergenic
1163410756 19:17152854-17152876 GGGCAGGTCTGGGGAGAAGATGG - Intronic
1163505238 19:17701875-17701897 CTGGAGCTCTGGGGAGATGCAGG + Intergenic
1164276659 19:23724609-23724631 CAGAAGGTGTGGGGAAAAGAAGG - Intergenic
1164364388 19:27559573-27559595 TTTAAGTCCTAGGGAGAAGAAGG + Intergenic
1164634726 19:29784191-29784213 CTGAAGGTGTGGGGAGAAGAGGG + Intergenic
1165554408 19:36617622-36617644 TTGAAGTACTGGGGAGAGAATGG + Intronic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1166666555 19:44683800-44683822 CTGGATATCTGGGGACAAGATGG + Exonic
1166993002 19:46704483-46704505 CTGAAGAGCTGGTGAGGAGATGG - Exonic
1167077465 19:47258155-47258177 CTGAATTTCTATGGAGAAGATGG + Intronic
1168163271 19:54527221-54527243 TTGAAGATCTCGGGAGAGGACGG - Intergenic
1168358828 19:55721003-55721025 CTTAAGTGTTGGGGAGAAAACGG + Intronic
925149200 2:1602947-1602969 GTGAGGTTATGGTGAGAAGACGG - Intergenic
925293887 2:2765503-2765525 CTGTATCTGTGGGGAGAAGAGGG - Intergenic
925757644 2:7149028-7149050 CCAACGTTCTGGGGAGATGAGGG + Intergenic
925907659 2:8548817-8548839 CTGAAATTCAGGTGAGATGAGGG - Intergenic
926456979 2:13079180-13079202 ATGAATTCCAGGGGAGAAGATGG - Intergenic
927404835 2:22755061-22755083 CTGTATTTTTGGGAAGAAGAGGG - Intergenic
930178518 2:48326148-48326170 TTGGAGATCTTGGGAGAAGAAGG - Intronic
930289254 2:49472717-49472739 TTGAATTTCTGGGGAGGAGGCGG - Intergenic
931084121 2:58810024-58810046 CTGTTGTTCAGTGGAGAAGAGGG + Intergenic
931084631 2:58815556-58815578 ATGATGTGCTGGGGAGAATATGG + Intergenic
932330144 2:70894135-70894157 GAGAACTACTGGGGAGAAGAAGG + Intergenic
933165407 2:79069906-79069928 GGGAAATTCTGGGCAGAAGAGGG + Intergenic
933398762 2:81765267-81765289 GGGAAGTTCTGGGTAGAGGAGGG + Intergenic
933425898 2:82112208-82112230 AGGAAGTACTGGGTAGAAGAGGG + Intergenic
933427111 2:82126909-82126931 GTGAAATACTGGGTAGAAGAGGG - Intergenic
933758259 2:85657546-85657568 CAGAGGCTGTGGGGAGAAGATGG + Intronic
933942914 2:87260074-87260096 CTGAAGGGCTGGGGAGGAGCTGG - Intergenic
934477295 2:94602187-94602209 CTGAAGTTTTGGGGTGAGGCAGG - Intronic
935014350 2:99165884-99165906 CTGAATTTCTGGGGTAATGAAGG + Intronic
935913896 2:107927867-107927889 GTGAGGCTATGGGGAGAAGATGG - Intergenic
936090154 2:109496585-109496607 GTGAACATCTGGGGAGAAGCAGG - Intronic
936337300 2:111601488-111601510 CTGAAGGGCTGGGGAGGAGCTGG + Intergenic
936518355 2:113196722-113196744 CTGAACTTTGGAGGAGAAGAGGG + Intronic
937259114 2:120574182-120574204 CTGGAGTTCAGGGGAGGAAAGGG - Intergenic
937700368 2:124857110-124857132 ATGAAGTTGTGGGGTGGAGATGG + Intronic
937748954 2:125451113-125451135 ATCAATTTCTGGGGAGAAGAAGG - Intergenic
937820842 2:126308481-126308503 GGGAAGTGCTGGGTAGAAGAGGG - Intergenic
937857411 2:126682547-126682569 CTGAAGCTGAGGGGAGAAGCGGG - Intronic
937891254 2:126940600-126940622 GGGAAATTCTGGGCAGAAGAGGG - Intergenic
938699578 2:133863901-133863923 GGGAAGTACTGGGTAGAAGAGGG - Intergenic
938719427 2:134052875-134052897 GTGAAGTTCTAGGGAGAAGGTGG - Intergenic
938787832 2:134648510-134648532 GGGAAATTCTGGGCAGAAGAGGG - Intronic
939011861 2:136855910-136855932 GTGAAGATCTGGGGAAAAGGAGG - Intronic
939329658 2:140740768-140740790 ATGAAGATATAGGGAGAAGATGG - Intronic
939500456 2:142976873-142976895 CTGAAAGCCTGGGGAGGAGAGGG + Intronic
940481772 2:154241311-154241333 GGGAAGTGCTGGGTAGAAGAGGG - Intronic
940701738 2:157053215-157053237 CTGAAGAGCTGGAGAGAAGAGGG + Intergenic
941274605 2:163475141-163475163 CTGCAGTTCTGGGGCAAAGCTGG - Intergenic
941576192 2:167233507-167233529 CTGAAGTTCTAGGGTAAAGAGGG + Intronic
942923348 2:181403728-181403750 TGGAAGTTCTGGGGAAAAGAAGG + Intergenic
943165730 2:184322933-184322955 CTGAAGTTCCTTGAAGAAGAAGG + Intergenic
943794959 2:191980693-191980715 CTGGAGGTCTGGAGAGAAGAGGG - Intronic
943906589 2:193506485-193506507 GGGAAGTGCTGGGTAGAAGAGGG - Intergenic
944748347 2:202681774-202681796 GGGAAATTCTGGGCAGAAGAGGG + Intronic
946036246 2:216744692-216744714 CTGAAGTGCTGGGAGGAAAATGG - Intergenic
946098049 2:217292312-217292334 CCGAAATACTGGGTAGAAGAGGG - Intronic
946216011 2:218184096-218184118 GGGAAATTCTGGGCAGAAGAGGG - Intergenic
946482294 2:220068845-220068867 CTGTAAGTCTGGGGAGAACAGGG - Intergenic
946613366 2:221482663-221482685 ATCAAGTTCAGGGGAGCAGATGG + Exonic
947040253 2:225910419-225910441 CTGTATCTCTGGGGAGAAGCAGG - Intergenic
947258517 2:228193209-228193231 GGGAAGTTTGGGGGAGAAGAGGG - Intergenic
947746814 2:232512196-232512218 CAGCAGTTCTGGGGAGGAGGGGG - Intergenic
947906439 2:233766604-233766626 GGGAAGTGCTGGGTAGAAGAGGG - Intronic
1168880378 20:1201435-1201457 CTGAAGTTCTTGGGGGAAGGGGG + Intergenic
1169338421 20:4776468-4776490 GTGAAGTGCTGGGTAGAGGAGGG - Intergenic
1169387373 20:5162598-5162620 CTGAAGCTTGGGGGAGAAGTTGG + Intronic
1169930996 20:10832842-10832864 CTGTAGTTCTTGGGAGTACAAGG + Intergenic
1170297010 20:14838858-14838880 TTGAAGTTCTGGGGAGTGAAGGG - Intronic
1170861124 20:20104822-20104844 GTGAAGACATGGGGAGAAGATGG - Intronic
1171432346 20:25091025-25091047 CTGAAGTCCTGGGGGGCAGAGGG + Intergenic
1172105199 20:32513038-32513060 CTGAAGTCCTTGGAAGAAGGAGG - Intronic
1172230747 20:33334037-33334059 CTGAAGATCTGATGGGAAGATGG - Intergenic
1174149537 20:48476414-48476436 CTGGAGACCTGGGGAGAAGCTGG - Intergenic
1174230266 20:49040558-49040580 CTGATGTGCTGGAGAGCAGATGG + Intergenic
1177124620 21:17181200-17181222 GGGAAATTCTGGGTAGAAGAGGG + Intergenic
1177489156 21:21799779-21799801 CTGAAGTATTGCAGAGAAGAGGG + Intergenic
1177703781 21:24674181-24674203 GGGAAATTCTGGGCAGAAGAGGG + Intergenic
1177787147 21:25683140-25683162 AGGAAGTACTGGGTAGAAGAAGG - Intronic
1178142241 21:29697726-29697748 CTGAAGCTATGGGGAGGAGAAGG - Intronic
1178565155 21:33677233-33677255 CTGCAGTTCTTGGGAGAAGTAGG - Intronic
1179721802 21:43320549-43320571 CTGAAGATACAGGGAGAAGACGG + Intergenic
1180820485 22:18823900-18823922 CTGAAATGCTGGGGAGAACCAGG + Intergenic
1181206709 22:21258372-21258394 CTGAAATGCTGGGGAGAACCAGG + Intergenic
1181903515 22:26174453-26174475 GTGAAGTTCAGGGGAGAGCAGGG - Intronic
1182244191 22:28942441-28942463 ATGAAGGTCTAGGGACAAGAAGG - Intronic
1183228483 22:36566114-36566136 CTCAAGTGGTGGGAAGAAGATGG + Intronic
1183352531 22:37342272-37342294 CTGAAATGCTGGGGAGGAGCTGG - Intergenic
1183554721 22:38516301-38516323 CTAAAGTTCAGTGGAGAAGCTGG - Intergenic
1183579265 22:38713875-38713897 CTGGAGTTCTGGGCATAGGATGG + Intronic
1184085021 22:42256159-42256181 CTGGAGTGCTGGGGAGAACTAGG - Intronic
1184883965 22:47330837-47330859 CTGATGTTTGGGGAAGAAGAGGG - Intergenic
1185021285 22:48377748-48377770 CTGAAGTGCTTGGGACCAGAAGG + Intergenic
1203220215 22_KI270731v1_random:37051-37073 CTGAAATGCTGGGGAGAACCAGG - Intergenic
1203270611 22_KI270734v1_random:49775-49797 CTGAAATGCTGGGGAGAACCAGG + Intergenic
949159339 3:861024-861046 CTGAAGACCTGGGGAGCAGCGGG - Intergenic
949159397 3:861464-861486 CTGGAGATCTGGGGAGGAGCTGG - Intergenic
949695564 3:6690176-6690198 CTGAAATCATGGAGAGAAGAAGG + Intergenic
950327204 3:12121953-12121975 CTGAGGTTTTGCAGAGAAGAAGG - Intronic
950966870 3:17152635-17152657 CTCAAGATCTGGGGAGGAGGTGG + Intergenic
951091618 3:18580068-18580090 CTCAACTTCTGGGGAGGGGAGGG + Intergenic
951251095 3:20395211-20395233 GGGAAATTCTGGGAAGAAGAGGG + Intergenic
952376674 3:32773284-32773306 CAGAATTTCTGGGGATAAGATGG + Intronic
953384691 3:42499880-42499902 CTGAAGCACTGGGGGGAAGGGGG - Intronic
953611308 3:44449695-44449717 CTGAAGTCCTGGTGGGAAGGTGG + Intronic
953664518 3:44916436-44916458 CTGCAGTTCAGAGGAGAAGAAGG - Intronic
954496100 3:50963830-50963852 CTGAGATTCTAGGGAGAACAAGG + Intronic
954563595 3:51579405-51579427 GGGAAATTCTGGGCAGAAGAGGG - Intronic
954700461 3:52448067-52448089 CTGAAGTACAGGGGAGATGGTGG - Intergenic
955060944 3:55490905-55490927 CTGAAGTCCTTGGGACTAGACGG - Intergenic
955074434 3:55600500-55600522 CTTGAGTGGTGGGGAGAAGATGG - Intronic
955156996 3:56426675-56426697 CTGCTGTTCTGAGGAGAAGGTGG + Intronic
955367987 3:58327778-58327800 GTGAAGGGCTGGGGAGGAGATGG - Intergenic
955840879 3:63111461-63111483 AAGAAGTTCTGGGGATAATACGG - Intergenic
956074663 3:65491940-65491962 TTGATGTTCTTTGGAGAAGACGG - Intronic
957337701 3:78853174-78853196 TTGAAGAGCAGGGGAGAAGAAGG + Intronic
957414185 3:79879021-79879043 AGGAAATTCTGGGCAGAAGAGGG - Intergenic
958177589 3:90016235-90016257 CTGCAGAGCTGGGGAGAAGCGGG + Intergenic
958467389 3:94474026-94474048 GGGAAATTCTGGGCAGAAGAGGG - Intergenic
959376488 3:105594110-105594132 TGGAAATTCTGGGGAGAAGAGGG - Intergenic
960042090 3:113161084-113161106 CTGATGTTGTGGGGAGAGGGAGG + Intergenic
960428966 3:117545490-117545512 CAGAAGTCCTGGAGAGAGGAAGG + Intergenic
961054398 3:123775809-123775831 GTGAACCTCTGGGAAGAAGATGG + Intronic
961153452 3:124659062-124659084 CTGAAGTGGTGGAGAGAATAAGG + Intronic
961295559 3:125881407-125881429 TTCAAGTTCTGGTGAAAAGACGG + Intergenic
961328432 3:126125209-126125231 CAGAAGTCCTGGAGAGAAGCAGG - Intronic
961532217 3:127546865-127546887 CTGAAGTTCTAGGGGGAAAAAGG + Intergenic
961826827 3:129603542-129603564 ATGAAGCTCTGGGGTGGAGATGG + Intronic
962737496 3:138338924-138338946 CTCAAGGCCTGGGGAGCAGATGG - Intergenic
963326821 3:143872356-143872378 CTGAAGAACTGGGGATAAGGAGG - Intergenic
963470827 3:145739832-145739854 CTGAAATTCTGAAGGGAAGAAGG + Intergenic
964364467 3:155934566-155934588 CAGAATCTCTGGGGAGAAAAAGG - Intronic
964564131 3:158031126-158031148 TTGGAGTTATGGGGAGAGGAGGG + Intergenic
965064797 3:163832722-163832744 CGAAAGTTCTTGGGAGAAGTTGG + Intergenic
965212834 3:165816922-165816944 CTGAAATTCAAGGGAGAAAAAGG - Intronic
965247515 3:166292351-166292373 GGGAAATTCTGGGTAGAAGACGG - Intergenic
965261604 3:166493039-166493061 CTGAAGTTATTGGAAGAAGGAGG - Intergenic
966133755 3:176674675-176674697 CTTAAATTCTGAGGAGAAAATGG - Intergenic
967222258 3:187257207-187257229 CTGAAGTTCTGGGTACAGGGAGG - Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967425644 3:189324200-189324222 GTAGAGTTCTGGGGATAAGAAGG + Exonic
970128811 4:12843981-12844003 GTGAAGATGCGGGGAGAAGATGG - Intergenic
971017761 4:22506133-22506155 CTGAAGATGGGGGGAGAAGCAGG + Intronic
971255933 4:25013340-25013362 ATGAAGATGTGGGGAGAAGGAGG + Intronic
971269471 4:25127606-25127628 TGGAAGTTCTGAGAAGAAGATGG - Intronic
971427421 4:26530222-26530244 GGGAAGTTCTGGGCAGACGAGGG + Intergenic
971896646 4:32605368-32605390 GTGAAGTTGTGAGGAGAGGACGG - Intergenic
972669712 4:41203704-41203726 CTGGAGTACTGGGGAGAATTGGG - Intronic
973662508 4:53122475-53122497 CTGAAGTTCTTGGCAGGATAGGG - Intronic
974026584 4:56738318-56738340 CTGAAGTGCTAGGGAGATGATGG + Intergenic
975008711 4:69322452-69322474 CTGAAGTGCAGGGGAGGAGAAGG - Intronic
975421353 4:74167700-74167722 CTGAAGATCTGGAGAGAACATGG + Intronic
976086690 4:81414033-81414055 CTGAAGTTCAGGGAAGGACAAGG + Intergenic
976473357 4:85455118-85455140 TGGAAGTACTGGGTAGAAGAGGG + Intergenic
977319836 4:95499620-95499642 GTGAAGTTGTGGGGAGAAAAAGG + Intronic
977827548 4:101551694-101551716 GGGAAATTCTGGGCAGAAGAGGG + Intronic
978260545 4:106752354-106752376 CCAAAATTCTGGGCAGAAGATGG + Intergenic
978297229 4:107220045-107220067 CAGAAGTTTGGGGGAGAAAAAGG - Intronic
978963947 4:114719114-114719136 GTGAAGTTATAGTGAGAAGATGG - Intergenic
979652071 4:123146426-123146448 CAGCAGTTATGGGGACAAGATGG + Intronic
979838015 4:125397999-125398021 CTCAAGTTCTGGTAAGAAAAGGG - Intronic
980270566 4:130578839-130578861 CTGAGGAGCTGGGGAGAAGCAGG - Intergenic
980994437 4:139766661-139766683 TTGGAGTTGTCGGGAGAAGAAGG - Intronic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
981432340 4:144676184-144676206 CTGAATTTCTTGGAAGCAGATGG - Intronic
982673867 4:158353081-158353103 CTTATGTTCTAGTGAGAAGAAGG - Intronic
982786680 4:159544396-159544418 GGGAAATTCTGGGCAGAAGAGGG - Intergenic
982798534 4:159673793-159673815 GAGAAATTCTGGGCAGAAGAGGG + Intergenic
982833432 4:160091774-160091796 TTGATGTTCTAGGAAGAAGAGGG - Intergenic
983532479 4:168825538-168825560 GTGAAGTGCTGGGTAGAAGGAGG + Intronic
983550940 4:169016753-169016775 GTAAAGCTCTGGGGATAAGAGGG + Intergenic
983562016 4:169110883-169110905 CTGAAGTTATGCGTAGAAAATGG + Intronic
983945881 4:173584937-173584959 ATGAAGCTCTGGGGAGGAAAAGG + Intergenic
983987234 4:174073872-174073894 GGGAAATTCTGGGCAGAAGAGGG - Intergenic
984519817 4:180788193-180788215 ATGAGGTTCTTTGGAGAAGAAGG + Intergenic
985752984 5:1693034-1693056 GGGAAATTCTGGGTAGAAGAGGG - Intergenic
986196104 5:5537433-5537455 GAGAAGCTGTGGGGAGAAGAGGG + Intergenic
986406590 5:7431851-7431873 GGGAAATTCTGGGCAGAAGAGGG + Intronic
987569498 5:19638009-19638031 CAGAAGTTGTGAAGAGAAGATGG - Intronic
990128351 5:52547999-52548021 GGGAAATTCTGGGCAGAAGAGGG + Intergenic
991082389 5:62615223-62615245 CGGAAATACTGGGTAGAAGAGGG - Intronic
991247982 5:64528144-64528166 CCGAAGATCTAGGGAGAAGACGG + Intronic
991290699 5:65031327-65031349 CTGAAGCACTGTGGGGAAGATGG + Intergenic
991996013 5:72387641-72387663 CTTAAGTTCAGGGGGGAAAAGGG - Intergenic
992226144 5:74621129-74621151 CAGAAATACTGGGTAGAAGAGGG - Intergenic
993184567 5:84600770-84600792 GGGAAATACTGGGGAGAAGAGGG - Intergenic
994188136 5:96838178-96838200 AGGAAATTCTGGGCAGAAGAGGG - Intronic
994750136 5:103727091-103727113 CAGAAGGTCTGGGGTGAAGATGG + Intergenic
995020316 5:107360007-107360029 CTGAATATCTGGTGATAAGAAGG + Intergenic
995264210 5:110139153-110139175 CTGAACTCCTGGGGAAAGGATGG - Intergenic
996101566 5:119450327-119450349 GGGAAATTCTGGGCAGAAGAGGG - Intergenic
996154269 5:120078578-120078600 TTGAAGGTTTGGGGATAAGATGG + Intergenic
996502205 5:124229954-124229976 GGGAAATTCTGGGCAGAAGAGGG + Intergenic
996585332 5:125081357-125081379 TTGAAGTTGTGGTGATAAGATGG - Intergenic
996650810 5:125873717-125873739 GGGAAATTCTGGGCAGAAGAAGG - Intergenic
996654220 5:125917955-125917977 TTTAATTTCTGGGGAGAAGAGGG + Intergenic
996657445 5:125958519-125958541 CTGATTCTCTGGGTAGAAGAGGG + Intergenic
996726140 5:126674756-126674778 TTTAAGTTCTTGAGAGAAGAAGG + Intergenic
996807050 5:127467865-127467887 GAGAAGTTCAGGGAAGAAGATGG - Intergenic
996841197 5:127849292-127849314 CTGTAGAACTGGGGAGAATAAGG - Intergenic
997064624 5:130546677-130546699 TTTAATTTCTGGGGAGAAGAGGG - Intergenic
998158043 5:139797106-139797128 CTAAAGTCCTGGGGAGAGGGTGG - Intronic
998644042 5:144042529-144042551 GGGAAATTCTGGGCAGAAGAGGG - Intergenic
999682953 5:154076776-154076798 CAAGAGTACTGGGGAGAAGATGG - Intronic
999924937 5:156364834-156364856 CTACAGTTCTGGAGAGAAAATGG - Intronic
1000021585 5:157323252-157323274 CTGAAGTTCAGGGTGGAAGGCGG - Intronic
1000866331 5:166519016-166519038 GGGAAATTCTGGGAAGAAGAAGG - Intergenic
1002452501 5:179326849-179326871 CTGAAGTCATGGGAAGGAGAGGG + Intronic
1002722463 5:181271256-181271278 CTGAAGGCCTGGAGAGAACAAGG - Intergenic
1002837450 6:876895-876917 CTGAAGTTCTGCAGAGCAGACGG + Intergenic
1003175361 6:3750030-3750052 GTGAGGCTCTGGGGAGCAGAGGG + Intronic
1003400698 6:5788161-5788183 CTGGAGTGCTGGGGAGACAAGGG - Intergenic
1005639152 6:27778012-27778034 CCACAGTTGTGGGGAGAAGATGG + Intergenic
1005707470 6:28469663-28469685 CTGGAGTTCCGGGGAGACGTGGG - Intergenic
1006179806 6:32148059-32148081 CTGGAGTTCTGGGGATAGTAGGG + Intergenic
1006244408 6:32717703-32717725 CAGAAGTGCTGGGTAGAGGAGGG - Intergenic
1007186639 6:39977526-39977548 CAGAAATCCTGGGGAGAAGTGGG - Intergenic
1007375727 6:41455351-41455373 CGGTGGTTCTGGGGTGAAGAAGG - Intergenic
1008255828 6:49298173-49298195 GGGAAATTCTGGGCAGAAGAAGG - Intergenic
1008847901 6:55990696-55990718 TTGACATGCTGGGGAGAAGAAGG + Intergenic
1009192447 6:60645681-60645703 CTGAAATTCAGGGGAAAACATGG + Intergenic
1009524724 6:64729207-64729229 GGGAAATTCTGGGCAGAAGAGGG - Intronic
1009544028 6:65001655-65001677 CGGAAATACTGGGTAGAAGAAGG - Intronic
1009764122 6:68047104-68047126 CTGAAGTTCTTTATAGAAGATGG + Intergenic
1010344691 6:74798317-74798339 CTGGAGTTCTGGGGAGGACTAGG + Intergenic
1010655813 6:78509334-78509356 CTGAAGTTCTCGGGAGAACTAGG + Intergenic
1010793657 6:80093895-80093917 CTGAAGCTCAGGGCAGAAAATGG - Intergenic
1011325794 6:86149065-86149087 GGGAAGTTCTGGGTAGAGGAGGG - Intergenic
1011805703 6:91070616-91070638 CAGAATTTCTGGGGAGATAAGGG + Intergenic
1011899592 6:92275435-92275457 GGGAAATTCTGGGCAGAAGAGGG - Intergenic
1013050882 6:106533843-106533865 CTGGAGTTCAGGGGAGAGGCTGG + Intronic
1013492398 6:110660935-110660957 GGGAAATTCTGGGCAGAAGAGGG - Intronic
1014138790 6:117917734-117917756 GTGGAATTCTGGGGAGAAGTCGG + Intronic
1014276370 6:119394593-119394615 GGGAAATTCTGGGCAGAAGAGGG - Intergenic
1014943368 6:127469619-127469641 TTGAAGTTATAGGGAAAAGATGG + Intronic
1015421616 6:133017023-133017045 GTGAAGTTCTGAGAGGAAGAGGG + Intergenic
1015812864 6:137178792-137178814 CTGAAGTTCTGGGAATACGCAGG + Intergenic
1016345383 6:143107624-143107646 CTAAAGGTCTGGGAAGCAGAGGG + Intronic
1016549010 6:145255874-145255896 GGGAAATTCTGGGCAGAAGAGGG - Intergenic
1017322352 6:153108513-153108535 CTGAAGTTCTGGGCACAAGGGGG - Intronic
1017510750 6:155112616-155112638 CTGGAGTTCAGGAGAGAAGTGGG - Intronic
1018083337 6:160277599-160277621 CTGAGGTCAGGGGGAGAAGATGG - Intronic
1019117349 6:169775631-169775653 CTGAAGCTCAGGAGAGAAGTAGG + Intronic
1019398610 7:837187-837209 CTGAAGTGCTGGGGTGAGCAGGG + Intronic
1019879048 7:3842249-3842271 CTTAAGGTCTGGGGAGAGGAAGG - Intronic
1019924918 7:4185746-4185768 CTAACGTTCTGGGGATAAGAGGG - Intronic
1020284167 7:6667492-6667514 GGGAAATTCTGGGCAGAAGAGGG + Intergenic
1020377565 7:7505188-7505210 CTGAAGTTGTAGGGAGCAGTTGG - Intronic
1020739135 7:11990706-11990728 GGGAAATTCTGGGCAGAAGAGGG - Intergenic
1020880316 7:13753849-13753871 CTGAAGTTCAGGTGAGGAGTGGG - Intergenic
1021092644 7:16501707-16501729 GGGAAATTCTGGGCAGAAGAGGG + Intronic
1021325120 7:19257033-19257055 CTGAATTTTATGGGAGAAGAGGG + Intergenic
1021422545 7:20461801-20461823 CTTAAGGTCTGGGGACAGGAGGG + Intergenic
1021522604 7:21552567-21552589 TTTAATTTCTGGGGAGAAGAGGG - Intronic
1021808325 7:24378610-24378632 GGGAAATTCTGGGCAGAAGAGGG + Intergenic
1022826582 7:34020540-34020562 CTGAAGTTCTGGGTACATCATGG + Intronic
1022964980 7:35464362-35464384 CAGCATTTCTGGGGAAAAGAGGG + Intergenic
1023500556 7:40844724-40844746 GGGAAGTACTGGGTAGAAGAGGG - Intronic
1023532567 7:41173681-41173703 CTAAAGTTGTGGGGAGGGGAGGG - Intergenic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1023870961 7:44262830-44262852 CTCAAGGTCAGGGGAGAAGAGGG + Intronic
1024831824 7:53468777-53468799 CAGAAATTGTGGGGAGGAGAGGG - Intergenic
1026583390 7:71636320-71636342 CTGCAGTTCTCTGGGGAAGATGG + Intronic
1026683081 7:72484672-72484694 CTGACATTCTGGGGAGATGAAGG - Intergenic
1026919447 7:74144459-74144481 GGGAAATTCTGGGCAGAAGAGGG + Intergenic
1027005410 7:74688744-74688766 AGGATGTTCAGGGGAGAAGAGGG + Intronic
1027722117 7:81756688-81756710 CAGAATCTCTGGGGAGAATAGGG - Intronic
1027888255 7:83937479-83937501 CAGAAATACTGGGTAGAAGAGGG + Intergenic
1027978483 7:85186943-85186965 CTGGAGCTTTGGGGAGGAGAGGG + Intergenic
1028095615 7:86756507-86756529 TTGAAGTTCTGGGGAAAAACTGG - Intronic
1031125088 7:117764315-117764337 CTGCAGTGCTGGGGAGAGGAGGG - Intronic
1031362283 7:120860887-120860909 CTAAAGTTGTGGAGAGAAAAAGG + Intergenic
1032771115 7:135057915-135057937 CAGAAGTTCTGGGAAAACGAAGG + Intronic
1033071814 7:138209777-138209799 GGGAAATTCTGGGCAGAAGAGGG - Intergenic
1033419063 7:141189785-141189807 CCAAAGTTGTGGGGAGAGGAGGG + Intronic
1033527754 7:142232945-142232967 GGGAAATTCTGGGTAGAAGAGGG - Intergenic
1033573247 7:142655169-142655191 CGGAAATACTGGGTAGAAGAGGG + Intergenic
1033767036 7:144505513-144505535 AGGAAATTCTGGGTAGAAGAGGG + Intronic
1033875787 7:145817322-145817344 AGGAAATTCTGGGCAGAAGAGGG + Intergenic
1033881365 7:145887484-145887506 CAGAAATTCTGGGTAGAAGAGGG - Intergenic
1034323577 7:150208226-150208248 CTGAGAGTCTGGGGAGAACAAGG + Intergenic
1034327730 7:150252263-150252285 CTTAAGTTCTTTGGAGAACATGG + Intronic
1034703099 7:153113854-153113876 CTGAAAATCTGGGGAGCAAAGGG - Intergenic
1034765483 7:153717170-153717192 CTTAAGTTCTTTGGAGAACATGG - Intergenic
1034769617 7:153760961-153760983 CTGAGAGTCTGGGGAGAACAAGG - Intergenic
1034828629 7:154289703-154289725 CTGAAGTTGTGCAGAGAAGGTGG - Intronic
1035020516 7:155797515-155797537 CTGCAATTCTGGGGAGAGCATGG + Intergenic
1035345681 7:158196289-158196311 CTGAAGGTCTGGGGAAACCAAGG - Intronic
1036471025 8:9052940-9052962 CTCAACCTCTGGAGAGAAGAGGG + Intronic
1036986544 8:13538134-13538156 CTGAGGTTCTGTGGAGAAATAGG + Intergenic
1037606488 8:20442090-20442112 CTGGAGTTCAGGGGAGGAGAAGG + Intergenic
1039257283 8:35733442-35733464 CTGAACTTGTGCTGAGAAGAAGG + Intronic
1039407332 8:37324846-37324868 CTGAGGTTCAGGGAAGCAGAAGG + Intergenic
1040555026 8:48470700-48470722 CTGAAGTTCTTTACAGAAGAGGG + Intergenic
1040652449 8:49464728-49464750 AGGAAGTGCTGGGTAGAAGAGGG + Intergenic
1040756695 8:50783832-50783854 CTGAAGTTCTGGAGCCAAGATGG - Intronic
1041243563 8:55870263-55870285 CTGAGGTTCTGTGAAGAAGAGGG + Intergenic
1041600965 8:59716931-59716953 CTGAAGGCCTGGGAAGAAGAAGG - Intergenic
1042103669 8:65300907-65300929 ATGAAGTCATGGGGAGAAGATGG - Intergenic
1042401906 8:68359508-68359530 CAGAAGTGCTGGTGATAAGAGGG + Intronic
1043238526 8:77900079-77900101 GGGAAGTGCTGGGTAGAAGAGGG - Intergenic
1043501466 8:80861771-80861793 CTGGAATTCAGTGGAGAAGATGG - Intronic
1043821193 8:84867132-84867154 GTGAAGACATGGGGAGAAGATGG - Intronic
1044138478 8:88617764-88617786 CTGAAGTAGATGGGAGAAGAGGG + Intergenic
1045031747 8:98143714-98143736 CGGAAGTTAGGGGGAAAAGAGGG - Intronic
1045227442 8:100263091-100263113 TTGAAGTTCAGGGGAGAGGTCGG + Intronic
1046277511 8:111982650-111982672 GGGAAGTGCTGGGTAGAAGAAGG - Intergenic
1046955820 8:120062000-120062022 ATGAAGTACTGATGAGAAGATGG - Intronic
1048196926 8:132339042-132339064 CAAAAGTTCTTGGGATAAGATGG + Intronic
1048294966 8:133207277-133207299 CTGGACTTCAGGGGAGAAGCAGG + Intronic
1048310931 8:133322001-133322023 CTGCAGTTCTGCGAAGGAGAAGG + Intergenic
1048351328 8:133619038-133619060 CTGAAGTGCTGGGTAGGAGTGGG + Intergenic
1048465316 8:134660724-134660746 CTGAACTTCTGGGGACCACAGGG + Intronic
1048512624 8:135076460-135076482 GTGAAGTCCTGGGCAGAAGGAGG - Intergenic
1048681922 8:136852413-136852435 ATGAAATACTGGGGAAAAGATGG + Intergenic
1049778341 8:144416375-144416397 CTGGGGTCCTGGGGAGAAGAGGG + Intronic
1050330372 9:4539928-4539950 GAGAAATTCTGGGCAGAAGAGGG + Intronic
1052235129 9:26203940-26203962 ATGAAGTTCTAGGGATATGAAGG - Intergenic
1052852675 9:33387375-33387397 CTGAAGTTTTGGGGTGAGGCAGG + Intronic
1052993622 9:34537472-34537494 CTTGAGTTGTGAGGAGAAGAGGG - Intergenic
1053351171 9:37414346-37414368 CTGCTCTTCTGGGGAGCAGAGGG - Intergenic
1053545420 9:39018142-39018164 GGGAAATTCTGGGCAGAAGAGGG - Intergenic
1053680774 9:40483926-40483948 CTGAAGTTTTGGGGTGAGGCAGG + Intergenic
1053809750 9:41839840-41839862 GGGAAATTCTGGGCAGAAGAGGG - Intergenic
1054282939 9:63141009-63141031 CTGAAGTTTTGGGGTGAGGCAGG - Intergenic
1054293856 9:63319441-63319463 CTGAAGTTTTGGGGTGAGGCAGG + Intergenic
1054391881 9:64623930-64623952 CTGAAGTTTTGGGGTGAGGCAGG + Intergenic
1054503848 9:65892398-65892420 CTGAAGTTTTGGGGTGAGGCAGG - Intronic
1054620843 9:67347588-67347610 GGGAAATTCTGGGCAGAAGAGGG + Intergenic
1055394105 9:75855124-75855146 CTGCAATTCTGGAGAAAAGAGGG + Intergenic
1057008597 9:91582425-91582447 CTGAAATAAAGGGGAGAAGAAGG - Intronic
1057020996 9:91697574-91697596 CAGAGGTTCTGGGGAGCATAGGG - Intronic
1057395971 9:94680735-94680757 CTGAGGTTCTGGGAAGCACATGG - Intergenic
1057397892 9:94696317-94696339 CTTATGTTCTGGTGAGCAGAGGG - Intergenic
1059306026 9:113353908-113353930 CTGGGGTTCTGGGATGAAGACGG + Intronic
1060214980 9:121733505-121733527 CCTGAGCTCTGGGGAGAAGACGG + Intronic
1061730674 9:132611522-132611544 CAGAGGTCCTGGGGAGAGGAAGG - Intronic
1062486265 9:136777885-136777907 CTGGAGACCTGGGGAGAAGCTGG - Intergenic
1062486349 9:136778387-136778409 CTGGAGACCTGGGGAGGAGATGG - Intergenic
1062563846 9:137154929-137154951 CTGAAGGTCTGGGGTCAAGAAGG - Intronic
1186033270 X:5392617-5392639 GAGAAATTCTGGGCAGAAGAGGG - Intergenic
1186111515 X:6262136-6262158 AGGAAGATCTTGGGAGAAGAAGG - Intergenic
1186128676 X:6443093-6443115 GGGAAATTCTGGGCAGAAGAGGG - Intergenic
1187185286 X:16978631-16978653 CAGAAGTTCTTGGTAGAAGAGGG + Intronic
1187929088 X:24277493-24277515 CGGGAGTTATGGGGAGAGGATGG - Intergenic
1188554842 X:31399570-31399592 GGGAAATTCTGGGCAGAAGAGGG - Intronic
1188966450 X:36559331-36559353 CTGAGGGTGTGGGGAGAGGAGGG - Intergenic
1190391430 X:49935596-49935618 CTGAATTTATAGAGAGAAGAAGG + Intronic
1190442757 X:50492243-50492265 TTGGAGCTCTGGGGAGAAGCTGG + Intergenic
1191199719 X:57766747-57766769 CTGAAGTTCTTGGGGATAGATGG - Intergenic
1191215706 X:57930628-57930650 CTGATTTTCTGGGGAGTGGAGGG + Intergenic
1192622133 X:72688563-72688585 TTCAAGATCTGGAGAGAAGAAGG - Intronic
1194146249 X:90268636-90268658 CAGAAACTCTGTGGAGAAGAGGG - Intergenic
1196458243 X:115904804-115904826 GTGAAGTTCTGGAGACAAAAAGG - Intergenic
1196725122 X:118888612-118888634 TTTAATTTCTGGGGAGAGGAGGG + Intergenic
1197746764 X:129936766-129936788 CTCAAGTTCAGGGCAGAATAAGG - Intergenic
1199030469 X:142992979-142993001 CTGAAGTTCTCCTGAGAAGTGGG + Intergenic
1199323894 X:146474806-146474828 GTGAAGTTACAGGGAGAAGATGG + Intergenic
1199336995 X:146630161-146630183 GAGAAATTCTGGGCAGAAGAGGG + Intergenic
1200142723 X:153909917-153909939 CTCCAGGTCTGGGGAGGAGAGGG + Exonic
1200163852 X:154022787-154022809 CTGAAGAGCTGGGGAGAATGGGG - Intronic
1200491991 Y:3837907-3837929 CAGAAACTCTGTGGAGAAGAGGG - Intergenic
1201470960 Y:14334529-14334551 CTGTAGGTGTGGGGAAAAGAAGG - Intergenic
1201646617 Y:16240491-16240513 GTGAAGGCCTGGGGAGAAGTTGG - Intergenic
1201656196 Y:16344826-16344848 GTGAAGGCCTGGGGAGAAGTTGG + Intergenic