ID: 1129512524

View in Genome Browser
Species Human (GRCh38)
Location 15:76135360-76135382
Sequence ACATGGCCAGAGATGGTGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 1, 2: 4, 3: 44, 4: 395}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129512514_1129512524 25 Left 1129512514 15:76135312-76135334 CCTTCACCTCACCAGAGGGGGCC 0: 1
1: 0
2: 1
3: 20
4: 184
Right 1129512524 15:76135360-76135382 ACATGGCCAGAGATGGTGCCGGG 0: 1
1: 1
2: 4
3: 44
4: 395
1129512518_1129512524 4 Left 1129512518 15:76135333-76135355 CCTTGTCTCTCTGCTGAGGTGAC 0: 1
1: 0
2: 0
3: 20
4: 210
Right 1129512524 15:76135360-76135382 ACATGGCCAGAGATGGTGCCGGG 0: 1
1: 1
2: 4
3: 44
4: 395
1129512516_1129512524 14 Left 1129512516 15:76135323-76135345 CCAGAGGGGGCCTTGTCTCTCTG 0: 1
1: 0
2: 0
3: 15
4: 153
Right 1129512524 15:76135360-76135382 ACATGGCCAGAGATGGTGCCGGG 0: 1
1: 1
2: 4
3: 44
4: 395
1129512515_1129512524 19 Left 1129512515 15:76135318-76135340 CCTCACCAGAGGGGGCCTTGTCT 0: 1
1: 0
2: 0
3: 20
4: 155
Right 1129512524 15:76135360-76135382 ACATGGCCAGAGATGGTGCCGGG 0: 1
1: 1
2: 4
3: 44
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129512524 Original CRISPR ACATGGCCAGAGATGGTGCC GGG Intronic
900142839 1:1145716-1145738 ACGTTGGCAGAGGTGGTGCCAGG + Intergenic
900337624 1:2172423-2172445 ACAGGGCCAGAGATGGCTTCGGG + Intronic
900611025 1:3544727-3544749 ACCAGGCCAGGGCTGGTGCCGGG - Intronic
903398755 1:23022805-23022827 AACTGGCCAGAGGTGGTGGCAGG - Intronic
904800315 1:33087996-33088018 AGATGGGGAGAGATGGTACCCGG - Intronic
904874395 1:33643103-33643125 ACATGGACACAGATGCTTCCTGG + Intronic
905475415 1:38223617-38223639 AAATGGCCAGATATGGTGCAGGG + Intergenic
906109036 1:43311420-43311442 ACATGGCCAGACATGGTTTGGGG - Intronic
906423604 1:45690351-45690373 AATTGGCCAGACATGGTGGCAGG + Intronic
906512710 1:46419988-46420010 ACATAGCCAGGCATGGTGGCAGG - Intergenic
906537495 1:46559790-46559812 CCATGGCCAGGCATGGTGGCAGG - Intronic
906584210 1:46961955-46961977 ACCTGGCAAGAGAAAGTGCCTGG - Intergenic
907835961 1:58108585-58108607 ACATCTTCAGAGATGGTGCCCGG + Intronic
908461184 1:64349719-64349741 CCTGGGGCAGAGATGGTGCCTGG + Intergenic
908800802 1:67878734-67878756 TCATGGCCAGTGATGATGCTGGG - Intergenic
909108297 1:71441145-71441167 ACATGGCCACACATTATGCCTGG - Intronic
910716325 1:90235570-90235592 TCATGTCCAGAGATGCTGTCTGG + Intergenic
911488212 1:98528598-98528620 ACATGGCCAGAAAAGGAGCAGGG - Intergenic
912556854 1:110522771-110522793 ACATGAGCAGACATGGTGCTGGG - Intergenic
913292899 1:117291741-117291763 AATTAGCCAGAGATGGTGGCAGG - Intergenic
913332851 1:117681714-117681736 ACATGGGCAGAGATGGGGGCTGG - Intergenic
915810754 1:158907436-158907458 AAATAGCCAGGGATGGTGGCAGG + Intergenic
918998074 1:191788988-191789010 ACATGGCAAGAGATGGAACATGG - Intergenic
919129867 1:193438298-193438320 GCATGTCCAGAGATGTTGTCTGG + Intergenic
919817218 1:201449070-201449092 ACAGGGCCAGTGCTGGGGCCAGG - Intergenic
920677141 1:208046060-208046082 CCGTGGTCAGAGAGGGTGCCAGG + Exonic
920999096 1:211024928-211024950 ACCTAGCAAGAGATGGTGACAGG + Intronic
921030728 1:211333335-211333357 ACATAGCCAGGCATGGTGGCAGG - Intronic
921195913 1:212757590-212757612 CCATGGCAAGAGATGGAGCAAGG + Intronic
921671321 1:217927014-217927036 AAATAGCCAGACATGGTGGCAGG + Intergenic
922214267 1:223508033-223508055 AGATGTCTGGAGATGGTGCCTGG + Intergenic
922226564 1:223650620-223650642 AGATGGGCAGAGAGTGTGCCAGG + Intronic
924085298 1:240445244-240445266 ACATGGCCAGGAATGTTGCCTGG - Intronic
1063380810 10:5584437-5584459 AAATGGCCAGGCATGGTGGCGGG + Intergenic
1063624910 10:7679884-7679906 ACATGGCCAGAGCAGGAGCTAGG + Intergenic
1063843066 10:10093197-10093219 ACAAGGTCAGAGAGAGTGCCTGG - Intergenic
1064899970 10:20284975-20284997 AGATGGCCACAGATGGGGGCAGG - Exonic
1066696091 10:38078794-38078816 ACATGGCCAGAGCAGGAGCAAGG + Intergenic
1067370627 10:45678655-45678677 CCAGGGCCAGGGCTGGTGCCCGG + Intergenic
1067389148 10:45847488-45847510 CCAGGGCCAGGGCTGGTGCCCGG - Intronic
1067840155 10:49669273-49669295 ACAAGGACAGAGCTGGTCCCTGG - Intergenic
1068116212 10:52740239-52740261 ACATGGGCAGAGCTGGAGCCTGG + Intergenic
1068889309 10:62132312-62132334 ACATGGCCAGAGAAGGAGGAAGG - Intergenic
1069829316 10:71272760-71272782 ACGTGGGCTCAGATGGTGCCAGG + Intronic
1070136370 10:73697896-73697918 CCGGGGCCAGGGATGGTGCCCGG - Exonic
1071507267 10:86240360-86240382 ACCTGGCCTGGGATTGTGCCTGG + Intronic
1072200879 10:93157795-93157817 ACATGGCAAGAGAAGGAGCAAGG - Intergenic
1072546938 10:96447232-96447254 ACAGGGCCAGAGAGGGAGGCAGG + Intronic
1072752429 10:97992019-97992041 ACAGGCTCAGAGATGCTGCCTGG - Intronic
1073451176 10:103610264-103610286 ACCTGGCCAGAGATGTGGCCTGG - Intronic
1074373594 10:112920745-112920767 AGCAGGCCAGAGATGGTGCTTGG + Intergenic
1075120651 10:119662194-119662216 ACATAGCCAGGCATGGTGGCGGG - Intronic
1077305222 11:1865908-1865930 TCAGGGCCAGGGAAGGTGCCCGG + Intronic
1080435346 11:32235812-32235834 ACCAGGTCAGAGATGGTGGCAGG + Intergenic
1081243164 11:40731371-40731393 ACATGGCCAGAGCAGGAGCAAGG - Intronic
1083286280 11:61661208-61661230 ACATGGCCAGAGGGGGAGCAAGG + Intergenic
1084493219 11:69489395-69489417 ACATGGGCTGAGAGGGGGCCTGG + Intergenic
1084606199 11:70173557-70173579 CCATGGCCAGAGGTGGAGCAAGG + Intronic
1084747711 11:71183814-71183836 TCATGGTGGGAGATGGTGCCTGG + Intronic
1085036267 11:73302135-73302157 ACCTGGACAGAGATGGGGCCAGG + Intergenic
1085600624 11:77853396-77853418 ACATGGCCAGAGCAGGAGGCAGG + Intronic
1088371176 11:109090013-109090035 ATAGCTCCAGAGATGGTGCCAGG + Intergenic
1088938913 11:114434279-114434301 ACATGGCCAGAGCAGGAGCAAGG + Intronic
1089931459 11:122317630-122317652 TCATAGCCAGAGATGTTTCCTGG - Intergenic
1090363235 11:126187461-126187483 ACAGGGACAGAGACTGTGCCAGG + Intergenic
1090479620 11:127056589-127056611 ACATGGCCACAGAGGGCGCTGGG + Intergenic
1091314660 11:134605073-134605095 ACATGGCCAGAGAAGGAACAAGG + Intergenic
1093168896 12:15836994-15837016 ACATGGCCAGGGCAGGAGCCGGG + Intronic
1093337210 12:17920876-17920898 ACATTGGCACAGATGCTGCCTGG + Intergenic
1096343876 12:50828373-50828395 GCATGTCCAGAGATGCTGTCTGG + Intergenic
1099610028 12:84856873-84856895 ACAGGTCCAGAGATGCTGTCTGG + Intergenic
1100547045 12:95613225-95613247 AGATGGCCAGGGATGAGGCCAGG + Intergenic
1100590394 12:96022775-96022797 CCATTGCCAGGGATGGTGCTGGG - Intronic
1101469445 12:104982963-104982985 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
1101992092 12:109494553-109494575 ACAGGGCCAGACATGGTGGGGGG - Intronic
1102078100 12:110075770-110075792 AATTAGCCAGAGATGGTGTCAGG + Intergenic
1102372553 12:112394254-112394276 ACTTAGCCAGACATGGTGGCAGG + Intergenic
1102542476 12:113632293-113632315 ACCTGGCCTGTGATGGAGCCAGG - Intergenic
1103947533 12:124534905-124534927 GCCTGGCCTGAGAAGGTGCCTGG - Intronic
1108429280 13:50338139-50338161 ACTTGGCCAGGCATGGTTCCTGG - Intronic
1108770375 13:53693504-53693526 ACATGGCAAGAGAGGGAGCAAGG - Intergenic
1109242135 13:59902336-59902358 ACATGGCCAGAGAAGGAGTAAGG - Intronic
1110345053 13:74437327-74437349 ACATGGCCACAGACAGTGACTGG - Intergenic
1114125806 14:19723921-19723943 ACATGGCAAGAGAGGGAGCAAGG + Intronic
1114412810 14:22516655-22516677 ATATGGCCAGAGATCCTGCTGGG - Intergenic
1114564663 14:23621544-23621566 AATTGGCCACAGCTGGTGCCAGG + Intergenic
1115675491 14:35668642-35668664 ACATTACCAGATATGGTGCCTGG + Intronic
1116388589 14:44363171-44363193 ACATGAGCAAGGATGGTGCCTGG - Intergenic
1116510952 14:45746190-45746212 ACTTAGCCAGGGATGGTGCCGGG - Intergenic
1117742556 14:58833809-58833831 ACATGGCCAGAGTGGGCGCGAGG - Intergenic
1117962980 14:61180703-61180725 AGATGGCCAGAGAGGGTGTGTGG - Intergenic
1119249482 14:73139132-73139154 AATTAGCCAGACATGGTGCCAGG + Intronic
1120653971 14:87167647-87167669 ACACGGGCAGGGATGCTGCCTGG + Intergenic
1122782803 14:104150744-104150766 ACATGGCCAGCCATCGAGCCAGG + Intronic
1122792258 14:104188993-104189015 AGATGGGCAGGGATGGGGCCTGG + Intergenic
1123009498 14:105340924-105340946 ACGTGGCCAGAGACGGGGCAAGG - Intronic
1123443775 15:20307057-20307079 ACATGGCCAGGGAGGGTCCAGGG - Intergenic
1123717046 15:23040634-23040656 ACCTGGCCAGAGATGCTGGGGGG + Intergenic
1123717128 15:23040896-23040918 ACCTGGCCAGAGATGCTGGGGGG + Intergenic
1123717209 15:23041158-23041180 ACCTGGCCAGAGATGCTGGGGGG + Intergenic
1123717285 15:23041420-23041442 ACCTGGCCAGAGATGCTGGGGGG + Intergenic
1123717641 15:23042608-23042630 ACCTGGCCAGAGGTGCTGCGGGG + Intergenic
1123717682 15:23042751-23042773 ACCTGGCCAGAGATGCTGGGGGG + Intergenic
1123717781 15:23043084-23043106 ACCTGGCCAGAGATGCTGGGGGG + Intergenic
1123717847 15:23043309-23043331 ACCTGGCCAGAGATGCTGGGGGG + Intergenic
1123717989 15:23043799-23043821 ACCTGGCCAGAGGTGCTGCGGGG + Intergenic
1123718018 15:23043907-23043929 ACCTGGCCAGAGATGCTGGGGGG + Intergenic
1123718151 15:23044351-23044373 ACCTGGCCAGAGATGCTGGGGGG + Intergenic
1123718228 15:23044613-23044635 ACCTGGCCAGAGATGCTGGGGGG + Intergenic
1123718366 15:23045117-23045139 ACCTGGCCAGAGATGCTGGGGGG + Intergenic
1123718464 15:23045451-23045473 ACCTGGCCAGAGATGCTGGGGGG + Intergenic
1123718529 15:23045677-23045699 ACCTGGCCAGAGATGCTGGGGGG + Intergenic
1123718695 15:23046269-23046291 ACCTGGCCAGAGGTGCTGCGGGG + Intergenic
1123718832 15:23046746-23046768 ACCTGGCCAGAGATGCTGGGGGG + Intergenic
1123718899 15:23046972-23046994 ACCTGGCCAGAGATGCTGGGGGG + Intergenic
1123718961 15:23047190-23047212 ACCTGGCCAGAGATGCTGGGGGG + Intergenic
1123719037 15:23047452-23047474 ACCTGGCCAGAGATGCTGGGGGG + Intergenic
1123719112 15:23047715-23047737 ACCTGGCCAGAGATGCTGGGGGG + Intergenic
1123719175 15:23047933-23047955 ACCTGGCCAGAGATGCTGGGGGG + Intergenic
1123719251 15:23048195-23048217 ACCTGGCCAGAGATGCTGGGGGG + Intergenic
1123719328 15:23048457-23048479 ACCTGGCCAGAGATGTTGGGGGG + Intergenic
1123719461 15:23048912-23048934 ACCTGGCCAGAGGTGCTGCGGGG + Intergenic
1123719492 15:23049020-23049042 ACCTGGCCAGAGATGCTGGGGGG + Intergenic
1123719550 15:23049210-23049232 ACCTGGCCAGAGGTGCTGCGGGG + Intergenic
1123737575 15:23200255-23200277 ACATGGCCTGAGCTGTAGCCTGG + Intergenic
1124132183 15:27000647-27000669 ACATGGCCAGAGCAGGAGCAAGG - Intronic
1124288787 15:28428917-28428939 ACATGGCCTGAGCTGTAGCCTGG + Intergenic
1124294438 15:28488396-28488418 ACATGGCCTGAGCTGTAGCCTGG - Intergenic
1124484409 15:30102400-30102422 ACCTGGCCAGAGCTTGTGCCAGG + Intergenic
1124519174 15:30394824-30394846 ACCTGGCCAGAGCTTGTGCCAGG - Intergenic
1124539482 15:30571397-30571419 ACCTGGCCAGAGCTTGTGCCAGG + Intergenic
1124676809 15:31694038-31694060 ACAGGACCAGAGATGCTTCCAGG + Intronic
1124759168 15:32436175-32436197 ACCTGGCCAGAGCTTGTGCCAGG - Intergenic
1124843085 15:33263107-33263129 ACATGGACATACATGGTGGCAGG - Intergenic
1124974482 15:34520283-34520305 ACCTGGCCAGAGCTTGTGCCAGG - Intergenic
1125588487 15:40839271-40839293 AAATAGCCAGACATGGTGGCAGG + Intergenic
1126238053 15:46408610-46408632 AAATAGTCAGAGATGGTGCCTGG - Intergenic
1126583050 15:50258578-50258600 ACCTTGCCAGAGATGGTCTCTGG - Intronic
1127865534 15:63029572-63029594 ACAGGGCCAGAGATGGAGGCGGG - Intergenic
1129030333 15:72612840-72612862 ACCTGGCCAGAGCTGGTGCCAGG + Intergenic
1129209908 15:74062450-74062472 ACCTGGCCAGAGCTGGTGCCAGG - Intergenic
1129469084 15:75740373-75740395 ACCTGGCCAGAGCTGGTGCCAGG + Intergenic
1129477123 15:75792971-75792993 ACATGGCCAGAGCTGGTGCCAGG + Intergenic
1129477384 15:75795331-75795353 GCATGTCCAGAGATGCTGTCTGG + Intergenic
1129512524 15:76135360-76135382 ACATGGCCAGAGATGGTGCCGGG + Intronic
1131371010 15:91881900-91881922 ACCTGGCCAGGGATGGAGCAGGG - Intronic
1131989070 15:98075611-98075633 AGATGGCCAGACATGTTTCCAGG - Intergenic
1132185906 15:99801478-99801500 ACCTGGCCAGAGCTTGCGCCAGG + Intergenic
1132429772 15:101751220-101751242 ACCTGGCCAGAGCTTGCGCCAGG - Intergenic
1132477989 16:152043-152065 AATTAGCCAGAGATGATGCCGGG + Intergenic
1132682209 16:1147280-1147302 ACATGGAGGGAGAGGGTGCCAGG + Intergenic
1134482211 16:14629880-14629902 ACAAGGCCCCGGATGGTGCCGGG + Intronic
1134880663 16:17742941-17742963 ACATGGCCAGGGCTGGGACCAGG + Intergenic
1135529479 16:23240242-23240264 ACCAGGCCTGAGATGGTGGCTGG - Intergenic
1135575856 16:23585069-23585091 GAATGACCAGAGATGGTTCCAGG - Intronic
1135850669 16:25960171-25960193 ACATGGCCAGAGAGTGAGCAAGG - Intronic
1135876507 16:26205393-26205415 TCCTGGCCAGAGATGGTGACAGG - Intergenic
1136722431 16:32336803-32336825 ACATGGCCAGGGAGGGTCCAGGG + Intergenic
1136840745 16:33542775-33542797 ACATGGCCAGGGAGGGTCCAGGG + Intergenic
1139623676 16:68167979-68168001 ACTTAGCCAGATATGGTGGCGGG - Intronic
1140343408 16:74188268-74188290 ACATGGCCAGAGTGGGAGCCGGG + Intergenic
1141125255 16:81396589-81396611 ACATGGCAAGAGAGGGAGCAAGG + Intergenic
1141248158 16:82330058-82330080 CCATGGCCAGACAGTGTGCCGGG + Intergenic
1142011989 16:87720152-87720174 ACCTGGCCTGAGCTGGTGACGGG - Intronic
1142414099 16:89932055-89932077 CCATGTCCAGTGATGGTGCCAGG - Intronic
1203004000 16_KI270728v1_random:180961-180983 ACATGGCCAGGGAGGGTCCAGGG - Intergenic
1203135608 16_KI270728v1_random:1717368-1717390 ACATGGCCAGGGAGGGTCCAGGG - Intergenic
1203150910 16_KI270728v1_random:1843072-1843094 ACATGGCCAGGGAGGGTCCAGGG + Intergenic
1142491802 17:284459-284481 CAATGGGCAGAGAAGGTGCCAGG + Intronic
1143444364 17:6998659-6998681 TCATGGTCAGTGATGGGGCCAGG - Intronic
1143510460 17:7392912-7392934 ACGTGGCCAATGGTGGTGCCTGG + Exonic
1143684641 17:8504097-8504119 ACATGGCCAGAGAAGGCTCCTGG - Intronic
1144260747 17:13517798-13517820 AATTAGCCAGAGATGGTGGCAGG - Intronic
1144863966 17:18323224-18323246 ACATGGGCAGAAGTGGAGCCTGG + Intergenic
1145271861 17:21409127-21409149 GCTTGGTCAGAGATGGGGCCTGG + Intronic
1145310073 17:21696592-21696614 GCTTGGTCAGAGATGGGGCCTGG + Intronic
1147259700 17:39201984-39202006 AAATGGCCAGGCATGGTGGCAGG + Intronic
1148222490 17:45873086-45873108 AAATAGCCAGGCATGGTGCCAGG + Intergenic
1148688397 17:49513262-49513284 AGGTGGCCTGAGATGGTGACGGG - Exonic
1150408522 17:64922744-64922766 AATTAGCCAGAGATGGTGGCAGG - Intergenic
1150432714 17:65131363-65131385 ACCTGGACAGAAATGGTGTCGGG - Intergenic
1150865915 17:68849799-68849821 TCAGGGCCAGAGATGCTGGCAGG + Intergenic
1151037425 17:70817597-70817619 AAATGGGAAGAGATGGTGGCTGG + Intergenic
1151479161 17:74360266-74360288 GCATAGCCTGAGAAGGTGCCCGG + Intronic
1151902223 17:77023940-77023962 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
1151964736 17:77425468-77425490 CCATGACCAGAGAGGGGGCCAGG - Intronic
1152015962 17:77750354-77750376 ACGTGGGCATAGATGGTGGCAGG + Intergenic
1152206109 17:78975430-78975452 ACTTGGCCAGTGATGGTGGCGGG - Intronic
1153311607 18:3682218-3682240 ACATGGCCAGAGCAGGAGCAAGG - Intronic
1155299697 18:24418107-24418129 AATTAGCCAGACATGGTGCCAGG - Intergenic
1156247760 18:35318509-35318531 AGACTGCCTGAGATGGTGCCGGG + Intergenic
1158764870 18:60437616-60437638 ACATTTCCAGAGATGTTGGCAGG - Intergenic
1158963196 18:62603229-62603251 ACGTGGCCATAGATGCTGCAAGG + Intergenic
1159348573 18:67239893-67239915 AAATAGCCAGACATGGTGGCGGG - Intergenic
1159420185 18:68208445-68208467 ACATGGCCAGAGAGGGATCAAGG + Intergenic
1159802509 18:72919203-72919225 GCAGGTCCAGAGATGCTGCCTGG + Intergenic
1160844933 19:1162012-1162034 GCACGGCCACAGATGGCGCCTGG + Intronic
1160935734 19:1593630-1593652 TCCCGGCCAGAGATGGTGGCTGG - Intergenic
1161082599 19:2318836-2318858 ACATAGCCAGGCATGGTGGCGGG + Intronic
1161137147 19:2626510-2626532 ACAGGTGCAGAGATGGTTCCAGG - Intronic
1161323753 19:3653195-3653217 GCAGGGCCAGGGAGGGTGCCAGG - Intronic
1161405654 19:4089885-4089907 ACAGGGGCAGAGATGGTGGCGGG + Intergenic
1161677958 19:5663611-5663633 ACATGGCCAGGGCTGCTGGCAGG + Intronic
1161744660 19:6048525-6048547 ACATGCTCAAAGCTGGTGCCAGG - Intronic
1161865416 19:6829139-6829161 GCCTGGGCAGGGATGGTGCCAGG + Intronic
1162178282 19:8847800-8847822 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
1162788391 19:13050487-13050509 ACAGAGCCAGAGAAGCTGCCTGG - Intronic
1163834895 19:19567260-19567282 ACAAGGCCAGAGCTGGAGCAAGG - Intronic
1164707681 19:30332436-30332458 GCATGGGCAGAGAGGATGCCTGG - Intronic
1165163518 19:33832955-33832977 ACATCGACAGAGATGGGGCAGGG + Intergenic
1168207835 19:54865359-54865381 ACATGGCAAGAGAGGGAGCAAGG + Intronic
1168255517 19:55162436-55162458 ACAGGGCCGGACATGGTGGCGGG + Intronic
1202691002 1_KI270712v1_random:95889-95911 ACATGGCCAGGGAGGGTCCAGGG + Intergenic
925099410 2:1232444-1232466 ACATAGCCAGGCATGGTGGCGGG - Intronic
925744280 2:7031433-7031455 AGATGGTCAGAGATGATGGCAGG + Intronic
926172221 2:10559479-10559501 ACTGGGCCAGAGATGTTGGCGGG - Intergenic
926328221 2:11803672-11803694 ACATGGCCTGAGTGGGTGTCTGG - Intronic
927174013 2:20392715-20392737 ACGTGGTGAGAGATGGGGCCTGG + Intergenic
927570194 2:24152799-24152821 GCATGTCCAGAGATGCTGTCTGG + Intronic
928046632 2:27940848-27940870 ACATGGACACAGATGCTGACTGG - Intronic
928205786 2:29282419-29282441 ACATGGCCAAGGATGGTCCCAGG - Intronic
928575941 2:32655135-32655157 AATTGGCCAGACATGGTGGCGGG - Intronic
928877700 2:36060133-36060155 CCAGTGCCAGAGATGGTGCTTGG - Intergenic
929177534 2:38996236-38996258 ACTTAGCCAGACATGGTGGCGGG - Intronic
930944816 2:57061173-57061195 ACATATCCAGAGATGCTGTCTGG + Intergenic
933136610 2:78743277-78743299 AAACGGTCACAGATGGTGCCAGG - Intergenic
933300349 2:80533620-80533642 GCATTGCCAGAGATGGATCCTGG + Intronic
933303584 2:80570195-80570217 ACATAGCCAGGCATGGTGGCAGG - Intronic
933850715 2:86364542-86364564 ACATGGCCAGAGCAGGAGCAAGG + Intergenic
933955392 2:87358062-87358084 ACATGGCCAGGGAGGGTCCAGGG - Intergenic
934273615 2:91562468-91562490 ACATGGCCAGGGAGGGTCCAGGG + Intergenic
934323683 2:91986818-91986840 ACATGGCCAGGGAGGGTCCAGGG - Intergenic
934462017 2:94217613-94217635 ACATGGCCAGGGAGGGTCCAGGG - Intergenic
934560092 2:95308663-95308685 GCATGGCCAGGGCTGGTGTCCGG + Intronic
935194545 2:100804675-100804697 GCATCCCCTGAGATGGTGCCTGG - Intergenic
937223549 2:120355571-120355593 ACCTGGCCAGAGATGGTGCATGG - Intergenic
938070193 2:128304365-128304387 CCAGGGACAGAGATGGTGCATGG + Intronic
938722232 2:134076918-134076940 ACATGGCCAGAGTAGGAGGCGGG - Intergenic
940662351 2:156562309-156562331 TCATTGCCAGAGATTGTACCAGG + Intronic
941748929 2:169115312-169115334 AGATGGACAGAGATGGTAACTGG + Intergenic
942769541 2:179500560-179500582 ATATGGCAAGAGATGGGGTCTGG - Intronic
943138816 2:183951453-183951475 AAATAGCCAGGCATGGTGCCAGG - Intergenic
944888466 2:204090096-204090118 ACATGACCAAAGATGGTGAAAGG + Intergenic
946107149 2:217381072-217381094 ACATGGTGAGAGACGGAGCCAGG + Intronic
948022375 2:234745554-234745576 ACATAGCAATATATGGTGCCAGG + Intergenic
948178836 2:235964413-235964435 ACTTTGCCAGGTATGGTGCCAGG - Intronic
1168917796 20:1505520-1505542 ATGTGGCCAGTCATGGTGCCTGG + Intergenic
1169355668 20:4902850-4902872 GCATGGACAGAGATGTTCCCAGG + Intronic
1169621278 20:7509134-7509156 ACATGGCAGGAGATGGAGCAGGG + Intergenic
1170516137 20:17132385-17132407 GCAAGGCTATAGATGGTGCCAGG - Intergenic
1170714339 20:18818956-18818978 ACATGGCCAAAGAAGGAGCAAGG + Intronic
1172032450 20:31991404-31991426 AGATGGCCAGAGGTGGGGGCTGG - Intronic
1172212443 20:33210313-33210335 ACGTGGCCAGAGATGATGGTGGG + Intergenic
1172764589 20:37344848-37344870 ACATGGCCACAGAAGATTCCTGG - Intronic
1172967809 20:38850996-38851018 TCATGGGCAGAGATGCTGCCTGG + Intronic
1172988794 20:39016175-39016197 ACATGGCAAGAGAGGAAGCCAGG + Intronic
1173332387 20:42086094-42086116 AAATAGCCAGACATGGTGGCAGG - Intronic
1174079742 20:47962467-47962489 ACATAGCCAGAGGCGGGGCCAGG - Intergenic
1174081056 20:47970975-47970997 AGAGGGCCAGAGCTGGTTCCTGG + Intergenic
1174359601 20:50019736-50019758 ACAGGGCCACACATGGTGCCAGG + Intergenic
1174745476 20:53057868-53057890 ACATGGACAGAAATGGGGTCAGG + Intronic
1175096982 20:56548969-56548991 ACATGGCCAGAGGAGGAGCAAGG - Intergenic
1175993364 20:62801012-62801034 AGATGGCCAGGGATGTTCCCAGG - Exonic
1175998358 20:62821302-62821324 AGAGGGCCAGGGATGGTCCCTGG - Intronic
1176119258 20:63446623-63446645 ACATGGCCAGAGCTGGGGCTGGG + Intronic
1176180796 20:63748442-63748464 ACATGGCCAGGGATGGGGAGAGG + Intronic
1177212909 21:18091986-18092008 ATGTGTCCAGAGATGCTGCCTGG - Intronic
1177773497 21:25543601-25543623 ACATGGCAAGAGAGGGAGTCGGG + Intergenic
1178088799 21:29139878-29139900 AAAAAGCCAGAGATGGGGCCTGG - Intronic
1179807854 21:43851435-43851457 ACATGGAAAGAGATGGGGACAGG + Intergenic
1180029905 21:45200021-45200043 AAATGGCCAGAAAAGTTGCCCGG + Intronic
1180550447 22:16532671-16532693 ACATGGCCAGGGAGGGTCCAGGG - Intergenic
1180603994 22:17041745-17041767 AAATAGCCAGACATGGTGGCAGG + Intergenic
1181264842 22:21624921-21624943 ACAAGGCCAAAAATGGTGGCTGG - Intergenic
1181354222 22:22289140-22289162 ACATGGCCAGGGAGGGTCCAGGG + Intergenic
1181644251 22:24222294-24222316 ACATGGCCTGAGCTGCTGACAGG + Intronic
1181672245 22:24431096-24431118 GTGTGGCCAGGGATGGTGCCAGG + Intronic
1182030065 22:27151719-27151741 AAATAGCCAGTGATGGTGGCAGG - Intergenic
1184163422 22:42713163-42713185 GAATGGACAGAGGTGGTGCCAGG - Intronic
1184801434 22:46762785-46762807 CCATGGCCAGCGACGGGGCCAGG + Exonic
1185411214 22:50683914-50683936 ACCTGGCCAGAGAAAGGGCCCGG - Intergenic
949542969 3:5048510-5048532 AATTGGTCAGAGCTGGTGCCAGG + Intergenic
949752830 3:7374625-7374647 AAATGGCCAGGTATGGTGGCGGG - Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
950252826 3:11480940-11480962 AGATGATCAGAGTTGGTGCCAGG + Intronic
950523794 3:13511680-13511702 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
954145480 3:48632290-48632312 AGACAGCCAGAGATGCTGCCCGG - Exonic
954670623 3:52289565-52289587 ACATGGCCTCACATGGTGCCTGG + Intronic
954988115 3:54813595-54813617 ATATGCCCAGAGTTGATGCCAGG - Intronic
957033064 3:75265407-75265429 ACCTCCCCAGAGATGTTGCCAGG - Intergenic
957890106 3:86345757-86345779 AGATGTCCAGAGATGCTGTCTGG + Intergenic
958195235 3:90235390-90235412 CCATGACCAGAGTGGGTGCCAGG - Intergenic
958418649 3:93906795-93906817 CCATGACCAGAGTGGGTGCCAGG - Intronic
961316018 3:126036256-126036278 ACAGGCCCAGAGCTGGTGCAAGG - Intronic
962338451 3:134559999-134560021 ATATGGCCACAGCTGGTGACAGG - Intronic
962433819 3:135346451-135346473 ACATGGCAAGAGAAGATGCGAGG - Intergenic
963891265 3:150638311-150638333 ACCTGGCCAGAGTTGGTTTCTGG + Intergenic
964810168 3:160654640-160654662 GCATGTCCAGAGATGCTGTCTGG - Intergenic
964992830 3:162835405-162835427 ACAGGTCCAGAGATGCTGTCTGG + Intergenic
965086319 3:164103501-164103523 ACATGGCCAAAGAAGGAGCACGG - Intergenic
965582029 3:170278826-170278848 ACATGGCAAGAGAGGGAGCAAGG + Intronic
968022493 3:195405845-195405867 ACATGGCCAGAGCAGGAGCCAGG + Intronic
968311559 3:197687855-197687877 AGCTGCCCTGAGATGGTGCCAGG - Intronic
968459796 4:718836-718858 GCCTGGCCAGAGATGGAGCAGGG + Intronic
969087274 4:4665846-4665868 ACATCCCCAGACATGGTGCTTGG + Intergenic
969311349 4:6354512-6354534 ACCTGCCCAGAGCTGGTGCCTGG + Intronic
969539497 4:7778089-7778111 ACAGAGCCAGAGTGGGTGCCAGG - Intronic
969595815 4:8148800-8148822 ACATGGCCTGGGCTGGTTCCTGG + Intronic
969725650 4:8916663-8916685 GCATGGGGAGAGATGGGGCCTGG - Intergenic
970402745 4:15733656-15733678 ACATGGCCAGAGAAGGAGGAAGG + Intronic
970434602 4:16021630-16021652 ACATGGCCCCAGATGATGCCAGG - Intronic
971051254 4:22865207-22865229 ACATGGCCAAAGATGGAGTCAGG - Intergenic
973852854 4:54977966-54977988 GCATGTCCAGAGATGCTGTCTGG - Intergenic
974103109 4:57439150-57439172 ACATAGCCAGGCATGGTGGCGGG - Intergenic
976589479 4:86834870-86834892 ACATGGCCAGAGAGGGAGCAAGG + Intronic
979517169 4:121623052-121623074 ACATGGCAAGAGATGAAGCTGGG - Intergenic
979622925 4:122815660-122815682 ACACGGCCAGAGATGATACATGG + Intergenic
979752167 4:124291981-124292003 ACATGGCAAGAGAGGGAGCGGGG - Intergenic
979866991 4:125768541-125768563 AAATAGCCAGATATGGTGGCAGG + Intergenic
980693077 4:136320831-136320853 ACATGCCCAGAGATAATGTCTGG - Intergenic
981259173 4:142699059-142699081 AAATGGACAGAGGTGGTGCATGG + Intronic
983737595 4:171082394-171082416 ACATGGCCAGAGAAGGAGCAAGG - Intergenic
986395075 5:7321424-7321446 ACATGGTAAGAGATGGAGCTTGG + Intergenic
986631610 5:9779209-9779231 ACATGACAAGAGATGGAGCAAGG - Intergenic
988262585 5:28907920-28907942 AAATAGCCAGAGAGGGTGGCAGG - Intergenic
988438295 5:31202486-31202508 ACTTAGCCAGATATGGTGGCAGG + Intronic
989283820 5:39675676-39675698 AGATGGCCAGTAATGGTGCTAGG - Intergenic
990665779 5:58069590-58069612 GCGTGGCCAGAGTGGGTGCCAGG + Intergenic
990753532 5:59042846-59042868 ACATGGCCTGAAACTGTGCCAGG + Intronic
991317613 5:65327144-65327166 ACATGGCAAGAGAGGGAGCAAGG - Intronic
992932669 5:81665640-81665662 AATTAGCCAGACATGGTGCCTGG - Intronic
993547393 5:89229765-89229787 ACAGGGGCAGATCTGGTGCCTGG + Intergenic
994584602 5:101690533-101690555 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
994764106 5:103894747-103894769 ACAAGGTCAGACATGATGCCAGG - Intergenic
995782189 5:115789308-115789330 ACATGGCGAGAGAGGGAGCAAGG - Intergenic
996167802 5:120246724-120246746 AAATAGCCAGAGGTGGTGGCAGG - Intergenic
997471285 5:134118459-134118481 ACATGGGCAGAGCAGGTCCCTGG - Intronic
997992923 5:138561148-138561170 ACATGTACAAAGATGGTGGCCGG + Intronic
1000677034 5:164133377-164133399 ACATGGCCAGAGAAGGAGCAAGG - Intergenic
1001250678 5:170144492-170144514 TCGTGGACAGAGTTGGTGCCAGG + Intergenic
1001364142 5:171120327-171120349 ACATGTCCAGAGATGCTGTCTGG + Intronic
1002043191 5:176528892-176528914 GCATTTCCAGAGCTGGTGCCAGG - Exonic
1002540294 5:179902343-179902365 ACAAGGCCAGAAATGGAGGCAGG + Intronic
1002780871 6:364998-365020 ACACGGCCAGGGGTGGGGCCGGG - Intergenic
1003323608 6:5075044-5075066 ACATGGCAAGAGAGGGAGCAAGG - Intergenic
1003415421 6:5903283-5903305 AATTGGCCAGACATGGTGGCAGG - Intergenic
1003938286 6:10998090-10998112 ACATGGCAAGAGAGGGAGCAAGG - Intronic
1004246811 6:13985855-13985877 ACATGGCCAGAGAGGAAGCAAGG - Intergenic
1004565306 6:16790380-16790402 ACATGGCCAGGGAAGGAGCAAGG + Intergenic
1005316052 6:24603923-24603945 GCATGGCCAGTGATGGTGTTAGG - Intronic
1005993623 6:30918850-30918872 ACAAGGCCAGAGACGCTGCCTGG + Exonic
1006792087 6:36709091-36709113 AAATAGCCAGAGGTGGTGGCAGG - Intronic
1007053753 6:38860278-38860300 ACAAAGACAGAGATGGTTCCAGG - Intronic
1008388924 6:50926381-50926403 ACATGGCCAGCCACAGTGCCTGG + Intergenic
1011791785 6:90906842-90906864 ATATGTCCAGAGATGCTGTCTGG + Intergenic
1013052447 6:106549392-106549414 TCATGGCCACAGGTGGAGCCAGG + Intronic
1015725996 6:136300257-136300279 AAATAGCCAGAAATGGTGGCAGG + Intergenic
1017205742 6:151803123-151803145 ACATGGCCAGGGACAGTGCTGGG + Intronic
1017419199 6:154256162-154256184 ATGTGGGCAGAGCTGGTGCCTGG + Intronic
1017924743 6:158901234-158901256 GCATGTCCAGAGATGCTGTCTGG + Intronic
1018042268 6:159935381-159935403 ACAGGTCCAGAGATGGTGAACGG - Intergenic
1018442306 6:163824472-163824494 ACATGGACAAAGATGCTGCATGG + Intergenic
1018554148 6:165033325-165033347 ACATGGCAAGAGAGGGAGCAAGG + Intergenic
1018766380 6:166936565-166936587 ACATGGCCAGAGAGGAAGCCAGG + Intronic
1018892495 6:167991934-167991956 ACTTAGCCAGACATGGTGGCAGG - Intergenic
1019044464 6:169132474-169132496 GCATGTCCAGAGATGCTGCCTGG - Intergenic
1021651461 7:22837500-22837522 AGGAGGTCAGAGATGGTGCCAGG + Intergenic
1022735437 7:33071347-33071369 ACATGGCCAGAGAAGGAGCAGGG - Intergenic
1023316336 7:38941472-38941494 AATTAGCCAGACATGGTGCCGGG - Intergenic
1024006141 7:45225954-45225976 ACATGTCCACGGATGCTGCCTGG - Intergenic
1024247416 7:47480747-47480769 ACCTGGACAGTGAGGGTGCCTGG - Intronic
1025835260 7:65087236-65087258 ACTTAGCCAGACATGGTGGCAGG - Intergenic
1025905036 7:65776709-65776731 ACTTAGCCAGACATGGTGGCAGG - Intergenic
1025991737 7:66502765-66502787 ACATGGTCAGAGAAGGTGGTCGG + Intergenic
1026887865 7:73964976-73964998 ACAGGGCCAGAAGTGATGCCAGG + Intergenic
1027541357 7:79470654-79470676 ACATGGCCATGCCTGGTGCCAGG - Intergenic
1028216521 7:88140066-88140088 ACATGGCAAGAGAGGGAGCAGGG + Intronic
1028604901 7:92644893-92644915 ACAGGGTCAGATATGGGGCCTGG + Intronic
1029540189 7:101178263-101178285 ACAGGGGTAGAGGTGGTGCCTGG - Intronic
1029932487 7:104387217-104387239 ACATGGCCAGGTGTGGTGGCAGG + Intronic
1036387063 8:8291832-8291854 GCAGGGCCAGAGAGGGTGGCAGG - Intergenic
1036717788 8:11142606-11142628 ACATGGCAAGAGCTGGAGCAAGG - Intronic
1037670656 8:21012630-21012652 AGATGGCCAGTGCTGGAGCCAGG - Intergenic
1038278521 8:26141866-26141888 ACATGGCCAGAGAGGGAGCAAGG - Intergenic
1038511451 8:28139794-28139816 AAATGGCCAGACGTGGTGGCAGG + Intronic
1040602389 8:48897492-48897514 ACATGGTCAGACATGCTGGCAGG - Intergenic
1040692290 8:49953517-49953539 AGATGCCCACAGAAGGTGCCTGG + Intronic
1040721037 8:50323810-50323832 ACATGTCCAGAGATGCTATCTGG + Intronic
1041436954 8:57852568-57852590 ACAGGGCCAGAGAGGGAACCAGG + Intergenic
1043533498 8:81175580-81175602 ACATGGCCAGAGCAGGAGCAAGG + Intergenic
1043750592 8:83929150-83929172 ACATGTCCAGAGATGCTATCTGG + Intergenic
1044967215 8:97585230-97585252 ACATGGTCAGTGATGTGGCCTGG + Intergenic
1045038963 8:98202565-98202587 ACATAGCAAGAGATGGGGCGAGG - Intronic
1045430762 8:102112846-102112868 ACATGGCCAGAGAGGAAGCAAGG - Intronic
1045598485 8:103685313-103685335 ACATGGCAAGAGAGGGAGCAAGG + Intronic
1046061432 8:109144581-109144603 ACATGGTCAGAGCTAGTGACAGG + Intergenic
1048230568 8:132636525-132636547 ACAGGGTCAGAGGTTGTGCCAGG - Intronic
1048331178 8:133471771-133471793 ACCTGGCCAGAGTTGGTGCTAGG + Intronic
1048378657 8:133844917-133844939 ACATGGCCAGAGCAGGAGCAAGG - Intergenic
1049068153 8:140335853-140335875 AACTGGCCAGACATGGTGGCGGG - Intronic
1049640298 8:143712231-143712253 ACATGGCCAGTGCATGTGCCAGG + Intronic
1049834246 8:144723816-144723838 ACATGGTCAGAGAAAATGCCAGG + Intronic
1049939988 9:536190-536212 AAATAGCCAGACATGGTGGCGGG + Intronic
1050316096 9:4402023-4402045 GCATGTCCAGAGATGTTGTCTGG - Intergenic
1051045838 9:12872532-12872554 ACCTGGACAAAGATGCTGCCTGG + Intergenic
1052204848 9:25827304-25827326 GCATGTCCAGAGATGCTGTCTGG + Intergenic
1053653077 9:40188893-40188915 AAATAGCCAGACATGGTGGCGGG + Intergenic
1053692493 9:40593296-40593318 ACATGGCCAGGGAGGGTCCAGGG - Intergenic
1054272324 9:63044237-63044259 ACATGGCCAGGGAGGGTCCAGGG + Intergenic
1054303735 9:63394214-63394236 ACATGGCCAGGGAGGGTCCAGGG - Intergenic
1054402513 9:64720724-64720746 ACATGGCCAGGGAGGGTCCAGGG - Intergenic
1054436123 9:65205055-65205077 ACATGGCCAGGGAGGGTCCAGGG - Intergenic
1054494269 9:65816632-65816654 ACATGGCCAGGGAGGGTCCAGGG + Intergenic
1054961966 9:70979243-70979265 ACCTGGCCAGACATGGGGCGCGG + Intronic
1057873333 9:98734130-98734152 ACATCCCCAGAAAGGGTGCCAGG + Exonic
1058086801 9:100756435-100756457 AAATGGCCAGAGATGATGACAGG - Intergenic
1058783984 9:108367676-108367698 ACAAGGCCAGGGATGTTGCATGG + Intergenic
1059391414 9:114001874-114001896 CCAGGGGCAGAGATGGTCCCTGG - Intronic
1059771248 9:117428459-117428481 ACATAGCTAGTGATGGGGCCAGG + Intergenic
1061060518 9:128247977-128247999 ACCTGGCTGGAGCTGGTGCCAGG - Intronic
1061189466 9:129073381-129073403 ACTTGGCCAGGCATGGTGGCGGG + Intergenic
1061959239 9:133979638-133979660 ACATGGCCGGAGGCGGGGCCGGG - Intronic
1062340556 9:136092183-136092205 GCGTGCCCAGAGAGGGTGCCAGG + Intronic
1187045682 X:15646314-15646336 TCAGGGCCAGAGATAGTGTCCGG - Intronic
1187933247 X:24312745-24312767 AGATGGCGAGAAATGGAGCCAGG - Intergenic
1187938977 X:24363309-24363331 AGATGGCCAGAAATGGAGCCAGG + Intergenic
1188607163 X:32045380-32045402 ACATGGCCAGAGCAGAAGCCAGG - Intronic
1189173689 X:38933354-38933376 CCATTGCCAAAGATAGTGCCTGG - Intergenic
1189654352 X:43226439-43226461 ACATGGCAAGAGAGGGAGCAAGG - Intergenic
1189930702 X:46006021-46006043 AGTTAGCCAGAGATGGTGGCGGG - Intergenic
1190389742 X:49920313-49920335 ACATGGCTAGGCATGGTGGCTGG - Intergenic
1192149322 X:68702133-68702155 ACTCGGCCAGAGCTGCTGCCAGG - Intronic
1193020860 X:76791307-76791329 AAATAGCCAGACATGGTGGCAGG - Intergenic
1194306665 X:92257129-92257151 ACATGGCCAGAAAAGGAGCAAGG + Intronic
1194427638 X:93759645-93759667 ACATTGCCTGAGATCTTGCCTGG + Intergenic
1194526554 X:94984046-94984068 ACAGGTCCAGAGATGCTGTCTGG - Intergenic
1195761469 X:108250736-108250758 ACTTGGCCAGAGATTAAGCCTGG + Intronic
1196485533 X:116202971-116202993 TCATGGCCAGAGATGCTGTCTGG + Intergenic
1196500411 X:116374439-116374461 ACATGGCAAGAGAGGATGCAAGG + Intergenic
1197278770 X:124510431-124510453 AAATGGCCAAAAATGGTGCTTGG + Intronic
1198512352 X:137365202-137365224 AGAGGGCCAGAGGTGGTGTCTGG - Intergenic
1198570673 X:137952435-137952457 ATATGGCAAGAGATGGGGGCAGG + Intergenic
1199393742 X:147310093-147310115 GCATGTCCAGAGATGCTGTCTGG - Intergenic
1199738578 X:150709697-150709719 ACATGGCCAGAGTGGGAGCAAGG + Intronic
1199784311 X:151090726-151090748 TCATGGCCATATATGGTGACAGG + Intergenic