ID: 1129506050

View in Genome Browser
Species Human (GRCh38)
Location 15:76082474-76082496
Sequence CAGAGTATTATGATGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129506048_1129506050 29 Left 1129506048 15:76082422-76082444 CCAAGAGTTGGTCAGGAAGAGAG 0: 1
1: 0
2: 3
3: 23
4: 247
Right 1129506050 15:76082474-76082496 CAGAGTATTATGATGGAGTCAGG 0: 1
1: 0
2: 2
3: 15
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129506050 Original CRISPR CAGAGTATTATGATGGAGTC AGG Intronic
900381755 1:2387645-2387667 CTGAGTAGTATGATGGAGGCAGG - Intronic
900606767 1:3527172-3527194 CAGAGTTTTAGGATGGAGCCTGG - Intronic
903101320 1:21032929-21032951 CATTGTATTATGATGGATTTGGG - Intronic
905305689 1:37016237-37016259 CAGGGGATTACAATGGAGTCAGG + Intronic
908308267 1:62847855-62847877 CAGATGAGTATGATGAAGTCAGG + Intronic
908755592 1:67466383-67466405 CAGATTATGATGATGAAGGCTGG + Intergenic
909200342 1:72684173-72684195 CAGAGGCTTATGATGTAGTCAGG + Intergenic
909606671 1:77515170-77515192 CATAGTATTGTCAGGGAGTCAGG - Intronic
910703853 1:90105446-90105468 CAGAGCATCAGCATGGAGTCCGG - Intergenic
911377225 1:97065713-97065735 CATAGTACTGTGATGGAGACTGG - Intergenic
913490920 1:119379207-119379229 CAGAGTTTCATGTTGGAGGCTGG + Intronic
914992101 1:152507722-152507744 CAGAGTGCTATGATGGAGAGAGG + Intergenic
916231096 1:162542041-162542063 GAGAAGATTATGAGGGAGTCGGG + Intergenic
917072546 1:171168483-171168505 CAGAGTATTAAGAGGGAGCAAGG - Intergenic
918468231 1:184843481-184843503 CAGAGTATTTTGATGGTATTTGG - Intronic
918837845 1:189490809-189490831 CTGAGTATTATGATGAAATCTGG - Intergenic
920915711 1:210256348-210256370 CAGAGCATTAGAATGGGGTCAGG + Intergenic
922191397 1:223321756-223321778 CATAGTATTATGAAGGAAACTGG + Intronic
923166597 1:231369907-231369929 CAGAGCATTTTAATTGAGTCAGG + Intronic
1066152980 10:32644131-32644153 CATAGTATAATGATTGAATCAGG + Intronic
1067207867 10:44234967-44234989 CAGATTCTTATCCTGGAGTCTGG + Intergenic
1068339279 10:55680860-55680882 CATTGTATAATGATAGAGTCAGG + Intergenic
1068405627 10:56585170-56585192 CAGAGTAATATAATGGACACCGG - Intergenic
1069699590 10:70412372-70412394 CAGAATTTTATGATGGCGGCCGG + Intronic
1070911829 10:80125695-80125717 CAGAGTGATATAATGGACTCTGG + Intergenic
1071219882 10:83453328-83453350 CAGAGTGTTATCATGGTGTTTGG + Intergenic
1071990369 10:91095570-91095592 CAGAGTAATAAGATGAAGTTTGG + Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1081443503 11:43106617-43106639 TAGAGTATTAGGAGGGAGCCTGG + Intergenic
1082140673 11:48604580-48604602 CAGAGAATTACGATGGACTATGG + Intergenic
1083464880 11:62838830-62838852 TAGAGGATTATAATGGAGTCAGG + Intronic
1085743183 11:79094204-79094226 CTGAGTATTTGGATGGAGTAAGG + Intronic
1085922264 11:80971491-80971513 CAGAGTCTTGTGATTAAGTCAGG - Intergenic
1087563137 11:99816809-99816831 CAGGGTATTATGAGGGAGAGAGG - Intronic
1088856368 11:113758442-113758464 CAGAGTATTAGTATAGGGTCTGG - Intronic
1091288322 11:134421673-134421695 CAGAGTATTCTGTAGGAGTGTGG - Intergenic
1092276437 12:7064712-7064734 CAGAGTGATATAATGGACTCTGG - Intronic
1095254513 12:40018896-40018918 CTTGGTATGATGATGGAGTCTGG + Intronic
1095800240 12:46264792-46264814 CAGAGTAATATAATGGACTGTGG - Intronic
1098554738 12:71805262-71805284 CAGAGTGATATGATGGACTTTGG - Intergenic
1101153715 12:101907869-101907891 CAGAGCCTCATGGTGGAGTCAGG + Intronic
1101800297 12:108016106-108016128 TGGAGGATTATGATGGAGTGGGG + Intergenic
1108316499 13:49242323-49242345 AAGATTATAATGATGGAGACAGG + Intergenic
1110685709 13:78371502-78371524 CAGAGTGGTATAATGGACTCTGG - Intergenic
1110700610 13:78543382-78543404 CAGAGTATTATGGTGGTGGAAGG - Intergenic
1112585844 13:100717984-100718006 CGGATTATTATGGTGCAGTCTGG + Intergenic
1114042476 14:18691786-18691808 CAGAGTGATATAATGGACTCTGG + Intergenic
1114083016 14:19218195-19218217 CAGAGGAGTATCGTGGAGTCTGG - Intergenic
1118011657 14:61616041-61616063 CAGAGTATTATGGTGGGATATGG + Intronic
1122338825 14:101011593-101011615 CAGAATATTAGGGTGGAGTTGGG - Intergenic
1126637618 15:50794585-50794607 CAGAGCTCTAAGATGGAGTCAGG - Intergenic
1127620151 15:60726160-60726182 AAGAGTATCATTTTGGAGTCAGG - Intronic
1127754822 15:62081884-62081906 CAGAGTAAGATGATGGAGACTGG + Intergenic
1129506050 15:76082474-76082496 CAGAGTATTATGATGGAGTCAGG + Intronic
1129506254 15:76083918-76083940 CAGAGTATTAGGATGGGGTCAGG + Intronic
1129551891 15:76460444-76460466 AAGAGTTTTTTGGTGGAGTCTGG + Intronic
1130139152 15:81209162-81209184 CAGAGGATAATGATGGAGACAGG + Intronic
1130141373 15:81229166-81229188 CAGAGGATAATGAGGGAGACAGG + Intronic
1133907821 16:10037991-10038013 CAGGGGATTATGATGTAGACTGG - Intronic
1134488490 16:14678094-14678116 CAGAGAAATATGATGTAGTGGGG + Intronic
1136036082 16:27541580-27541602 AAGAGTACTACGATGGTGTCTGG + Intronic
1136570626 16:31094482-31094504 CAGATGATTATTCTGGAGTCTGG - Intronic
1142326781 16:89421053-89421075 CAGTGTGTGATGACGGAGTCAGG + Intronic
1142326801 16:89421136-89421158 CAGTGTGTGATGACGGAGTCAGG + Intronic
1144262720 17:13538567-13538589 CAGAGTATTATGCTGGCATTCGG - Intronic
1146111095 17:30090145-30090167 CAAAGTATCATGATGGAGAGTGG + Intronic
1146649903 17:34600153-34600175 AAGAGTATTATCTTGGATTCTGG - Intronic
1147034840 17:37672184-37672206 CAGGGGCTTATGCTGGAGTCGGG + Intergenic
1147588826 17:41668154-41668176 CAGTGTCTTATGATGGCCTCTGG + Intergenic
1147597979 17:41728785-41728807 CAGTGTCTTATGATGGCCTCTGG - Intronic
1153468981 18:5421784-5421806 CAGAGTAATATAATGGACACTGG + Intronic
1154499721 18:14989870-14989892 CAGAGGAGTATCCTGGAGTCTGG - Intergenic
1157026145 18:43846304-43846326 CAGGATGTTGTGATGGAGTCTGG - Intergenic
1164446396 19:28321248-28321270 CAGAGTAATATAATGAAGTGTGG + Intergenic
926610369 2:14940762-14940784 CAGAGTATTGTGTTGAATTCTGG - Intergenic
926699264 2:15792104-15792126 CAGAGTAGTATAATGGACTTTGG + Intergenic
926764047 2:16307086-16307108 CAGGGTATTTTGATGGAATTGGG - Intergenic
926995636 2:18732522-18732544 CATAGTATGAAGATGAAGTCTGG - Intergenic
927368484 2:22327003-22327025 TAGAGAATCAGGATGGAGTCTGG + Intergenic
928019399 2:27690328-27690350 CAGAGTGGTATGATGGACTTTGG - Intronic
928915976 2:36470931-36470953 CAGAATATTAACATGGAGTTTGG + Intronic
931953797 2:67395951-67395973 GACAGTGTTATGATGGTGTCAGG - Intergenic
933904899 2:86882273-86882295 CAGAGTGTTATGATGGACTTTGG + Intergenic
934135505 2:88992657-88992679 CAGAGAATGAGGATGGAGACTGG + Intergenic
935234138 2:101123943-101123965 CAGAGTTTTATTATGTAGGCAGG + Intronic
936367329 2:111869889-111869911 CAGAGTGTTATGATGGACTTTGG - Intronic
938060020 2:128246479-128246501 AAGAGTATGGTGATGGCGTCTGG + Intronic
938093458 2:128447714-128447736 CACAGTATTATGGTGGGGGCAGG + Intergenic
938093494 2:128447827-128447849 CACAGTATTATGGTGGGGGCAGG + Intergenic
938493561 2:131778442-131778464 CAGAGGAGTATCGTGGAGTCTGG + Intergenic
938498930 2:131820223-131820245 CAGAGGAGTATCGTGGAGTCTGG - Intergenic
940143277 2:150519268-150519290 CAGAGTATATTTATGGAGCCTGG + Intronic
942174542 2:173319285-173319307 CGTAATATTATGCTGGAGTCAGG + Intergenic
942777671 2:179603543-179603565 CAGTGTATCATGGTGGAGACTGG + Intronic
943492914 2:188579464-188579486 CAGTGTGTAATGATCGAGTCAGG + Intronic
944979069 2:205093139-205093161 CAGAGTATTGTGCTGGACTCTGG - Intronic
1170781546 20:19430108-19430130 CATAGTATTAGGGTGGGGTCGGG - Intronic
1173483049 20:43418037-43418059 CAGAGTGATATAATGGACTCTGG - Intergenic
1174194759 20:48765149-48765171 CAGAGTATTAGGATTGTGTTTGG - Intronic
1174963766 20:55187332-55187354 CAGAGTCTTAGGATGTAGTCTGG + Intergenic
1178102818 21:29288453-29288475 GAGAGAATTTTGGTGGAGTCGGG - Intronic
1180497763 22:15904486-15904508 CAGAGGAGTATCGTGGAGTCTGG + Intergenic
1182475877 22:30575972-30575994 CAGTGCATCATGATGGAGCCAGG - Intergenic
1183660237 22:39215814-39215836 CAGAGTCTTCAGCTGGAGTCAGG + Intergenic
1184625383 22:45723550-45723572 CAGAGTAGTATAATGGACACTGG - Intronic
1203293689 22_KI270736v1_random:20031-20053 CAGAGTATTATTATCGTGCCTGG - Intergenic
949480270 3:4487388-4487410 CATAGTATAATGATCCAGTCAGG + Intergenic
952239888 3:31520648-31520670 CAGAGTAATATAATGGACTTTGG + Intergenic
953240698 3:41146824-41146846 CAGAGGTATATGATGGACTCTGG + Intergenic
956510829 3:69991532-69991554 CATAGTATTATTATGAAGTGAGG + Intergenic
956996690 3:74833640-74833662 CAGTGTATTATGATTGAAACTGG - Intergenic
960934392 3:122888615-122888637 CAGTGTATTAGGATGGAGGCGGG - Intergenic
964773483 3:160249868-160249890 CAGAGTGATATAATGGACTCTGG - Intronic
965130790 3:164697429-164697451 CAGAGTGGTATGATGGACTTTGG - Intergenic
965291347 3:166885840-166885862 CAGAGTAATATAATGGATTTTGG + Intergenic
967336548 3:188350735-188350757 CAGAGCATTATGATGAAGATAGG + Intronic
969554630 4:7898082-7898104 CAGAGCACTATGATGAAGGCTGG - Intronic
971602023 4:28605081-28605103 TAGAGTATTCTGATGGACTCAGG + Intergenic
971945883 4:33276757-33276779 CAGAGGATTATATTGGGGTCTGG - Intergenic
973695057 4:53482669-53482691 CAGAGTAATATAATGGACTTTGG + Intronic
975485286 4:74928536-74928558 CAGAGTTGTTTGATGGAGTTTGG - Intergenic
976695999 4:87920286-87920308 CAGAGTATTATGTGGGTGTTTGG - Intergenic
980155145 4:129095363-129095385 CCAGGTATTATGATGGAGCCTGG - Intronic
980165972 4:129227957-129227979 CATAGTGTGATGAAGGAGTCAGG + Intergenic
981821613 4:148893740-148893762 CAGAGTATTTTTGTGGAGTCAGG + Intergenic
986340492 5:6784914-6784936 AAGATTATGATGCTGGAGTCTGG + Intergenic
987463311 5:18242075-18242097 CAGAGTCTTGTGATAGAGTAAGG + Intergenic
988348544 5:30070663-30070685 CAGAGTAGTATGATGGACATTGG - Intergenic
989542217 5:42630812-42630834 CAAAGTATTATGTTTGTGTCAGG - Intronic
991639355 5:68737998-68738020 CAGAGTATTATGTTTGCATCAGG - Intergenic
992243421 5:74793524-74793546 AAGAGTGTTATCATGGACTCTGG + Intronic
993926954 5:93877468-93877490 GAGCATATTATGAGGGAGTCAGG - Intronic
995513523 5:112931314-112931336 CAGCATATTTTGTTGGAGTCAGG + Intergenic
996111804 5:119574329-119574351 CAGAGTAATATAATGGACTTTGG - Intronic
998358529 5:141563095-141563117 CAGAGTATTGTGCTGGACTGGGG - Intronic
998430552 5:142066227-142066249 CAGAGCCTTGTCATGGAGTCTGG + Intergenic
1001180584 5:169516344-169516366 CAGAATAGTAAGATGGGGTCAGG + Intergenic
1001184111 5:169551076-169551098 CTGAAAATTATCATGGAGTCAGG + Intergenic
1002356315 5:178632128-178632150 CAGAGTATTCTGATGACTTCTGG + Intergenic
1002378999 5:178811624-178811646 CATTGTATCATGATGGAATCGGG - Intergenic
1004761628 6:18673115-18673137 CAGAGTATAAAAATGGAGTGTGG - Intergenic
1006276528 6:33008838-33008860 CAGAGCATTATGACTGAGTGTGG + Intronic
1006692165 6:35898340-35898362 CAGAGTGATATAATGGACTCTGG + Intronic
1008335032 6:50292974-50292996 CAGAGTATCATGGTGGTTTCTGG - Intergenic
1009438161 6:63642041-63642063 CAGAGAATTATACTGAAGTCAGG - Intronic
1012029564 6:94041085-94041107 CAGAGTAGTATAATGGACACTGG - Intergenic
1012414397 6:98997201-98997223 TAGAATATAATGATGGAGACAGG - Intergenic
1012969346 6:105710907-105710929 AAGAGTAGTTTGATGGTGTCTGG - Intergenic
1013313766 6:108922077-108922099 CAGAGTACTCTGATGGAGGAAGG + Intronic
1014028108 6:116672009-116672031 GAGTGTATTAAGATGGAGTAGGG - Intergenic
1017072774 6:150590820-150590842 CAGAATATTGTAATAGAGTCTGG + Intergenic
1020501622 7:8930024-8930046 CAGAGTATTAGGAAGAAGACTGG + Intergenic
1021051203 7:15987440-15987462 GACAGTATTATGTTAGAGTCGGG - Intergenic
1022552529 7:31254839-31254861 AAGAGTCTTGTGATGGAGTCTGG - Intergenic
1022720656 7:32939448-32939470 CAGAGTGGACTGATGGAGTCAGG + Intergenic
1033830959 7:145251850-145251872 CAGAATATTATGATGGTTGCTGG + Intergenic
1036757428 8:11480649-11480671 CAGAGGAGTATGATGGAGCTGGG - Intergenic
1038064958 8:23954319-23954341 CAGAGTATTTTAATGTGGTCAGG - Intergenic
1039653626 8:39373896-39373918 AAGAGTAATATAATGGACTCTGG + Intergenic
1039688348 8:39834282-39834304 AAGAGATTTATGGTGGAGTCTGG + Intronic
1041365642 8:57100786-57100808 CAAAGTATTGTGATGGAGTCTGG - Intergenic
1044122152 8:88411273-88411295 CTTAGTATGATGATGGATTCAGG + Intergenic
1044341062 8:91046824-91046846 CAGAGTATATTGAAGCAGTCAGG + Intergenic
1044966611 8:97579946-97579968 CAAAGTCTTATCTTGGAGTCAGG - Intergenic
1048145287 8:131836034-131836056 CAGAGGCTTTGGATGGAGTCAGG - Intergenic
1048612842 8:136042453-136042475 CAGAATAATTTGATGGATTCTGG + Intergenic
1051182106 9:14422424-14422446 CTAAGTATTCTTATGGAGTCAGG + Intergenic
1052340002 9:27355452-27355474 CAAAGGATGATGAAGGAGTCAGG - Intronic
1057262933 9:93596162-93596184 CAGAGTATCATGCTGGACTGAGG - Intronic
1187264078 X:17715200-17715222 CAGAGTGATATAATGGAGTTTGG - Intronic
1187891927 X:23944572-23944594 CAGAGTGCTATGATAGAGTATGG + Intergenic
1188380017 X:29479691-29479713 CAGAGTGATATAATGGACTCTGG - Intronic
1188704831 X:33314748-33314770 CAGAGTAATGTGATGTAGACTGG - Intronic
1191836299 X:65467123-65467145 CAGAGTAGTATAATGGACACTGG - Intronic
1192961374 X:76134844-76134866 CAGAGTAGTATAATGGACACTGG + Intergenic
1193895162 X:87105059-87105081 GAGAGTGTTATGATGGACACAGG + Intergenic
1194108377 X:89799708-89799730 AAGAGTATTATGGTGGCATCTGG - Intergenic
1194505216 X:94725982-94726004 AAGAGTAATATAATGGACTCTGG + Intergenic
1194816242 X:98445582-98445604 AAGAGTAATATAATGGACTCTGG + Intergenic
1195318473 X:103701373-103701395 GAGATTATGATGATGTAGTCTGG + Intergenic
1196189214 X:112777432-112777454 CAAAGTACTATGCTGCAGTCGGG - Exonic
1196485998 X:116207813-116207835 CAGAGTGATATAATGGAGACTGG + Intergenic
1196614739 X:117755192-117755214 CAGAGTAATAAAATGGAGTGGGG + Intergenic
1196672224 X:118381076-118381098 CATAGTATTATGATAAAATCAGG - Intronic
1198949341 X:142053098-142053120 CAGAGTGATATAATGGACTCTGG - Intergenic
1199044921 X:143158631-143158653 AAGAGAAATATAATGGAGTCTGG - Intergenic
1199404623 X:147442640-147442662 GAGAGTAATATGATGGACTTTGG + Intergenic
1199660917 X:150050265-150050287 CAGAGCACTAAGCTGGAGTCAGG + Intergenic