ID: 1129512992

View in Genome Browser
Species Human (GRCh38)
Location 15:76138621-76138643
Sequence CTAAGCATGTTCCTGCATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129512992_1129512998 26 Left 1129512992 15:76138621-76138643 CCTACATGCAGGAACATGCTTAG 0: 1
1: 0
2: 1
3: 9
4: 134
Right 1129512998 15:76138670-76138692 CTAGGAGCTCTGCAGACATTAGG 0: 1
1: 0
2: 1
3: 20
4: 175
1129512992_1129512997 8 Left 1129512992 15:76138621-76138643 CCTACATGCAGGAACATGCTTAG 0: 1
1: 0
2: 1
3: 9
4: 134
Right 1129512997 15:76138652-76138674 GGAATCTAGAGAATTCGGCTAGG 0: 1
1: 0
2: 1
3: 3
4: 79
1129512992_1129512999 27 Left 1129512992 15:76138621-76138643 CCTACATGCAGGAACATGCTTAG 0: 1
1: 0
2: 1
3: 9
4: 134
Right 1129512999 15:76138671-76138693 TAGGAGCTCTGCAGACATTAGGG 0: 1
1: 0
2: 2
3: 16
4: 178
1129512992_1129512996 3 Left 1129512992 15:76138621-76138643 CCTACATGCAGGAACATGCTTAG 0: 1
1: 0
2: 1
3: 9
4: 134
Right 1129512996 15:76138647-76138669 GTAAGGGAATCTAGAGAATTCGG 0: 1
1: 0
2: 0
3: 6
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129512992 Original CRISPR CTAAGCATGTTCCTGCATGT AGG (reversed) Intronic
903136285 1:21311266-21311288 CTATGAACATTCCTGCATGTTGG - Intronic
907267115 1:53269192-53269214 CTAGGCATGCTCCTGCATTAGGG + Intronic
908166798 1:61467044-61467066 CTAAGCAAGTTACTGCACCTCGG - Intergenic
908166933 1:61468111-61468133 CTAAGCAAGTTACTGCACCTCGG + Intergenic
911643614 1:100315692-100315714 TGAAGCATGTTCCTGAATGGCGG - Intergenic
913250104 1:116906212-116906234 CTAAGCAGGGTCCTGCCTGAGGG - Intergenic
915633624 1:157171374-157171396 CTCGGGATGTTCCTGAATGTGGG + Intergenic
915636965 1:157194266-157194288 CTCGGGATGTTCCTGAATGTGGG + Intergenic
918817351 1:189205645-189205667 CAAAGAAAGTTTCTGCATGTTGG + Intergenic
920762161 1:208795063-208795085 ATAAGCATGTTCATCCATGAAGG + Intergenic
1066156788 10:32686800-32686822 CCAGCCATGTTGCTGCATGTGGG + Intronic
1070142690 10:73750241-73750263 CTAATCATGTTCCTGTAGGCAGG + Intronic
1070554956 10:77520419-77520441 CTCAGCAGGTTCCTGCACATAGG + Intronic
1073724439 10:106213380-106213402 CCAACCATTTTCCTGCATGTGGG + Intergenic
1081234445 11:40629481-40629503 TAAAGCATGTTTCTACATGTTGG + Intronic
1081564816 11:44252097-44252119 CTGAGCTTGTTCCTGCCTGAGGG - Intergenic
1083170771 11:60922944-60922966 GTAGGCATGTGCCTGCAAGTGGG + Exonic
1090811313 11:130246744-130246766 CCAAGCCTGTTTCTGAATGTTGG - Intronic
1090919903 11:131198354-131198376 CAAAGCAGGTTCCTGCACCTGGG - Intergenic
1100396578 12:94190806-94190828 CTAAGCATGTTCCTGCCCCAGGG + Intronic
1102567802 12:113808514-113808536 CAAAGCATGTTCCTGAGAGTGGG - Intergenic
1103211500 12:119170420-119170442 TCAAGCATGTTCCTGCCTGAAGG - Intergenic
1103949205 12:124542108-124542130 CTCAGCCTCTTCCTGCATGGAGG + Intronic
1106213524 13:27673415-27673437 CTAAGCATGATCCCACATGGAGG - Intergenic
1106449686 13:29869103-29869125 GAAAGCATGTTTCTGGATGTAGG + Intergenic
1109010307 13:56932623-56932645 GTAAGTATGTGCCTGCTTGTTGG - Intergenic
1115736178 14:36332581-36332603 CTGAGCCTGTTCCTGAATGTAGG - Intergenic
1119432859 14:74579594-74579616 GGCAGCATGTGCCTGCATGTGGG - Intronic
1120103660 14:80471099-80471121 CCAAGCCTGTTCCTGCACCTGGG - Intergenic
1121133333 14:91470484-91470506 ATAAGCATGTTTCAGCTTGTAGG + Intronic
1121765275 14:96480521-96480543 CTGGACATGTTTCTGCATGTTGG + Intronic
1125302223 15:38268313-38268335 CTAAGGATGTACCTCCGTGTTGG - Intronic
1126149277 15:45507880-45507902 CCAAGAATCTTCCAGCATGTGGG - Intronic
1127561492 15:60141528-60141550 CCAAGGAGGTTCCTTCATGTTGG + Intergenic
1128341202 15:66823695-66823717 CTCACCATGTTCCTGCAGGGTGG + Intergenic
1129512992 15:76138621-76138643 CTAAGCATGTTCCTGCATGTAGG - Intronic
1130160832 15:81398372-81398394 CTCGTCATTTTCCTGCATGTTGG + Intergenic
1133698529 16:8287728-8287750 ATAAGGATGTTCCTTCAGGTGGG + Intergenic
1134026653 16:10959192-10959214 CTGAGCAAGTTCCTGAATATAGG + Intronic
1136115184 16:28089968-28089990 GTATGCATGTGCATGCATGTGGG - Intergenic
1137797708 16:51236197-51236219 CCAAGCATGTTCCTGCCTCCAGG + Intergenic
1144498753 17:15767516-15767538 CTGAGCATATTTCTACATGTAGG - Intergenic
1145162136 17:20582550-20582572 CTGAGCATATTTCTACATGTAGG - Intergenic
1153150879 18:2091603-2091625 CTGAGCATTTTCATGTATGTGGG - Intergenic
1154153453 18:11925832-11925854 CTCAGAATGTTTCTGCATGAGGG + Intergenic
1156816206 18:41314379-41314401 TTAAATATGTTCATGCATGTTGG - Intergenic
1156867199 18:41902279-41902301 CTTTGCCTGTTTCTGCATGTTGG + Intergenic
1158655943 18:59334185-59334207 CTAAGCAAGTTCATGCTTCTGGG - Intronic
1159972843 18:74675142-74675164 CCAAGCATGTTTCTGCCTGAGGG + Intronic
1167919432 19:52770739-52770761 ATAAGGATGTTCCTGCAGTTGGG + Intronic
1168369540 19:55820620-55820642 CTTAGCATGTTTGTGCATTTAGG - Intronic
925845665 2:8031123-8031145 CTGAGAATGTTCCAGAATGTTGG + Intergenic
930326724 2:49929165-49929187 CTCATCATGTGCCTGCATGATGG + Intronic
933993112 2:87647801-87647823 CATACCATGATCCTGCATGTGGG - Intergenic
936300746 2:111303082-111303104 CATACCATGATCCTGCATGTGGG + Intergenic
937034837 2:118772293-118772315 CTACAAGTGTTCCTGCATGTTGG - Intergenic
939651335 2:144766399-144766421 ATAAGCTTGTTCCTGGATGAGGG - Intergenic
940185629 2:150981991-150982013 TTAAGCATGTTCCTGTCTGGGGG + Intergenic
940337523 2:152544786-152544808 CTAAGCATCTTCCTCCATGTGGG - Intronic
940856254 2:158730712-158730734 CCACGCATGTTCCTCCTTGTTGG - Intergenic
941155304 2:161970593-161970615 CTAAGCATATTCGTGAATATTGG + Intronic
944764409 2:202849713-202849735 CTTAACATGTTCCTGCCTGCTGG + Intronic
945766922 2:213991949-213991971 CCAAGCATGTTGCTGCGAGTAGG + Intronic
946669568 2:222088510-222088532 CTAAGCTTGTTCCTGCCTCAGGG - Intergenic
1169766919 20:9156786-9156808 TTAACCATTTTCCTTCATGTTGG + Intronic
1170541012 20:17388061-17388083 CTGAGCATGTTCCTGCCTCAGGG - Intronic
1172975020 20:38899653-38899675 CTGAGGATGTTTCTGCATATGGG + Intronic
1173194552 20:40903573-40903595 CCAGGCATGTTCCTGCCTCTGGG - Intergenic
1174112300 20:48205100-48205122 CTCAGCAGGTTACTGCATCTGGG + Intergenic
1175711788 20:61227170-61227192 CTAAGCATGGCCCTGCCTGTGGG - Intergenic
1177181178 21:17746184-17746206 ATAAGGATGTTCCTTCCTGTGGG + Intergenic
1177646287 21:23903576-23903598 CTAAGCAAGTTGCTACAGGTAGG - Intergenic
1177923972 21:27190343-27190365 GTAAGCATGTGCATGCATGTGGG - Intergenic
1178409979 21:32355412-32355434 CTGAGCATGTTCCTTTATGTGGG + Intronic
1179309700 21:40184875-40184897 CTAAGTATTTTCCTGCATGCTGG + Intronic
1181168974 22:20997749-20997771 CTAAGCCTCCTCCCGCATGTTGG - Exonic
1183787167 22:40036415-40036437 CTAAGGATGAACCTGCATGAGGG - Exonic
1185008668 22:48300582-48300604 CTGCGCATGTGTCTGCATGTGGG - Intergenic
952217181 3:31289233-31289255 GTAAGCACGTGCCAGCATGTTGG + Intergenic
952710804 3:36430183-36430205 CAAAGCCTGTACCTGCATGTTGG + Intronic
953977799 3:47395454-47395476 CTAAGCCTGTGCCTCCAGGTGGG + Intronic
954121099 3:48500646-48500668 CTATGAATTTACCTGCATGTTGG - Intronic
956466054 3:69521715-69521737 CCAAGCATGTTCCTACCTCTGGG + Intronic
957568929 3:81920887-81920909 CAAAGCATGTTACTTCCTGTTGG - Intergenic
958609183 3:96402229-96402251 TGAAGCATGTAACTGCATGTAGG - Intergenic
960808378 3:121605838-121605860 CTAAGCATGTCCCTGTGTGGGGG + Intronic
961705267 3:128780047-128780069 CTGATCATGTTCCTCCATGGGGG + Intronic
963462187 3:145629806-145629828 CTAAGATTTTTACTGCATGTTGG + Intergenic
966016437 3:175144616-175144638 TATAGCATGATCCTGCATGTGGG - Intronic
973685145 4:53362251-53362273 CTAAGCATGTTCCAGCCTCAGGG - Intronic
981021735 4:140036346-140036368 ATACTCATGTTCCTGCATGCTGG - Intronic
983736384 4:171067770-171067792 CTCTGCTTATTCCTGCATGTAGG + Intergenic
984500136 4:180548045-180548067 ATCAGCATGTTCCTACATCTTGG + Intergenic
985371399 4:189289198-189289220 CAAAGCAGGGTCCTGGATGTGGG - Intergenic
985574336 5:666533-666555 CTAACCATGTTCCTGTGTGGGGG - Intronic
985632056 5:1018880-1018902 CCAAGGATGTTCCTCCCTGTGGG - Intronic
987668035 5:20970210-20970232 CAAAGCAAATTCCTGCATTTAGG - Intergenic
988694340 5:33605000-33605022 ATAAGCATGTTACTGCCTTTGGG + Intronic
990929867 5:61076496-61076518 CTGAGCATGTTCCTGCCTCAGGG - Intronic
994153748 5:96479138-96479160 CTAAGCAGGTGTCAGCATGTAGG - Intergenic
996862294 5:128081326-128081348 CTAAGCATGCTCCTGCCTTTGGG + Intergenic
999277507 5:150341206-150341228 CTAAGCTTGTGGCTGCCTGTGGG + Intergenic
1003155865 6:3593364-3593386 CTTTGCATGTTTGTGCATGTAGG + Intergenic
1004729522 6:18344168-18344190 GGAAGCATGTTCATGCATCTGGG - Intergenic
1006609944 6:35288433-35288455 GAAACCATGGTCCTGCATGTGGG + Intronic
1007080439 6:39098227-39098249 CTAAGCATGATCCTGGCTTTGGG - Intergenic
1008343052 6:50390835-50390857 CTAAGCATATGCCTGCTTCTTGG + Intergenic
1008349209 6:50469735-50469757 CTAAGCATGTTTCTCAAGGTGGG - Intergenic
1009315638 6:62216048-62216070 ATAAAGATGTTCATGCATGTTGG + Intronic
1010989194 6:82460268-82460290 ATAACCATGTTCCTGCACTTAGG - Intergenic
1013479115 6:110537840-110537862 CTAAGCTAGTTCCTGATTGTGGG - Intergenic
1016689423 6:146919416-146919438 ATCACCATGTTCCTGCAGGTGGG - Intergenic
1016987236 6:149904750-149904772 CTGAGCATTTTCCTGGATCTTGG - Intergenic
1017499209 6:155007680-155007702 CTAAGCAAAGTCCTGCCTGTTGG - Intronic
1018058479 6:160071670-160071692 CTAAGTGTGTTGCTGCCTGTGGG + Intronic
1018390012 6:163335124-163335146 CACAGCATCTCCCTGCATGTGGG - Intergenic
1022246841 7:28568663-28568685 ATAAGCCTGTTCCTGCCTTTGGG + Intronic
1022830683 7:34063013-34063035 CTAGGCATGTGTCTACATGTGGG - Intronic
1028202830 7:87982415-87982437 CTAAGCTTGTTCCTGCCTCAGGG - Intronic
1029994568 7:104994731-104994753 CTATGACTGTTGCTGCATGTTGG + Intergenic
1030343439 7:108406585-108406607 ATAAGCAGGTTGCTGCATATGGG - Intronic
1030586458 7:111425787-111425809 CTAAGAATGATCCAGCAGGTGGG - Intronic
1034613547 7:152394422-152394444 CTAAGCACATTCCTGCCTCTGGG + Intronic
1034827786 7:154282292-154282314 AGAAGCATGTCCCTGCATGCAGG - Intronic
1038688704 8:29742136-29742158 CTCAGGATGTTTCTGGATGTTGG - Intergenic
1040586273 8:48745417-48745439 CTCAGCCTGTTCATGCATTTTGG + Intergenic
1040669188 8:49666899-49666921 CTAAGTATGTTTCTGGATTTGGG + Intergenic
1044723705 8:95174832-95174854 CCAAGCTTGTGCCTGCATGCTGG - Intergenic
1047226632 8:122960605-122960627 CCCAGCATGCTCCTGCATGTTGG - Intronic
1051741279 9:20254715-20254737 CCAAGCAGGTTCCTGGATGGGGG + Intergenic
1055047023 9:71937245-71937267 CACAGCATGTTTCTGCCTGTAGG + Intronic
1055696780 9:78893393-78893415 CCAAGCATGTATCTTCATGTTGG + Intergenic
1056872090 9:90291240-90291262 CCAAGCATGTTCCTTCTGGTGGG - Intergenic
1058501551 9:105624153-105624175 CTAAGCATGCTCATTTATGTTGG - Intronic
1059584519 9:115591646-115591668 CCAAGCATCTTCTTGCTTGTAGG + Intergenic
1186061940 X:5718463-5718485 CTCTGTATGTTCCTGCATTTTGG - Intergenic
1186402504 X:9272740-9272762 GTCAGAATTTTCCTGCATGTTGG - Intergenic
1189884966 X:45533202-45533224 CTCAGCCAGTGCCTGCATGTTGG + Intergenic
1190116748 X:47630303-47630325 CTCAGTATGTTCCTGCTCGTGGG + Exonic
1194722178 X:97353321-97353343 CTAAGCAAGATACTGCATGGTGG - Intronic
1196756233 X:119159787-119159809 GAAAGCAGTTTCCTGCATGTGGG - Intergenic
1197094494 X:122576579-122576601 CTAAGGGTGTTATTGCATGTGGG - Intergenic
1200063180 X:153492639-153492661 CCAGGCATGTTCCTGGATGGGGG - Intronic
1201535095 Y:15038522-15038544 CTAAGCCTTTCCCTGCATGGAGG - Intergenic
1202053492 Y:20805059-20805081 CCAAGCCTGTCCCTGCATGAGGG - Intergenic