ID: 1129512992

View in Genome Browser
Species Human (GRCh38)
Location 15:76138621-76138643
Sequence CTAAGCATGTTCCTGCATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129512992_1129512997 8 Left 1129512992 15:76138621-76138643 CCTACATGCAGGAACATGCTTAG 0: 1
1: 0
2: 1
3: 9
4: 134
Right 1129512997 15:76138652-76138674 GGAATCTAGAGAATTCGGCTAGG 0: 1
1: 0
2: 1
3: 3
4: 79
1129512992_1129512999 27 Left 1129512992 15:76138621-76138643 CCTACATGCAGGAACATGCTTAG 0: 1
1: 0
2: 1
3: 9
4: 134
Right 1129512999 15:76138671-76138693 TAGGAGCTCTGCAGACATTAGGG 0: 1
1: 0
2: 2
3: 16
4: 178
1129512992_1129512998 26 Left 1129512992 15:76138621-76138643 CCTACATGCAGGAACATGCTTAG 0: 1
1: 0
2: 1
3: 9
4: 134
Right 1129512998 15:76138670-76138692 CTAGGAGCTCTGCAGACATTAGG 0: 1
1: 0
2: 1
3: 20
4: 175
1129512992_1129512996 3 Left 1129512992 15:76138621-76138643 CCTACATGCAGGAACATGCTTAG 0: 1
1: 0
2: 1
3: 9
4: 134
Right 1129512996 15:76138647-76138669 GTAAGGGAATCTAGAGAATTCGG 0: 1
1: 0
2: 0
3: 6
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129512992 Original CRISPR CTAAGCATGTTCCTGCATGT AGG (reversed) Intronic