ID: 1129515022

View in Genome Browser
Species Human (GRCh38)
Location 15:76152115-76152137
Sequence TCACCAGCCACTGTATCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 500}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129515018_1129515022 -1 Left 1129515018 15:76152093-76152115 CCTGCTCCAAGGCAGCCAGGCCT 0: 1
1: 0
2: 2
3: 102
4: 641
Right 1129515022 15:76152115-76152137 TCACCAGCCACTGTATCCCCTGG 0: 1
1: 0
2: 1
3: 34
4: 500
1129515013_1129515022 15 Left 1129515013 15:76152077-76152099 CCAGTCTCCATGGCTCCCTGCTC 0: 1
1: 0
2: 4
3: 62
4: 534
Right 1129515022 15:76152115-76152137 TCACCAGCCACTGTATCCCCTGG 0: 1
1: 0
2: 1
3: 34
4: 500
1129515012_1129515022 16 Left 1129515012 15:76152076-76152098 CCCAGTCTCCATGGCTCCCTGCT 0: 1
1: 0
2: 1
3: 34
4: 445
Right 1129515022 15:76152115-76152137 TCACCAGCCACTGTATCCCCTGG 0: 1
1: 0
2: 1
3: 34
4: 500
1129515010_1129515022 18 Left 1129515010 15:76152074-76152096 CCCCCAGTCTCCATGGCTCCCTG 0: 1
1: 0
2: 5
3: 44
4: 421
Right 1129515022 15:76152115-76152137 TCACCAGCCACTGTATCCCCTGG 0: 1
1: 0
2: 1
3: 34
4: 500
1129515011_1129515022 17 Left 1129515011 15:76152075-76152097 CCCCAGTCTCCATGGCTCCCTGC 0: 1
1: 0
2: 3
3: 57
4: 575
Right 1129515022 15:76152115-76152137 TCACCAGCCACTGTATCCCCTGG 0: 1
1: 0
2: 1
3: 34
4: 500
1129515015_1129515022 8 Left 1129515015 15:76152084-76152106 CCATGGCTCCCTGCTCCAAGGCA 0: 1
1: 0
2: 6
3: 47
4: 363
Right 1129515022 15:76152115-76152137 TCACCAGCCACTGTATCCCCTGG 0: 1
1: 0
2: 1
3: 34
4: 500
1129515019_1129515022 -7 Left 1129515019 15:76152099-76152121 CCAAGGCAGCCAGGCCTCACCAG 0: 1
1: 0
2: 3
3: 34
4: 374
Right 1129515022 15:76152115-76152137 TCACCAGCCACTGTATCCCCTGG 0: 1
1: 0
2: 1
3: 34
4: 500
1129515009_1129515022 21 Left 1129515009 15:76152071-76152093 CCACCCCCAGTCTCCATGGCTCC 0: 1
1: 0
2: 6
3: 63
4: 665
Right 1129515022 15:76152115-76152137 TCACCAGCCACTGTATCCCCTGG 0: 1
1: 0
2: 1
3: 34
4: 500
1129515017_1129515022 0 Left 1129515017 15:76152092-76152114 CCCTGCTCCAAGGCAGCCAGGCC 0: 1
1: 0
2: 12
3: 255
4: 1102
Right 1129515022 15:76152115-76152137 TCACCAGCCACTGTATCCCCTGG 0: 1
1: 0
2: 1
3: 34
4: 500
1129515008_1129515022 22 Left 1129515008 15:76152070-76152092 CCCACCCCCAGTCTCCATGGCTC 0: 1
1: 0
2: 5
3: 51
4: 639
Right 1129515022 15:76152115-76152137 TCACCAGCCACTGTATCCCCTGG 0: 1
1: 0
2: 1
3: 34
4: 500

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129515022 Original CRISPR TCACCAGCCACTGTATCCCC TGG Intronic
900814463 1:4832880-4832902 TCACCAGACACTGAATCTGCTGG - Intergenic
902154343 1:14472020-14472042 TCACCAGACACTGAATCGTCTGG - Intergenic
902189717 1:14753864-14753886 TCACCAGACACTGAATCTGCTGG - Intronic
902539569 1:17144341-17144363 TCACCAGACACTGAATCTTCTGG - Intergenic
902727983 1:18350060-18350082 TCACCACCCACTGCTTCCTCAGG - Intronic
903372991 1:22848834-22848856 TCCAGAACCACTGTATCCCCCGG - Intronic
903421756 1:23222714-23222736 TCAACAGTCACTGTATTGCCAGG - Intergenic
907201320 1:52729102-52729124 TCACGAGACACTGAATCCACTGG - Intronic
907628495 1:56055715-56055737 TCACCAGACACTGAATCTGCTGG + Intergenic
909468842 1:76003565-76003587 GCACCAGCCACTGTGCACCCAGG - Intergenic
910514737 1:88047240-88047262 TCACCAGACACTGAATCTGCTGG + Intergenic
910898065 1:92089581-92089603 TCACCAGGCACTGAATCTGCTGG - Intronic
911610934 1:99958505-99958527 TCACCAGACACTGAATCAGCTGG + Intergenic
911716646 1:101141030-101141052 TCACCAGACACTGAATCTGCTGG - Intergenic
913971178 1:143419686-143419708 TCTCCAGCCACAATATCCCGGGG + Intergenic
914384306 1:147152979-147153001 TTACTAGCCATTTTATCCCCTGG - Intergenic
914385615 1:147167042-147167064 TCCTAAGCCATTGTATCCCCTGG + Intronic
915100744 1:153497730-153497752 TCACCAGACACTGAATCTGCTGG + Intergenic
916985966 1:170191692-170191714 TCCCCAGGCACTCTATCCCAGGG + Intergenic
917605336 1:176622899-176622921 TCACCAGACACTGAATTCGCTGG - Intronic
917851203 1:179065870-179065892 TCACCAGACACTGAATCTGCTGG - Intronic
918098844 1:181356303-181356325 TCTCCAGCCACTGTATTCCCTGG + Intergenic
918491599 1:185087264-185087286 TCACCAGACACTGCATCTGCTGG - Intronic
918538918 1:185605932-185605954 TCACCAGACACTGCATCTCCTGG + Intergenic
919461845 1:197885938-197885960 TCACCAGACACTGAATCTGCTGG - Intergenic
919839946 1:201601678-201601700 TCACCAGACACTGCATCTCCTGG + Intergenic
921107348 1:211995865-211995887 TCACCAGACACTGAATCTGCTGG + Intronic
921249756 1:213285909-213285931 TCACCAGACACTGAATCTGCTGG + Intergenic
921354453 1:214273391-214273413 TCACCAGACACTGAATCTGCTGG - Intergenic
921481017 1:215664829-215664851 TCACCAGACACTGAATCTGCAGG + Intronic
921753492 1:218824992-218825014 TCACCAGACACTGGATCTGCAGG + Intergenic
922409301 1:225355175-225355197 TCACCAGCCACTGAATCTGCTGG - Intronic
922514173 1:226194628-226194650 TCACCAGACACTGAATCTGCTGG - Intergenic
922616062 1:226961835-226961857 TCACCAGACACTGAATCTTCTGG - Intronic
922823621 1:228502024-228502046 TCACCAGCCACTGGATATGCTGG + Intergenic
922975487 1:229780199-229780221 TCACCAGACACTGAATCTGCAGG + Intergenic
923003126 1:230023968-230023990 TCACCAGACACTGAATCTGCTGG - Intergenic
923405579 1:233655745-233655767 TCACCAGACACTGAATCTGCTGG + Intronic
923411443 1:233713838-233713860 TCACCAGACACTGAATCTGCTGG + Intergenic
1063606621 10:7528169-7528191 ACAGCAGCCACCGTCTCCCCGGG - Intergenic
1065933158 10:30497020-30497042 TCACCAGACACTGAATCTACTGG + Intergenic
1066474893 10:35737643-35737665 TCACCAGACACAGAATCCCCTGG - Intergenic
1068029512 10:51689771-51689793 TCATCACCCACTCTTTCCCCAGG - Intronic
1070573383 10:77658615-77658637 TCACCAGACACTGAATCTGCTGG + Intergenic
1072230599 10:93411280-93411302 TCACCAGACACTGAATCCGCCGG - Intronic
1072535930 10:96362738-96362760 TCACCAGACACTGAATCTCCTGG - Intergenic
1073470473 10:103719036-103719058 TCACCAGACACTGAATCTGCTGG + Intronic
1073617745 10:105014875-105014897 TCACTAGACACTGTATCTGCTGG + Intronic
1074252270 10:111762904-111762926 TCACCAGACACTGAATCTGCTGG + Intergenic
1074726956 10:116320847-116320869 TCACCAGACACTGAATTCGCTGG + Intergenic
1076266126 10:129111062-129111084 CCACCACCGACTGTGTCCCCAGG - Intergenic
1076311931 10:129514759-129514781 TCACCAGGCACTGAATCTGCCGG + Intronic
1076567940 10:131411744-131411766 TCACCAGGCCCAGGATCCCCAGG - Intergenic
1076747156 10:132520171-132520193 TCACCCCCCACTGCAGCCCCTGG + Intergenic
1077216826 11:1398478-1398500 TCTCCACCCCCTGTATCCCCAGG - Intronic
1078130935 11:8613616-8613638 TCTCCAGCCTCTGTCTCCACTGG - Exonic
1078147548 11:8731955-8731977 TAACAAGCCTCTGTCTCCCCTGG + Intronic
1078156804 11:8806814-8806836 TCCCCAGCCCCTGCCTCCCCAGG + Intronic
1078445341 11:11400597-11400619 TCACCAGACACTGGATCTGCTGG - Intronic
1079075558 11:17383445-17383467 TCAGCAGACACTGAATCCACTGG + Intergenic
1080081853 11:28229657-28229679 TCACCAGACACTGAATCTGCTGG + Intronic
1080191137 11:29550642-29550664 TCACCAGACACTGAATCTGCTGG - Intergenic
1081506820 11:43726325-43726347 TCCTCACCCACTCTATCCCCTGG - Intronic
1082772558 11:57219687-57219709 TCACCAGACACAGTATTCCGTGG + Intergenic
1082821432 11:57546806-57546828 TCACCCACTGCTGTATCCCCAGG - Intronic
1083029713 11:59581090-59581112 TCATCAGACTTTGTATCCCCAGG + Intronic
1084477125 11:69395439-69395461 CCACCAGCCACTGCATTCTCTGG - Intergenic
1084541988 11:69792641-69792663 TCACGAGCCATTGTAGTCCCAGG + Intergenic
1085096403 11:73763945-73763967 TCACCAGACACAGTATCTTCTGG - Intergenic
1085250235 11:75138623-75138645 TCACCAGACACTGGATCCACTGG - Intronic
1085792745 11:79510019-79510041 TCACCAGACACTGAATCTACTGG + Intergenic
1086532830 11:87806313-87806335 TCACCAGACACTGAATCTGCTGG - Intergenic
1086860489 11:91919610-91919632 TCACCAGACACTGAATCTGCTGG - Intergenic
1087583595 11:100090646-100090668 TCACCAGGCACTGAATCTCCTGG - Intronic
1087729375 11:101760860-101760882 TCACCAGACACTGAATCTACTGG - Intronic
1087756703 11:102062182-102062204 TCACCAGCAACTGAATCATCTGG + Intronic
1088427730 11:109723382-109723404 TCACCAGACACTGAATCTACTGG - Intergenic
1088924728 11:114289919-114289941 TCACCAGACACTGAATCTGCTGG - Intronic
1090302927 11:125662223-125662245 TCACCAGACACTGAATCTGCTGG - Intronic
1090651881 11:128814197-128814219 TCACCAGACACTGAATCTGCTGG - Intergenic
1090687156 11:129134875-129134897 TCACCAGACACTGAATCTGCTGG + Intronic
1090738341 11:129632611-129632633 TCACCAGACACTGAATCTCCTGG - Intergenic
1091318157 11:134630652-134630674 TCACCAGACACTGAATATCCTGG - Intergenic
1091338447 11:134792085-134792107 ACACCAGCTGCTGTCTCCCCCGG + Intergenic
1091809473 12:3383631-3383653 TCACCAGACACTGAATCTGCTGG + Intronic
1093158990 12:15722688-15722710 TCACCAGACACTGAATCTGCTGG - Intronic
1093378059 12:18455626-18455648 TCACCAGACACTGAATCTGCTGG - Intronic
1093967760 12:25345277-25345299 TCACCAGACACTGGATCTGCCGG + Intergenic
1094090528 12:26644407-26644429 TCACCAGACACTGAATCTGCTGG + Intronic
1095395138 12:41754232-41754254 TCACCAGGCACTGAATCTTCTGG + Intergenic
1095516103 12:43007205-43007227 CCACTAGCAACTGTATCCACAGG + Intergenic
1095864607 12:46957728-46957750 TCACCAGACACTGAATCTGCTGG + Intergenic
1095917500 12:47494962-47494984 TCAGCAGCCCCTCTATCCCAGGG + Intergenic
1095959743 12:47826750-47826772 TGACCAGCCAATATAGCCCCTGG - Intronic
1096432073 12:51553965-51553987 TCACCAGCTACATTAGCCCCTGG + Intergenic
1096883013 12:54687879-54687901 TCACCAGACACTGAATCTGCTGG + Intergenic
1096917105 12:55045198-55045220 TCACCAGACACTGAATCTACTGG - Intergenic
1097308901 12:58097488-58097510 TCACCAGACACTGAATCTGCTGG - Intergenic
1097523470 12:60699925-60699947 TCACCAGACACTGAATCTGCTGG - Intergenic
1100206063 12:92351017-92351039 TCACCAGACACTGAATCTGCTGG + Intergenic
1100843114 12:98632997-98633019 TCACCATCCATGGAATCCCCTGG + Intronic
1101733106 12:107442921-107442943 TCACCAGACACTGAATCTGCTGG - Intronic
1102963636 12:117110307-117110329 TCCCCAGCCACTGTGTCCATGGG - Intergenic
1102982260 12:117251190-117251212 TCACCAGACACTGAATCTGCTGG + Intronic
1103101376 12:118179265-118179287 TCCCCAGTCACTGCATGCCCAGG + Intronic
1104569447 12:129912249-129912271 TCACCAGCCACTGCATCTTCTGG - Intergenic
1105700959 13:22935478-22935500 TCTCCAGCTTCTGGATCCCCTGG + Intergenic
1105716832 13:23074838-23074860 TCACCAGACACTGAATCGGCTGG - Intergenic
1105819219 13:24064609-24064631 TCACCAGACACTGAATCTTCTGG + Intronic
1105829586 13:24152180-24152202 TCACCAGACACTGAATCTACAGG - Intronic
1105968122 13:25403230-25403252 TCACCAGACACTGAATCTGCAGG + Intronic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1106109545 13:26764678-26764700 TCACCAGACACTGAATCTGCTGG - Intergenic
1107084480 13:36411806-36411828 TCACCAGACACTGAATCTACAGG - Intergenic
1107084674 13:36413629-36413651 TCACCAGACACTGAATCTACAGG - Intergenic
1107999499 13:45893417-45893439 TCACCAGACACTGAACCCACTGG - Intergenic
1108568016 13:51720729-51720751 TCACCAGACACTGAATCTGCTGG - Intronic
1109128758 13:58553072-58553094 TCACTAGACATTGAATCCCCTGG - Intergenic
1109433502 13:62267891-62267913 TCATCAGCCACTGAATCTGCTGG + Intergenic
1110351623 13:74515265-74515287 TCACCAGACACTGAATCTGCTGG + Intergenic
1110884921 13:80620812-80620834 TCACCAGCAACAGAATCACCAGG + Intergenic
1112764266 13:102724052-102724074 TCACCAGACACTGAATCTGCTGG + Intergenic
1112955802 13:105056726-105056748 TCACCATCCACCCAATCCCCAGG + Intergenic
1113038695 13:106080763-106080785 TCACCAGACACTGAATCTTCTGG - Intergenic
1113223961 13:108138955-108138977 TCACCAGACACCCTATCTCCTGG - Intergenic
1114596207 14:23914295-23914317 TCACAAGGCACTGCACCCCCAGG - Intergenic
1114836602 14:26210417-26210439 TCACCAGACACTGAATCTACTGG + Intergenic
1114899028 14:27033063-27033085 TCACCAGACACTGAATCTGCAGG + Intergenic
1116139572 14:40974372-40974394 TTACCAGACACTGAATCCTCAGG - Intergenic
1116800359 14:49437181-49437203 TCACCAGACACTGAATCTGCTGG + Intergenic
1116809332 14:49524243-49524265 TCCCCAGACACTGAATCTCCTGG + Intergenic
1117305207 14:54467308-54467330 TCACCAGTCACTGGATCTGCTGG + Intergenic
1117831159 14:59752270-59752292 TCACCAGACACTAAATCCACTGG - Intronic
1118348707 14:64958427-64958449 TCACCAGACACTGAATCTGCTGG + Intronic
1119133732 14:72197517-72197539 TCCCTACCCACTGTAGCCCCAGG - Intronic
1119680075 14:76585564-76585586 TCACCAGACACTGAATCCACTGG - Intergenic
1119894707 14:78210208-78210230 TCACCAGACACTGAATCTGCTGG - Intergenic
1120398239 14:83995467-83995489 TCACCAGACACTGGATCTGCTGG + Intergenic
1120668535 14:87336395-87336417 TCACCAGACACTGAATCAGCTGG + Intergenic
1121069924 14:91009334-91009356 TCACCAGACACTGAACCTCCTGG + Intronic
1121321369 14:92993584-92993606 TCTCCAGCCACTGTGTTACCGGG + Intronic
1121813811 14:96913961-96913983 TCACCAGGCACTGAATCTGCTGG + Intronic
1122167590 14:99840545-99840567 TCACCAGCCGCTGTATGTCAGGG - Intronic
1122260134 14:100513394-100513416 TCACCAGACACTGAATCTGCTGG + Intronic
1122275315 14:100587858-100587880 TCACTCGCTACTGTACCCCCTGG - Intergenic
1122285575 14:100650105-100650127 TCACCAGACACTGAATCTGCTGG + Intergenic
1122877028 14:104672262-104672284 TCCCCAGCCCCTGTACCCCCAGG - Intergenic
1123185329 14:106511303-106511325 TCACCAGCTACTATATGCACTGG - Intergenic
1123220519 14:106851299-106851321 TTACCAGCTACTGGATCCACTGG - Intergenic
1123398920 15:19964854-19964876 TCACCAGCTACTGTATGCACTGG - Intergenic
1124047387 15:26162805-26162827 TCACCAGACACTGAATCTGCTGG - Intergenic
1125260921 15:37823832-37823854 TCACCAGACACTGAATCTACTGG + Intergenic
1126183344 15:45807557-45807579 TCACCAGACACTGGATCTGCTGG - Intergenic
1126910963 15:53416402-53416424 TCACCAGACACTGAATCTGCAGG + Intergenic
1127733237 15:61819126-61819148 TCACCAGACACTGAATCTGCTGG + Intergenic
1127890582 15:63247094-63247116 TCACTAGACACTGTATCTGCTGG - Intronic
1128370541 15:67036032-67036054 CCCCCAGCCACAGTCTCCCCAGG + Intergenic
1128500974 15:68227585-68227607 CCACCAGCCAGGGTATTCCCAGG - Intronic
1128527607 15:68423158-68423180 TAATTAGCCACTGTATCCCCGGG - Intronic
1129163540 15:73761620-73761642 TCACCAGACACTGAATCTGCTGG + Intergenic
1129344859 15:74910780-74910802 TCAGAAGCCACTGTCTCACCAGG + Intergenic
1129380271 15:75160642-75160664 TCACCAGACACTGAATCTTCTGG - Intergenic
1129515022 15:76152115-76152137 TCACCAGCCACTGTATCCCCTGG + Intronic
1129971423 15:79780869-79780891 TCCCCAGGCACTGTGTCCCAGGG - Intergenic
1130230532 15:82093426-82093448 TCACCAGACACTGAATCTGCTGG - Intergenic
1131258058 15:90874305-90874327 TCAGCAGCCAGTGTTTGCCCTGG + Intronic
1132539118 16:500034-500056 CCAGCAGCCATTGTAGCCCCCGG + Intronic
1132598452 16:763620-763642 TCAGCAGGCCCTGTGTCCCCAGG + Exonic
1133022853 16:2974488-2974510 TGGCCAGCCACTATCTCCCCAGG + Intronic
1133270857 16:4610226-4610248 CCATCAGCCACAGCATCCCCGGG + Intronic
1133436536 16:5784850-5784872 TCACCAGACACTGAATCTCCCGG + Intergenic
1134437022 16:14269008-14269030 TCACCAGACACTGAATCTGCTGG - Intergenic
1134503959 16:14790569-14790591 TCACCAGGCACTGAATCTGCAGG + Intronic
1134576613 16:15338339-15338361 TCACCAGGCACTGAATCTGCAGG - Intergenic
1134725826 16:16418160-16418182 TCACCAGGCACTGAATCTGCAGG + Intergenic
1134941607 16:18293699-18293721 TCACCAGGCACTGAATCTGCAGG - Intergenic
1135059876 16:19262370-19262392 TCACCAGACACTGAATCTGCTGG + Intronic
1135961869 16:27001659-27001681 TCACCAGACACTGGATCTCCTGG - Intergenic
1136610203 16:31361535-31361557 CCACCAGCCACTCACTCCCCTGG + Intronic
1137479036 16:48835974-48835996 TCACCAGACACTGAATCTACTGG + Intergenic
1138007491 16:53351498-53351520 TCACTAGACACTGTATCTGCTGG - Intergenic
1138120121 16:54393985-54394007 TCACCAGACACTGAATCTACTGG + Intergenic
1138313331 16:56046975-56046997 TCTCCCACCATTGTATCCCCTGG - Intergenic
1139128407 16:64109838-64109860 TCACCAGACACTGAATCAGCTGG + Intergenic
1139154745 16:64427131-64427153 TCACCAGACACTGAATCTGCTGG - Intergenic
1140032559 16:71350140-71350162 TCACCAGACACTGGATCTGCTGG - Intergenic
1141051450 16:80768492-80768514 TCACCAGACCCTGAATCCACTGG - Intronic
1141239846 16:82255477-82255499 TCACATGTCACGGTATCCCCAGG - Intergenic
1141532855 16:84658716-84658738 TCTCCAGCCACTCGGTCCCCGGG + Intronic
1142399727 16:89852563-89852585 TCCCCACCCCCTGGATCCCCTGG + Intronic
1142568595 17:857159-857181 TCACCAGACACTGAGTCCACTGG - Intronic
1143655445 17:8291048-8291070 TTACCAGCATCTGTGTCCCCAGG - Intronic
1144060724 17:11581671-11581693 TCATCAGACACTGAATCTCCTGG - Intergenic
1144135884 17:12294137-12294159 TCTCCAGCCCCTAGATCCCCAGG - Intergenic
1144315629 17:14058519-14058541 TTACTAGCCACTGTATCCTTGGG + Intergenic
1144358575 17:14469668-14469690 TCACCAGGCACTGAATCTGCTGG - Intergenic
1145102552 17:20088967-20088989 TCACCAGACACTGAATCTGCTGG + Intronic
1145817743 17:27807754-27807776 TCACTCACCACTGGATCCCCAGG - Intronic
1146269006 17:31472317-31472339 GAACCAGCCACTCTCTCCCCAGG - Intronic
1146893443 17:36524025-36524047 TGAGCAGCCACTGTAGCCCTGGG - Intronic
1148555703 17:48577600-48577622 TCACCAGCGACTTTTTCGCCAGG - Intronic
1148690212 17:49522809-49522831 TCACCTGCCACTCTCTCCTCTGG - Intergenic
1149335729 17:55633827-55633849 TCACCAGACACCGAATCCGCTGG - Intergenic
1149357380 17:55855462-55855484 TCACCAGCCACTGAATCTGCTGG - Intergenic
1149888417 17:60364101-60364123 TCACCAGACACTGAATCTGCTGG - Intronic
1150556489 17:66259392-66259414 TCACCAGACACTGAATCTGCAGG + Intergenic
1150600658 17:66648055-66648077 TCACCAGACACTGAATCTGCTGG - Intronic
1150951072 17:69802526-69802548 TCACGTGCCACTGCATTCCCCGG + Intergenic
1151624907 17:75270725-75270747 ACACCCGCCGCTGCATCCCCCGG + Intronic
1151716953 17:75835851-75835873 TCACCAGCCACTGCAGCTCCCGG + Exonic
1152061706 17:78081069-78081091 TCACCAGACACTGAATCTTCTGG - Intronic
1152449006 17:80364505-80364527 TCACCAGCCCCTGTAACTCGGGG - Exonic
1152473919 17:80505282-80505304 TCTCCAGACACTGTGTCCCTAGG - Intergenic
1153664015 18:7351991-7352013 TCACCAGAGACTGAATCCGCTGG + Intergenic
1154063730 18:11087170-11087192 TCACCAGACACTGAATCGGCTGG + Intronic
1155838985 18:30624847-30624869 TCACCAGACACTGAATCTGCAGG + Intergenic
1156226332 18:35112898-35112920 TCACCAGACACTGAATCTGCTGG - Intronic
1156931439 18:42649582-42649604 TCACCAGACACTGAATCTGCCGG - Intergenic
1157304062 18:46503855-46503877 TCACCAGCCACTGTGTCAGGTGG - Intronic
1157546818 18:48552480-48552502 TCACCAGACACTGAATCTGCTGG - Intronic
1158891728 18:61878661-61878683 TCACTAGACACTGAATCCACTGG - Intronic
1158965479 18:62618814-62618836 CCACCAGCCACAGCATCACCTGG + Intergenic
1159358203 18:67364375-67364397 TCACCAGACACTCAATCCGCAGG - Intergenic
1159560428 18:69986981-69987003 TCACCAGACACTGAATCTGCTGG - Intergenic
1159809445 18:72999063-72999085 TCACCAGCCCCTGAATCTGCTGG - Intergenic
1160221767 18:76983372-76983394 TCACCTGCCTCTGAATCGCCTGG - Intronic
1160719846 19:592298-592320 ACACCAGCCACTCCCTCCCCTGG + Intronic
1160857539 19:1224191-1224213 CCCCCAGACACTGTACCCCCCGG - Intronic
1160888437 19:1363555-1363577 GCACCAGCCTCTGTATGTCCCGG - Intronic
1161573133 19:5041130-5041152 TCACCAGGTACTGTACCCCGCGG + Exonic
1162877949 19:13634827-13634849 TCACCAGACACTGAATCTGCTGG + Intergenic
1163239744 19:16053522-16053544 TCACCAGACACTGAATCTGCTGG - Intergenic
1163296999 19:16418849-16418871 TCACCAGACACTGGATCTGCTGG + Intronic
1164592935 19:29516101-29516123 TCACCAGCCACAGAAAGCCCTGG - Intergenic
1165341328 19:35214286-35214308 ACACCAGCCACTGTGGGCCCTGG + Intergenic
1166118961 19:40673565-40673587 ACACCAGCCACCACATCCCCTGG - Exonic
1166608195 19:44164496-44164518 TCACCAGACACTGAATCTGCTGG - Intergenic
1167786275 19:51639544-51639566 TCTCCAGACACTGAATCCGCTGG - Intronic
1168476248 19:56677506-56677528 TCACCAGACACCGAATCTCCTGG - Intergenic
925151373 2:1617778-1617800 TCCCCAGGCACCGTCTCCCCAGG + Intergenic
925527581 2:4819924-4819946 TCACCAGACACTGAATCCGCAGG + Intergenic
926801522 2:16664719-16664741 TCACCAGTCACTATCTCCTCTGG - Intronic
928306053 2:30171300-30171322 TCACCAGACACTGAATCTGCTGG - Intergenic
929584534 2:43105481-43105503 TCACCAGACACTGAATCTGCCGG + Intergenic
930871800 2:56178634-56178656 TCACCAGACACTGAATCTACTGG - Intergenic
933157098 2:78988448-78988470 TCACCAGGCACTGGATCTGCCGG + Intergenic
933293806 2:80467850-80467872 TCACCAGACACTGAATCTGCTGG + Intronic
935708343 2:105875684-105875706 TCACCAGACACCGAATCTCCTGG + Intronic
935983587 2:108651098-108651120 TCACCAGCTCCTGAAACCCCGGG + Intronic
936049186 2:109210486-109210508 ACTCCAGCCACTGTCTCCCTGGG - Intronic
936136026 2:109894763-109894785 TCACCAGCTCCTGAAACCCCGGG + Intergenic
936208671 2:110476722-110476744 TCACCAGCTCCTGAAACCCCGGG - Intergenic
937278410 2:120701284-120701306 TCCCCCGCCACTGTCACCCCAGG - Intergenic
938318727 2:130347724-130347746 TCACCAGACACTGAATCTGCTGG + Intronic
938612276 2:132960024-132960046 TACCCAGCCACTGCTTCCCCTGG - Intronic
938836903 2:135113252-135113274 TCACCAGCCAGTGTTTCCCAAGG - Exonic
939114995 2:138050357-138050379 TCACCAGACACTGCATCTTCTGG - Intergenic
939350687 2:141033760-141033782 TCACCAGACACTGAATCTGCTGG + Intronic
939566953 2:143796376-143796398 TCACCAGCCACTGAATCTGCTGG + Intergenic
939925946 2:148173264-148173286 CCACGAGCCACTGTGTTCCCAGG + Intronic
940115384 2:150202909-150202931 TCACCAGACACTGAATCTGCTGG + Intergenic
941000505 2:160197731-160197753 TGGCCAGCCACTGTTTCCCTTGG - Intronic
941688842 2:168477061-168477083 TCACCAGACACTGCATCTGCTGG - Intronic
942014595 2:171799124-171799146 TCACCAGACACTGAATCTGCTGG + Intronic
943313869 2:186361138-186361160 TCACCAGACACTGAATCTGCAGG + Intergenic
943781521 2:191829358-191829380 TCACCAGACACTGAATCTGCTGG + Intergenic
943834027 2:192496140-192496162 TCACCAGGCACTGAATCTGCTGG + Intergenic
944636467 2:201680334-201680356 TCGCCAGACACTGCATCCACTGG - Intronic
945763384 2:213943056-213943078 TCACCAGGCACTGGATCTTCTGG + Intronic
946866748 2:224047717-224047739 TCACCAGGCACTGGATCTGCTGG + Intergenic
1169833322 20:9849942-9849964 TCACCAGACACTGAATCTGCTGG + Intergenic
1170409360 20:16072119-16072141 CCAGCAGCCACAGCATCCCCTGG + Intergenic
1170443143 20:16398766-16398788 TCATCACCCACTCTATCCCTTGG - Intronic
1170561974 20:17566559-17566581 TCACCAGACACTGAATCTGCTGG - Intronic
1171381773 20:24738817-24738839 TCACCAGCCCCTGAATCTGCTGG + Intergenic
1172308163 20:33896565-33896587 TCACCAGACACTGAATCTGCTGG + Intergenic
1174373864 20:50112780-50112802 TCGCCAGCCCCGGTATCCTCAGG + Intronic
1175114300 20:56671332-56671354 TCACCAGGCACTGTCTCTCTGGG + Intergenic
1175142509 20:56871554-56871576 TCTCCAGCCCCTGAGTCCCCAGG - Intergenic
1175772092 20:61630336-61630358 ACACCAGCCACTGGGGCCCCAGG + Intronic
1175782079 20:61689294-61689316 TCACCAACCACTGTCCCCTCCGG - Intronic
1175782110 20:61689438-61689460 TCACCAACCACTGTCCCCGCCGG - Intronic
1175782141 20:61689582-61689604 TCACCAACCACTGTCCCCGCCGG - Intronic
1175782257 20:61690161-61690183 TCACCAACCACTGTCCCCACTGG - Intronic
1175994631 20:62806637-62806659 CGGTCAGCCACTGTATCCCCTGG - Intronic
1176745598 21:10649588-10649610 TCACCAGCTACTGTATGCACTGG - Intergenic
1177141815 21:17365852-17365874 TCACCAGACACTGAATCTGCTGG + Intergenic
1177167161 21:17615240-17615262 TCACCAGACACTGGATCTGCTGG + Intergenic
1177734933 21:25077125-25077147 TCACCAGACACTGAATCTGCTGG - Intergenic
1177898527 21:26884306-26884328 TCACCAGATACTGAATCTCCCGG + Intergenic
1178071413 21:28972212-28972234 TCACCAGACACTGAATCTGCTGG + Intronic
1178303346 21:31470780-31470802 GAAACAGCCACTGTCTCCCCAGG + Intronic
1178465586 21:32844492-32844514 GCATGAGCCTCTGTATCCCCTGG + Intergenic
1178519945 21:33281026-33281048 TCACCAGACACTGAATCTGCTGG - Intronic
1179149827 21:38800254-38800276 TCACCAGACACTGAATCTGCTGG + Intergenic
1179335217 21:40445027-40445049 TCACCAGACACAGAATCTCCTGG - Intronic
1180625176 22:17189543-17189565 TCACCAGCCCCTGTAGCACGCGG - Intronic
1180843272 22:18969103-18969125 CCCCCAGCCACTCTGTCCCCTGG - Intergenic
1181058198 22:20269632-20269654 CCCCCAGCCACTCTGTCCCCTGG + Intronic
1181111656 22:20606134-20606156 TCACATGCCACTGGCTCCCCTGG - Intergenic
1181591270 22:23886457-23886479 TCAACAGACACTGAATCCACTGG - Intronic
1183888661 22:40906852-40906874 TCACCAGACACTGAATCTGCTGG - Intronic
1184528427 22:45039412-45039434 TCACCAGACACTGAATCTGCTGG - Intergenic
949602960 3:5621194-5621216 TCACCAGACACTGAATCTACTGG - Intergenic
949714714 3:6916546-6916568 TCACCAGACACTGAATCTGCTGG - Intronic
950704443 3:14771215-14771237 TCACCAGGCACTGAATCTGCAGG + Intronic
950842422 3:15980198-15980220 TCACCAGTCACTGAATCTGCTGG - Intergenic
951391095 3:22104873-22104895 GCAGCAGTCACTGTATTCCCTGG - Intronic
952234035 3:31460745-31460767 TCACCAGTCACTGAATCTGCAGG - Intergenic
952789151 3:37185313-37185335 TCACCAGACACTGAATCTGCTGG + Intergenic
953408403 3:42672244-42672266 TCACCAGATACTGAATCTCCTGG + Intergenic
954769403 3:52952599-52952621 TCACCAGATTCTGAATCCCCTGG - Intronic
955417111 3:58702816-58702838 TCACCAGACACTGAATCTGCTGG - Intergenic
957219267 3:77361560-77361582 TCACCAGACACTGAATCTGCTGG - Intronic
958180086 3:90048933-90048955 TCACCAGACACTGAATCTGCTGG - Intergenic
959018069 3:101158470-101158492 TCACCAGGCACTGAATCTGCTGG + Intergenic
959019507 3:101173128-101173150 TCACCAGACACTGAATCTGCTGG - Intergenic
959141713 3:102493785-102493807 TCACCAGACACTGAATCTGCAGG + Intergenic
959979842 3:112503677-112503699 TCACCAGATACTGTATCTGCTGG + Intergenic
960143427 3:114173187-114173209 TCACCAGACACTGAATCTTCTGG + Intronic
960593297 3:119386350-119386372 TCACCAGACACTGAATCTACCGG - Intronic
960635086 3:119777059-119777081 TCACCAGTCACTGAATCTGCTGG - Intergenic
961404333 3:126667843-126667865 GCACCAGCCCCTGTAACTCCAGG + Intergenic
961607931 3:128111343-128111365 GCACTGACCACTGTATCCCCAGG + Intronic
962128480 3:132647852-132647874 TCACCAGACACTGAATCTGCTGG - Intronic
963146470 3:142000289-142000311 TCACCAGGCACTGAATCTGCCGG - Intronic
963734729 3:149007065-149007087 TCTCCAGCCACTGAATCTGCTGG - Intronic
964291990 3:155191522-155191544 TCACCAGACACTGAATCTACTGG + Intergenic
964359281 3:155877720-155877742 TCACCAGGCACTGAATCTGCAGG - Intronic
964548276 3:157859009-157859031 TGACCACCAACTGTGTCCCCAGG + Intergenic
966170624 3:177076058-177076080 TCACTAGGCACTGTATCTGCTGG - Intronic
966493540 3:180555128-180555150 TCACCAGACACTGAATCTGCTGG - Intergenic
966792817 3:183689456-183689478 TCACCAGACACTGAATCTGCTGG - Intergenic
967013936 3:185464814-185464836 TCACCAGACACTGAATCTGCTGG - Intronic
967168872 3:186808276-186808298 TCACCAGCCACTGAATCTTATGG - Intergenic
967785217 3:193485839-193485861 TCACCAGACACTGAATCTGCTGG + Intronic
968589116 4:1448959-1448981 TCACCAGACCCTGCAACCCCAGG - Intergenic
969197209 4:5572554-5572576 TCACCAGACACTGCATCTGCAGG + Intronic
969283482 4:6187630-6187652 TCACCAGACACTGAATCTGCCGG + Intronic
969625965 4:8305927-8305949 TCACCACCCACCGCCTCCCCAGG - Intronic
969951950 4:10846155-10846177 TCACCAGACACTGAATCTGCTGG + Intergenic
969965244 4:10987235-10987257 TCACCAGACACTGAATCTGCTGG + Intergenic
970478100 4:16444843-16444865 TCACCAGACACTGAATCTGCTGG + Intergenic
970765238 4:19540545-19540567 TCACCCACCACTGTATCTTCGGG - Intergenic
970968817 4:21957836-21957858 TCACCAGACACTGGATCTGCTGG + Intergenic
971325403 4:25639388-25639410 TCAGCAGCCACTGTGTCCTGTGG + Intergenic
971409166 4:26352236-26352258 TCACCAGACACTGAATCTTCTGG - Intronic
971459691 4:26881553-26881575 TCACCAGACACTGAATCTGCTGG + Intronic
971480550 4:27110801-27110823 TCACCAAACACTGAATCTCCTGG + Intergenic
971711061 4:30113174-30113196 TCACCAGACACTGTAGCTACTGG - Intergenic
971993206 4:33928628-33928650 TCACCAGACACTGAATCTGCTGG + Intergenic
972732993 4:41813634-41813656 TCACCAGACACTGAATCTGCTGG - Intergenic
973199934 4:47488936-47488958 TCACCAGACACAGTATCTGCTGG + Intronic
973815945 4:54619077-54619099 TCACCAGACACTGAATCCTCTGG + Intergenic
974014287 4:56634781-56634803 CCACCATCCACTTTGTCCCCTGG + Intergenic
975975942 4:80097053-80097075 TCACCAGGCACTGAATCTGCTGG - Intronic
976426014 4:84904156-84904178 TCACCAGACACTGAATCTGCTGG + Intronic
976839785 4:89418725-89418747 TCGCCAGCCACTGAATCTGCTGG - Intergenic
977392905 4:96435403-96435425 TCACCAGACACTGAATCTGCTGG + Intergenic
977586470 4:98780425-98780447 TCAGCAGTGACTGTATCCCTTGG + Intergenic
977933643 4:102776300-102776322 TCACCACCCACTGAATCTGCTGG - Intergenic
978867421 4:113530727-113530749 TCACCAGACACCGAATCTCCTGG + Intronic
979026270 4:115581313-115581335 TCACCAGACACTGAATTCGCTGG + Intergenic
979638940 4:122989573-122989595 GAACCAGCCACTGTAGACCCAGG - Intronic
979748365 4:124244867-124244889 TTACCAGACACTGAATCTCCTGG + Intergenic
980380172 4:132003601-132003623 TCACCAGACACTGAATCTGCTGG - Intergenic
981275000 4:142888798-142888820 TCACCAGACACTGAATCTGCCGG + Intergenic
982419793 4:155181687-155181709 TCACCAGACACTGAATCTGCTGG + Intergenic
982508325 4:156248954-156248976 TCACCAGACACTGAATCTGCTGG - Intergenic
982673295 4:158347917-158347939 TCACCAGACACCAAATCCCCTGG + Intronic
982951201 4:161698204-161698226 TCACCAGACACTGAATCTGCTGG + Intronic
983984759 4:174045122-174045144 TCACCAGACACTGAATCTGCTGG - Intergenic
984600358 4:181719464-181719486 TCACCAGACACTGAATCGGCTGG - Intergenic
985364606 4:189215114-189215136 TCACTCACCAATGTATCCCCAGG - Intergenic
986674538 5:10171455-10171477 TCACCAGACACTGAATCTGCTGG + Intergenic
987070228 5:14329486-14329508 TCACCAGTCACTGAGTCTCCTGG + Intronic
987702673 5:21421913-21421935 TCACCAGACACTGAATCTTCTGG - Intergenic
988151085 5:27381356-27381378 CCACCAGGCACTGAATCCACTGG + Intergenic
989517908 5:42364632-42364654 TCACCAGACACTGGATCTGCTGG + Intergenic
990377211 5:55183511-55183533 TCACCAGACACTGAATCTGCTGG - Intergenic
990434360 5:55773115-55773137 TCACCAGACACTGAATCTGCTGG - Intronic
991159188 5:63476878-63476900 TCATCATCCAGTGTATCACCAGG + Intergenic
992179059 5:74179100-74179122 GCACAAAGCACTGTATCCCCAGG + Intergenic
992181868 5:74205363-74205385 TCACCAGACACTGTATCTGCTGG + Intergenic
992940336 5:81754412-81754434 GCATCAGCAACTGTATCTCCTGG + Intergenic
993664946 5:90684599-90684621 TCACCAGGCACTGAATCTGCTGG - Intronic
993756059 5:91731773-91731795 TCACTAGACACTGTATCTGCTGG + Intergenic
994163278 5:96580995-96581017 TCACCAACCACTGAATCTGCTGG + Intronic
994716461 5:103327675-103327697 TCACCAGACACTGGATCTGCTGG + Intergenic
995220965 5:109647475-109647497 ACACCAGCCACTGCTGCCCCCGG + Intergenic
996421799 5:123270695-123270717 TTGCCAGCCACTCTATCCCTAGG - Intergenic
996611337 5:125383504-125383526 TCACCAGACACTGAACCCGCTGG + Intergenic
997120339 5:131166636-131166658 CCAGCAGCAACTGTATCACCTGG - Intronic
999208235 5:149865484-149865506 GCATCAGCCACTGTGTCCCGTGG + Intronic
999777183 5:154820764-154820786 TCACCAGCATCAGAATCCCCTGG + Intronic
999831455 5:155324090-155324112 TCACCAGACACTGAATCTGCTGG + Intergenic
1000047284 5:157532140-157532162 TCTCCAGCCACTGTGTCTCATGG + Intronic
1000609048 5:163355489-163355511 TCACCAGACACTGAATCTGCTGG + Intergenic
1001021756 5:168189008-168189030 TCACCAGACACTGAATCTGCTGG - Intronic
1001446860 5:171792058-171792080 TCACCAGACACTGAATCTGCTGG + Intronic
1001783481 5:174391092-174391114 CCACCAGCCACTGTTGCTCCTGG - Intergenic
1002281944 5:178136016-178136038 TCACAGGCCACTGTTTCACCAGG - Intronic
1003527771 6:6912194-6912216 TCACCAGACACTGCATCTGCCGG + Intergenic
1004667352 6:17760876-17760898 TCACCAGCCTCTGCATTCCAGGG - Intronic
1006094321 6:31646468-31646490 TCTCCAGCCGCTGTAGCTCCTGG + Exonic
1006330490 6:33386840-33386862 TCACCAGACACTGTACCTGCCGG + Intergenic
1007036066 6:38674880-38674902 TCACCAGACACTGGATCTGCTGG + Intergenic
1008869994 6:56261563-56261585 TCACCAGACACTGCATCTACAGG + Intronic
1008939837 6:57034704-57034726 TCACCAGACACTGAATCTGCTGG + Intergenic
1010056117 6:71567128-71567150 TCACCAGCCACTAAATCTGCTGG + Intergenic
1010470171 6:76217814-76217836 TCACCAGACACTGAATCTGCTGG - Intergenic
1010986978 6:82435762-82435784 TCACCAGACACTGAATCTGCTGG + Intergenic
1011805467 6:91067922-91067944 TCACCAGACACTGAATCTGCTGG + Intergenic
1012054531 6:94388910-94388932 TCACCAGACACTGAATCTACTGG - Intergenic
1012357477 6:98333574-98333596 TCACCAGACACTGAATCTGCTGG - Intergenic
1012986012 6:105877187-105877209 TCACCAGACACTGAATCTGCTGG - Intergenic
1013805229 6:113989357-113989379 TCACCAGACACTGAATCTGCTGG - Intronic
1013957854 6:115861336-115861358 TCACCAGACACTGAATCAGCTGG - Intergenic
1014182506 6:118400653-118400675 ACACCAATCACTATATCCCCAGG + Intergenic
1014774909 6:125497477-125497499 TCACCAGACACTGAATCTGCTGG + Intergenic
1015500523 6:133927962-133927984 TCACCAGGCACTGGATCTGCTGG + Intergenic
1015758008 6:136627707-136627729 TCACCAGACACTGAATCTGCTGG + Intronic
1016165354 6:140935439-140935461 TCAGCAGACACTGAATCCACTGG - Intergenic
1016301082 6:142632618-142632640 TCACCAGACACTGAATCTGCCGG + Intergenic
1017515260 6:155150709-155150731 TCACCAGACACTGAATCTGCCGG - Intronic
1017594042 6:156009737-156009759 TTACCAGCCACTGAAACCACTGG + Intergenic
1017772010 6:157650995-157651017 ACACCTGCCACTGCAGCCCCAGG + Intronic
1017792890 6:157817079-157817101 TCACCAGACACTGAATCTGCTGG + Intronic
1018791367 6:167150583-167150605 TCACCAGACACTGGATCTGCTGG + Intronic
1018909688 6:168094912-168094934 TCACCAGGGACTGGAGCCCCAGG + Intergenic
1019006272 6:168799253-168799275 CCACCTGCCCCTCTATCCCCCGG + Intergenic
1019175322 6:170156642-170156664 TCACCTGCCCCTTCATCCCCGGG + Intergenic
1020220617 7:6233865-6233887 TCACCACACACTGAATCCGCCGG - Intronic
1020356541 7:7282013-7282035 TTACCAGACACTGTATCTGCTGG - Intergenic
1020412729 7:7911301-7911323 TCACCAGACACTGAATCTGCTGG - Intronic
1021477467 7:21078855-21078877 TCACCAGACACTGAATCTGCTGG + Intergenic
1022309979 7:29187771-29187793 TCAACATCCACTCTCTCCCCAGG + Intronic
1023416088 7:39934168-39934190 TCACCAGACACTGCATCTGCTGG + Intergenic
1024283716 7:47739399-47739421 TCAGGTGCCTCTGTATCCCCAGG + Intronic
1024297064 7:47852914-47852936 GCACCAGCCACTGCATCACAAGG + Intronic
1024481987 7:49873275-49873297 TCACCAGGCACTGAATCTGCAGG - Intronic
1024595110 7:50926278-50926300 TCACCAGACACTGAATCTGCTGG - Intergenic
1024952226 7:54876376-54876398 TCACCAGACACTCTATCTCCTGG + Intergenic
1027457926 7:78416873-78416895 TCACCAGACACTGAATCTGCTGG + Intronic
1027756098 7:82213960-82213982 TCTCCAGACACTGAATCTCCTGG - Intronic
1028572543 7:92306641-92306663 TTACCAGACACTGAATCACCTGG + Intronic
1028629075 7:92913903-92913925 TCACCAGACACTGAATCTGCTGG + Intergenic
1028777067 7:94689279-94689301 TCACCAGACACTGAATCTGCTGG - Intergenic
1029804421 7:102981635-102981657 TCACCAGACACTGAATCTGCTGG - Intronic
1030649577 7:112102672-112102694 TCACCAGACACTGAATCTACTGG + Intronic
1031206472 7:118764478-118764500 TCACCAGACACTGTATCTGCTGG - Intergenic
1031559489 7:123220961-123220983 TCACCAGACACTGGATCTCCTGG + Intergenic
1032085643 7:128882081-128882103 TCCCCATGCACTGTGTCCCCAGG + Intronic
1033611703 7:142969364-142969386 TCACGAGGAACTGTTTCCCCAGG - Intergenic
1033773568 7:144581203-144581225 TCACCAGACACTGAATCTACTGG + Intronic
1034054628 7:148021630-148021652 TCACCGGGGACTGGATCCCCAGG - Intronic
1034716456 7:153247112-153247134 TCACCAGACACTGAATCTGCTGG + Intergenic
1035003695 7:155638880-155638902 TCACCAGACACTGAATCTGCTGG - Intronic
1035997485 8:4564434-4564456 TCACCAGACACTAGATCCCCTGG - Intronic
1036161783 8:6395790-6395812 TCACCAGACACTGAATCTGCTGG - Intergenic
1036439197 8:8765413-8765435 TCATCAGACACTGTATCTGCTGG - Intergenic
1036571499 8:9983515-9983537 TCACCAGACACTGGATCTGCGGG + Intergenic
1037749627 8:21672772-21672794 TCACCAGCCATTCAATCTCCTGG - Intergenic
1038311451 8:26449199-26449221 TCTCCAGCCACAGGATTCCCCGG + Intronic
1038394313 8:27235837-27235859 TCACCAGACACTGAATCTGCTGG + Exonic
1038532239 8:28327873-28327895 TCACCAGACACTGAATCTGCAGG - Intronic
1039137487 8:34341921-34341943 TCACCAGACACTGGATCTGCTGG + Intergenic
1039877848 8:41602822-41602844 TCACCAGACACTGAATCTGCTGG - Intronic
1040086940 8:43353337-43353359 TCACCAGACACTGAATCTTCTGG - Intergenic
1040476037 8:47778555-47778577 GCATCAGCCACTGGATCCTCGGG - Exonic
1041117380 8:54553351-54553373 TCACTAGACACTGTATCTTCTGG - Intergenic
1041257619 8:55992751-55992773 TCGCCAGGCACTGTATCTACTGG - Intronic
1041544412 8:59025717-59025739 TCTCCAGCTCCTGTTTCCCCAGG + Intronic
1042191181 8:66188875-66188897 TCGCCAGACACTGGATCCACTGG + Intergenic
1042210164 8:66372123-66372145 TCACCAGACACTGAATCTGCTGG - Intergenic
1042990273 8:74631760-74631782 TCACCAGACACTGAATCTGCTGG - Intronic
1043011638 8:74888439-74888461 TCACCAGACACTGAATCTGCTGG - Intergenic
1043715633 8:83482025-83482047 TCACCAGACACTGGATCTGCTGG + Intergenic
1044620457 8:94186412-94186434 TCACCAGACACTGAATCTGCTGG - Intronic
1046863736 8:119123247-119123269 TCACCAGACACCGTATCTTCTGG - Intergenic
1047105488 8:121726585-121726607 TCACCAGTCACTGAACCCACTGG - Intergenic
1048039914 8:130717235-130717257 TCACCAGACACTGAATCTGCAGG + Intergenic
1048110821 8:131466251-131466273 TCACCAGCCACATTCTCCCGGGG - Intergenic
1048164206 8:132048085-132048107 TCACCAGACACTGAATCATCTGG + Intronic
1048571446 8:135660324-135660346 TCAGCAGACACTGTATCTGCCGG - Intergenic
1048929032 8:139296252-139296274 TCACCAGACACTGAATCTGCTGG + Intergenic
1049153520 8:141052355-141052377 TCACCAGACACTGGATCCACTGG + Intergenic
1050093650 9:2041363-2041385 TCACCAGACACTGAATCTGCTGG - Intronic
1050755404 9:8996619-8996641 TCACCAGACACTGAATCTGCTGG - Intronic
1056993476 9:91432106-91432128 TCACCTGCCCCGGTAGCCCCTGG - Intergenic
1057026721 9:91739719-91739741 TCACCAGCCATTGTTTCCTTGGG + Intronic
1057801701 9:98195083-98195105 TCCCCAGCCACAGCAACCCCAGG - Intergenic
1057811528 9:98260770-98260792 TCACCAGACACTGAATCTGCTGG - Intergenic
1058881321 9:109288228-109288250 TCACCAGTCACTGAATCTACTGG + Intronic
1059277163 9:113106854-113106876 TCACCAGGCACTGAATCCTCAGG + Intergenic
1059279088 9:113117697-113117719 TCACCAGGCACTGAATCCTCAGG - Intergenic
1059507707 9:114814703-114814725 TCACCAGACACTGAATCTGCTGG - Intergenic
1060078893 9:120622314-120622336 TCACCAGCCATTGTCTTTCCAGG - Intronic
1060081074 9:120645897-120645919 CTACCACCCACTGTATCCCATGG - Intronic
1060937438 9:127523846-127523868 TCATCAGGCACTGTCTCCACAGG - Exonic
1060966641 9:127715540-127715562 TCACCATCCACCGCTTCCCCGGG + Exonic
1061543431 9:131290350-131290372 TCACGGGCCACGGCATCCCCTGG + Exonic
1062294046 9:135814380-135814402 TCACAAGCCGTTGTATCCCAAGG + Intronic
1062445709 9:136593336-136593358 TCCCCAGCCCCAGTATACCCTGG + Intergenic
1185970886 X:4662359-4662381 TCACCAGGCACTGAATCTGCTGG - Intergenic
1186160869 X:6775848-6775870 TCACCAGGCACTGGATCTGCTGG + Intergenic
1186236354 X:7515234-7515256 TCACCATCAACTGTGTCCCCTGG + Intergenic
1186700857 X:12088217-12088239 TCACCAGCCACAGAATCTCCTGG - Intergenic
1186987062 X:15028543-15028565 TCACCAGACACTGAATCTGCTGG + Intergenic
1187221756 X:17334045-17334067 TCACCAGACACTGAATCTTCTGG - Intergenic
1187280674 X:17856482-17856504 TCACCAGACACTGAATCTGCCGG + Intronic
1188391775 X:29630107-29630129 TCACCAGACACTGAATCTGCTGG - Intronic
1189124764 X:38434743-38434765 TCACCAGACACTGAATCTGCTGG - Intronic
1189256871 X:39646701-39646723 TCACCAGACACTGAATCTTCTGG + Intergenic
1189636893 X:43020567-43020589 TCACCAGACACTGAATCTGCTGG + Intergenic
1189719005 X:43895780-43895802 TCACCAGACACTGAACCTCCTGG + Intergenic
1189774477 X:44458097-44458119 TCACCAGACACTGAATCTGCTGG - Intergenic
1190597007 X:52060892-52060914 GCCCCAGCCTCTGTTTCCCCAGG - Intergenic
1190611817 X:52193181-52193203 GCCCCAGCCTCTGTTTCCCCAGG + Intergenic
1191663283 X:63672205-63672227 TCACCAGGCACTGAATCTACTGG + Intronic
1192272183 X:69591382-69591404 TCACCAGACACTGAATCTGCTGG + Intergenic
1192705077 X:73520726-73520748 TCACCAGGCACTGAATCTGCTGG - Intergenic
1194621402 X:96176988-96177010 GCTCCAGCCACTGTGTCCCTTGG - Intergenic
1195430331 X:104782044-104782066 TCACCAGACACTGAATCTGCTGG + Intronic
1195987622 X:110647371-110647393 TCACCAGACACTGAATCTGCTGG + Intergenic
1196140527 X:112257574-112257596 TCACAAGCCACTGAATCTGCTGG - Intergenic
1196939082 X:120758121-120758143 TCACCAGACACTGGATCTGCTGG + Intergenic
1196964314 X:121039078-121039100 TCACCAGACACTGAATCTGCTGG - Intergenic
1197638967 X:128947236-128947258 TAACCATTCACTGTGTCCCCTGG + Intergenic
1198499182 X:137225668-137225690 TCACCAGACACTGAATCTGCTGG + Intergenic
1199742415 X:150748004-150748026 TCACCAGACACTGAATCTGCTGG - Intronic
1199845041 X:151686683-151686705 TCACCAGACACTGAATCTGCTGG - Intergenic
1200006980 X:153093089-153093111 TCACCAGACACCGGATCTCCTGG - Intergenic
1200137085 X:153880438-153880460 TCACCAGGCACCATGTCCCCAGG - Intronic
1200308479 X:155053309-155053331 AAACCAGCCACTACATCCCCAGG - Intronic
1201554135 Y:15250905-15250927 TCACCAGGCACTGGATCTGCTGG + Intergenic