ID: 1129510173

View in Genome Browser
Species Human (GRCh38)
Location 15:76115818-76115840
Sequence CCATCTACCCATGTGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129510168_1129510173 11 Left 1129510168 15:76115784-76115806 CCCTTCTATATTTGGGGAAATTC 0: 2
1: 1
2: 1
3: 31
4: 399
Right 1129510173 15:76115818-76115840 CCATCTACCCATGTGCAGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 118
1129510169_1129510173 10 Left 1129510169 15:76115785-76115807 CCTTCTATATTTGGGGAAATTCC 0: 1
1: 0
2: 1
3: 18
4: 215
Right 1129510173 15:76115818-76115840 CCATCTACCCATGTGCAGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129510173 Original CRISPR CCATCTACCCATGTGCAGCC AGG Intronic
900307514 1:2018490-2018512 CCACCTGCCCCTGTGCGGCCAGG + Intergenic
900616955 1:3569760-3569782 CCAACTGCCCCTGTGCTGCCTGG - Intronic
900833409 1:4981090-4981112 CCATCCTCGAATGTGCAGCCAGG + Intergenic
903232296 1:21929316-21929338 CCCCCTACCCATCTCCAGCCAGG - Intronic
904009796 1:27383065-27383087 CCGTCTCCCCAGGAGCAGCCTGG - Intronic
904118004 1:28176489-28176511 CCATCTGCTTAGGTGCAGCCTGG + Intronic
904479296 1:30783948-30783970 CCTTCCACCCATGAGTAGCCAGG + Intergenic
904891486 1:33782937-33782959 CCATCTACCCATCTGCCACATGG - Intronic
906962182 1:50425490-50425512 TCACCTACCCAGGTGCAGCCGGG - Intergenic
913060702 1:115204105-115204127 CACTCTACACATGTGCAGCTTGG - Intergenic
915510635 1:156385094-156385116 TCTTCTACCCATGTGCAGGCTGG - Exonic
916513079 1:165490465-165490487 CCATCCATCCATGTGCTTCCAGG - Intergenic
917931285 1:179824457-179824479 CCATCCACCCCTGTGGAGACCGG - Intergenic
922501223 1:226098407-226098429 CCATCTTCCTATGTCCAGGCAGG - Intergenic
924445143 1:244122859-244122881 GCATCTACCGATGTTGAGCCAGG - Intergenic
1068102005 10:52567168-52567190 TCATCTACCCATTTCCAGCAGGG - Intergenic
1068934735 10:62624695-62624717 CCATTTGCCCATGTGGAGCATGG + Intronic
1069726570 10:70583816-70583838 CCAGCTACTCGTGTGCAGCCTGG - Intergenic
1070543455 10:77434197-77434219 ACATCTAGACATCTGCAGCCAGG + Intronic
1073161870 10:101405043-101405065 ATATCCACCCATGTGCAGCTTGG + Intronic
1073565089 10:104528087-104528109 TCTTCTTCCCATGTGCAGCCAGG - Intergenic
1077304611 11:1863524-1863546 CCATGTACCCATGTCCAGGATGG - Intronic
1077415744 11:2423495-2423517 ACCTCTACCCAGGTGCACCCAGG - Intergenic
1077440484 11:2566564-2566586 CCATGAAGCCATCTGCAGCCAGG + Intronic
1078849803 11:15153348-15153370 CCAGCTAGCCATGGGCAACCAGG - Intronic
1080786244 11:35477919-35477941 CCATCTACCCATCTGCTGCTGGG + Intronic
1084544102 11:69805337-69805359 CCCTCTGCCCATGTCCACCCTGG + Intergenic
1085531992 11:77197385-77197407 CCTTCTAGCCAGGAGCAGCCTGG - Intronic
1088655590 11:111996338-111996360 CCATTTAGCCACGTGCAGGCAGG + Intronic
1089073486 11:115718544-115718566 CCACCTACCCAAGTGCAGCGGGG - Intergenic
1092842124 12:12552554-12552576 CTATGTATCCGTGTGCAGCCAGG + Intronic
1095737209 12:45570497-45570519 GCATCTGACCATCTGCAGCCTGG + Intergenic
1097815087 12:64064892-64064914 CCATCTTCCCAGTTGTAGCCAGG + Intronic
1099856591 12:88176298-88176320 CAGGCTACCCATGTTCAGCCAGG + Exonic
1101652234 12:106687904-106687926 CCATTTTCCCATGTGCTGCAGGG + Intronic
1102535199 12:113575972-113575994 CCAACTCCCCAGGGGCAGCCTGG + Intergenic
1105039160 12:132948378-132948400 CCATCTACACCTGTGGAGCGAGG + Intronic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1112152638 13:96780804-96780826 CCATAGACACATGTGCAGCTAGG - Intronic
1114406804 14:22464363-22464385 CCCTTTCCCCATGTGCAGCATGG - Intergenic
1118364243 14:65080756-65080778 TTAACTACCCATGTGCATCCGGG + Intronic
1118916884 14:70115161-70115183 CCATCTTCCCAAGTGCTTCCTGG - Intronic
1120917344 14:89721630-89721652 CCATCTACCCCTCTGCTGCTTGG - Intergenic
1121522357 14:94594745-94594767 GCATCTACTCATGTGCAGACAGG - Intronic
1124034179 15:26038908-26038930 CCTTCTTCCCATGTGAGGCCAGG - Intergenic
1127303864 15:57683201-57683223 CCAACTACCAAGCTGCAGCCTGG + Intronic
1129510173 15:76115818-76115840 CCATCTACCCATGTGCAGCCAGG + Intronic
1130107995 15:80943334-80943356 CAACCTTCCCATGTGCAGCGGGG - Intronic
1131048039 15:89328617-89328639 GCATCTCCCCAAGTGCAGCTAGG + Intronic
1133230802 16:4365655-4365677 CCATCCAGCCATGTTCAGCCTGG + Intronic
1137032227 16:35533562-35533584 CAATCTCCCCATCTGCAGCATGG + Intergenic
1137593877 16:49710893-49710915 CCATGTCCCCAAGTGAAGCCTGG - Intronic
1142172858 16:88631992-88632014 CCCTCTGCCCATGCGCAGCCGGG + Intergenic
1142970762 17:3610003-3610025 CCAGCTAAGCATCTGCAGCCAGG + Exonic
1149448401 17:56731551-56731573 CCCTCTCCCCATGGGCAGTCAGG - Intergenic
1152181835 17:78827121-78827143 ACGTCTACCCAAGGGCAGCCTGG + Intronic
1157042640 18:44059097-44059119 CCAGCTAACCATCTGCTGCCAGG + Intergenic
1157223045 18:45840681-45840703 GCATCCACCCATGTGAAGGCTGG + Intronic
1161105901 19:2443917-2443939 CCAACAACCCATGAGCACCCTGG + Intronic
1161514100 19:4687105-4687127 CCATCTCCTCATCTGAAGCCAGG + Intronic
1161572967 19:5040338-5040360 GCATGTACCCGTGTGGAGCCAGG - Intronic
1162776963 19:12985757-12985779 CCAGCTCTCCCTGTGCAGCCTGG - Intergenic
1163005266 19:14393478-14393500 CCATCTGCCCCTGTGAATCCTGG - Intronic
1164502586 19:28832216-28832238 CCATGCACCCATGGGCACCCTGG + Intergenic
1167346069 19:48946480-48946502 GACTGTACCCATGTGCAGCCAGG - Intergenic
925035711 2:683973-683995 ACATCTCCCCATGTGCACACAGG + Intergenic
931261942 2:60627980-60628002 CCATCCACCCATCTGCATTCTGG + Intergenic
931289116 2:60856853-60856875 CCATCTACCACTGTCCTGCCTGG - Intergenic
933451406 2:82457561-82457583 CCAACTGCCCATATTCAGCCAGG - Intergenic
933739624 2:85523336-85523358 TCACCTCCCAATGTGCAGCCTGG + Intergenic
936076727 2:109405999-109406021 CCAGCCATCGATGTGCAGCCGGG - Intronic
938762855 2:134441409-134441431 CCATCAACACTTATGCAGCCAGG - Intronic
939662258 2:144904522-144904544 CCAACTACCCATGTGCAGAATGG - Intergenic
941699849 2:168592659-168592681 GCATTTACCCCTGTGCAGCAGGG + Intronic
945532218 2:210969882-210969904 ACAAACACCCATGTGCAGCCTGG + Intergenic
945561846 2:211349239-211349261 CCATCCCCTCATGTGAAGCCAGG - Intergenic
946024474 2:216663826-216663848 GCAGCTACCCATGCGCTGCCGGG - Intronic
946771704 2:223095607-223095629 CCCTCTCCCCATGTATAGCCAGG - Intronic
947995302 2:234522518-234522540 CCCTCTACCCACTTGCTGCCTGG - Intergenic
1172588459 20:36101304-36101326 CTCTCACCCCATGTGCAGCCCGG + Intronic
1172621607 20:36321288-36321310 CTATTCTCCCATGTGCAGCCAGG - Intronic
1174378751 20:50143077-50143099 CCAGCTAGCCATGTGGAGACTGG + Intronic
1176897728 21:14402351-14402373 CCATGTACTCAGGTCCAGCCTGG + Intergenic
1185314113 22:50171386-50171408 CCTTCCACCCAAGTCCAGCCTGG - Intronic
950018117 3:9768426-9768448 CCATCTAACCCTATCCAGCCTGG + Intronic
950113875 3:10438146-10438168 CAGTCTCCCCATGTGCACCCTGG + Intronic
950566961 3:13775136-13775158 CCATCTAGCCATCTTCACCCAGG - Intergenic
950718583 3:14866742-14866764 CAATCTGCCCAAGTTCAGCCGGG + Intronic
953126940 3:40099921-40099943 CCATCAACACATGTGCAACAGGG - Intronic
953606814 3:44417807-44417829 CCCTGTAGCCATCTGCAGCCTGG + Intergenic
953664811 3:44918090-44918112 CCAGCTCCCCATGTGCTCCCTGG + Intronic
954380232 3:50215364-50215386 CCATCTTCCCATGTGTCCCCAGG + Exonic
954430833 3:50470149-50470171 CCAGGGGCCCATGTGCAGCCAGG + Intronic
956399143 3:68858100-68858122 CCATCTTTCCAGGTGGAGCCAGG + Intronic
959830757 3:110859095-110859117 CCATATGCCAAGGTGCAGCCTGG - Intergenic
961441202 3:126954341-126954363 CCCTCTCCCCATGGTCAGCCTGG - Intronic
965758941 3:172054339-172054361 CCAGCTACCCAGGTTTAGCCTGG - Intronic
969273736 4:6120574-6120596 CCATCTCTCCAGGTGCTGCCCGG - Intronic
971555802 4:28012295-28012317 TCATCAGCCCATGTGCTGCCAGG - Intergenic
971620422 4:28848670-28848692 CCATCTATGCTTGTTCAGCCTGG + Intergenic
975748301 4:77496002-77496024 TCATCTACTCCTGTGCAGCCTGG - Intergenic
981042664 4:140237762-140237784 CCAGCAGCCAATGTGCAGCCAGG + Intergenic
989803037 5:45568060-45568082 CACTCTACTCACGTGCAGCCAGG + Intronic
991550116 5:67826362-67826384 CCAGCTACCCAGGTGGTGCCTGG + Intergenic
992204012 5:74412279-74412301 CCATCTGCTCCTTTGCAGCCTGG + Intergenic
994016481 5:94972466-94972488 CCATGTACCCATGTCCTTCCTGG + Intronic
996861634 5:128073608-128073630 TCATCTCCCGCTGTGCAGCCTGG + Intergenic
998262518 5:140642249-140642271 CCATCTCCCCACACGCAGCCTGG + Intronic
1003431595 6:6043582-6043604 CCATCCACCCATGAGGAGACTGG + Intergenic
1007242967 6:40440352-40440374 CCTTCTACCCTTGTGCACCTGGG + Intronic
1013078745 6:106793948-106793970 ACATCTACCCATATACACCCTGG + Intergenic
1015875916 6:137822357-137822379 CCATCCTCCCATGTGCTTCCTGG - Intergenic
1019494236 7:1330210-1330232 ACATCCACACATGTGCAGCGTGG + Intergenic
1020149559 7:5671176-5671198 CCATGTGCCCATGTGAAGGCTGG + Intronic
1021841377 7:24724341-24724363 CCCTCTCCCCAAGTCCAGCCAGG + Intronic
1023167748 7:37359580-37359602 CCATCTACCCATGTTTAGGGTGG - Intronic
1024105766 7:46084022-46084044 CCCTGTACCCATGAGCAGTCAGG - Intergenic
1024534795 7:50421253-50421275 CAAGCTGCCCAGGTGCAGCCAGG + Intergenic
1035376331 7:158409295-158409317 ACATCTCCCCATATGCTGCCAGG - Intronic
1035679508 8:1477633-1477655 CCTTCTGCCCATCTGCACCCAGG + Intergenic
1036966285 8:13301710-13301732 CCATCTCCTGCTGTGCAGCCTGG - Intronic
1043781310 8:84339272-84339294 TCATCTCCCACTGTGCAGCCTGG - Intronic
1043827984 8:84952326-84952348 CAATCTACCCATGTGAAGAAAGG - Intergenic
1044882263 8:96735706-96735728 CCATAGACCCATCTGCAGACAGG + Intronic
1048710194 8:137201329-137201351 AAACCTACCCATGTGCAACCAGG + Intergenic
1049443748 8:142620662-142620684 CTGTCTCCCCATGTGCACCCAGG - Intergenic
1060678068 9:125534877-125534899 CCTGCTTCCCATGTGCACCCAGG + Intronic
1062004808 9:134233822-134233844 CCAGCTCCCCAGCTGCAGCCAGG + Intergenic
1189075354 X:37908648-37908670 CCATATACCCATGTGGAGAGGGG - Intronic
1192564848 X:72155101-72155123 CCATCTAAGCATGTGCTTCCTGG - Intergenic