ID: 1129515209

View in Genome Browser
Species Human (GRCh38)
Location 15:76153089-76153111
Sequence TCAGGTGGTTAGGAAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 252}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129515209 Original CRISPR TCAGGTGGTTAGGAAGCTGC AGG (reversed) Intronic
901068086 1:6504148-6504170 TCAGGTAGGCAGGAAGCTGCCGG + Intronic
902936738 1:19769937-19769959 ACACGTGCTTAGGGAGCTGCCGG + Intronic
906253354 1:44328670-44328692 CCAGGTGATGAGGATGCTGCTGG + Intronic
906935880 1:50213760-50213782 GCAGGTGGTTATGGAGCTTCTGG - Intergenic
907318369 1:53587164-53587186 TCAGGAGGAGAGGAAGCTTCAGG + Intronic
908135200 1:61124942-61124964 ACAGCTGCTTTGGAAGCTGCTGG - Intronic
908831943 1:68188058-68188080 TCAGGTTGTGAGGAAAGTGCTGG - Intronic
910502495 1:87909078-87909100 TCAGGTGGGTATGAAGGTGTTGG - Intergenic
911121623 1:94302474-94302496 CCAGGAGGTTAGGCAGCTGGTGG - Intergenic
916068711 1:161157250-161157272 ACAGGTGGTTTGGAAAATGCTGG + Exonic
916122824 1:161544253-161544275 TCAGATGGTTAATTAGCTGCAGG + Intronic
916132726 1:161625697-161625719 TCAGATGGTTAATTAGCTGCAGG + Intronic
917970211 1:180201395-180201417 TCAGGTGCCAAGGAAGCTCCAGG + Exonic
919851976 1:201679004-201679026 GGAGGTGGTTAGGATGCTGGGGG + Intronic
920043095 1:203116516-203116538 TGAGAGGCTTAGGAAGCTGCAGG + Intronic
921595979 1:217054110-217054132 TCAGGTGCTTAGGAAGTTTCTGG + Intronic
921937303 1:220806922-220806944 TTAGGTGGATAGCAAGCAGCTGG + Intronic
922479164 1:225926948-225926970 TCAGGTAGTGAGGAAGTTGGGGG + Intergenic
922577472 1:226671933-226671955 TCAGTGAGATAGGAAGCTGCTGG + Intronic
1065916483 10:30358092-30358114 TCAGCTGGTTGGGGGGCTGCAGG - Intronic
1067058421 10:43065427-43065449 TCAGGGGGTGGGGAGGCTGCTGG - Intergenic
1067254104 10:44618404-44618426 TCACGTGGTTAGTAGGCTGAAGG - Intergenic
1067509180 10:46881386-46881408 GCAGGTTGTTAGGAAGCTCAAGG + Intergenic
1067653072 10:48170464-48170486 GCAGGTTGTTAGGAAGCTCAAGG - Intronic
1067717390 10:48699914-48699936 TCAGGAGGTGAGGAGGCAGCTGG - Intronic
1068488031 10:57684354-57684376 TCAGTTGCTTAGGAACCTGGGGG - Intergenic
1069294038 10:66821545-66821567 TCAGTGGGTTAGGTTGCTGCTGG - Intronic
1069771989 10:70905978-70906000 TCTGGTGGTTTGGACTCTGCTGG + Intergenic
1071238784 10:83680739-83680761 TCGGGTGGTGAGAAAGCTGCAGG + Intergenic
1071490792 10:86135140-86135162 CCAGCTGGTGAGGAAGCTGATGG + Intronic
1072990462 10:100187256-100187278 TCAAGTGGTTAGGAAACTGCAGG + Exonic
1073323253 10:102628237-102628259 TCTGGTGTTTAGGAAGCTGAGGG + Intronic
1074894369 10:117762264-117762286 TTACGTGGTTAGGAACCTGGCGG + Intergenic
1075437372 10:122454997-122455019 TCAGGTGGTGCTGAGGCTGCTGG - Exonic
1076566288 10:131401711-131401733 TGAGGTGGTTACGCAGCCGCTGG - Intergenic
1076655691 10:132022022-132022044 GCAGCAGGTTAGGAAGCTGCAGG - Intergenic
1078103096 11:8341368-8341390 TTAGGTTGTCCGGAAGCTGCTGG - Intergenic
1078107087 11:8365309-8365331 TGAGGGGGCTAGGAAGCTGACGG + Intergenic
1079457994 11:20653255-20653277 TCAGGTGAGAAGGATGCTGCTGG - Intronic
1080743601 11:35087803-35087825 TCTGGTGGTTTTGAAGCTGTGGG - Intergenic
1083743248 11:64722176-64722198 GCAGGGGGAGAGGAAGCTGCAGG - Intronic
1086073231 11:82821902-82821924 TCAGGTGGTTAGGAAAGAACAGG - Intergenic
1091607795 12:1971101-1971123 ACAGGTGGCTGGGAAGCGGCTGG - Intronic
1097275801 12:57812852-57812874 TAATGATGTTAGGAAGCTGCAGG - Intronic
1097461983 12:59873256-59873278 CCAGGTGGTAAGAAATCTGCAGG - Intergenic
1098974852 12:76891901-76891923 TCAGGTGATTCAGAAGCTTCTGG - Intergenic
1099869677 12:88331127-88331149 TAAGGAGGCTAGGAAGCTGATGG + Intergenic
1100692616 12:97054516-97054538 TCATGTGCTTATGATGCTGCTGG + Intergenic
1100840324 12:98605998-98606020 TCAGCTACTTAGGAAGCTGAAGG + Intronic
1103887534 12:124214159-124214181 TCTGGAGATTAGGAAGCTGAGGG - Intronic
1104502702 12:129301887-129301909 TCAGGTGGTGATGACGCTGAAGG + Intronic
1105422414 13:20264750-20264772 GCAGGTGCTCAGGAAGGTGCTGG + Intergenic
1105940232 13:25141329-25141351 TCTGGTGCTTAGGAAGCCCCTGG + Intergenic
1110317895 13:74132710-74132732 GAAGGGGGTTGGGAAGCTGCAGG + Intronic
1110407871 13:75170561-75170583 TCATGTGGAGAGGATGCTGCTGG + Intergenic
1110741965 13:79008188-79008210 CCAGGTGGTGAGGAAGACGCTGG - Intergenic
1112579795 13:100668779-100668801 TATGCTGGTTAGGAATCTGCAGG + Exonic
1113702738 13:112399346-112399368 GCAGGGGGTGAGGAAGCTGGGGG - Intronic
1114633338 14:24173297-24173319 CCAGGTGGTTAGGAAGCAGCAGG - Exonic
1114670755 14:24409763-24409785 GCAGGTGCTTTGGAAGCTGCAGG - Exonic
1115648351 14:35385441-35385463 TCAGGAGGTGATGAGGCTGCAGG - Intergenic
1116282844 14:42930262-42930284 TCAGGTGCTGAGGAAGCAGCTGG + Intergenic
1118505106 14:66402739-66402761 TCAGGAGATTAGGAAACCGCAGG - Intergenic
1119956657 14:78805507-78805529 TAAGGTGGGTAGGATGGTGCAGG - Intronic
1121007238 14:90498273-90498295 GGAGGTGGTTAGGATGCTGGAGG + Intergenic
1121007246 14:90498329-90498351 AGAGGTGGTTAGGATGCTGGAGG + Intergenic
1121007258 14:90498407-90498429 GGAGGTGGTTAGGATGCTGGAGG + Intergenic
1121007262 14:90498425-90498447 GGAGGTGGTTAGGATGCTGGAGG + Intergenic
1121007268 14:90498463-90498485 GGAGGTGGTTAGGATGCTGGAGG + Intergenic
1122714535 14:103687152-103687174 GAAGCTGGTTAGGAAGCTGAAGG + Intergenic
1123506284 15:20942944-20942966 TAGGGTGGGTAGGAAGCTTCGGG + Intergenic
1123563510 15:21516648-21516670 TAGGGTGGGTAGGAAGCTTCGGG + Intergenic
1128080361 15:64853619-64853641 TCAGGTGGTGCGAATGCTGCTGG + Intronic
1128349109 15:66877324-66877346 TCAGGCGGTTACGAAGGTGTTGG - Intergenic
1129515209 15:76153089-76153111 TCAGGTGGTTAGGAAGCTGCAGG - Intronic
1129867833 15:78922771-78922793 CCAGGTCTTTAGGACGCTGCAGG - Intronic
1129901496 15:79154601-79154623 TCAGGTGATGTGGATGCTGCTGG - Intergenic
1129986449 15:79923436-79923458 CCAGGAGGTGCGGAAGCTGCAGG - Exonic
1130011709 15:80157534-80157556 TCGGGTTGTAAGGGAGCTGCAGG - Intronic
1130841675 15:87706649-87706671 CCAGGTGATTCGGATGCTGCTGG - Intergenic
1130871465 15:87975497-87975519 GCAGGAGGTCAGGGAGCTGCAGG + Intronic
1131243154 15:90765992-90766014 CCAGCTGCTTAGGAAGCTGAGGG + Intronic
1131856597 15:96603587-96603609 GAAGATGGTTAGGAAGCTGTCGG + Intergenic
1131875300 15:96799299-96799321 TCATTTGGTTAGGAAACGGCTGG + Intergenic
1202971868 15_KI270727v1_random:243785-243807 TAGGGTGGGTAGGAAGCTTCGGG + Intergenic
1132551489 16:555601-555623 TCAAGTGGAGAGGAGGCTGCTGG - Intergenic
1132955008 16:2587043-2587065 ACAGGTGCTTAGGAGGCAGCCGG + Intronic
1133950720 16:10389803-10389825 TCAGGTGATGCGGATGCTGCTGG + Intronic
1135199660 16:20426366-20426388 TCTGATGGTCAGGAAGCTGGAGG + Intronic
1135219041 16:20597244-20597266 TCTGATGGTCAGGAAGCTGGAGG - Intergenic
1135568433 16:23529833-23529855 CCAGCTGGTGGGGAAGCTGCAGG - Exonic
1135642144 16:24129300-24129322 TCAGGGGGTTAGAAAGGAGCTGG + Intronic
1137381918 16:48007275-48007297 TCAGGTAGGTAGGAAGGTCCAGG + Intergenic
1138339467 16:56279235-56279257 ACAGGTGGTGAGTCAGCTGCCGG - Intronic
1139118364 16:63985012-63985034 TCAGCTGCTTAGGAAGCTGATGG - Intergenic
1140321312 16:73954450-73954472 TCAGGTTGTTGGGAACCTGCGGG - Intergenic
1140951297 16:79820397-79820419 TCAGGTGGTGTTGATGCTGCTGG + Intergenic
1142273084 16:89101152-89101174 CCCGGTGGTCAGGAAGCTGGGGG + Exonic
1142358039 16:89613359-89613381 TCAGGAAATGAGGAAGCTGCTGG + Intronic
1142641231 17:1286981-1287003 CCAGGTGGTGAGGAGGATGCTGG + Intronic
1144659686 17:17060093-17060115 GCAGGAGGTCAGGAAGCTGGCGG - Intronic
1145998563 17:29118144-29118166 TCAGCAGTTTAGTAAGCTGCAGG - Exonic
1146136517 17:30326171-30326193 TCAGATAGGAAGGAAGCTGCTGG + Intronic
1147752916 17:42747934-42747956 TCAGGTGGAAAGGAAGTTGAAGG + Intergenic
1149573106 17:57689396-57689418 TCCTGTGGTCAGGAAGCTGCAGG + Intergenic
1151354108 17:73548454-73548476 TCCTGTGCCTAGGAAGCTGCAGG - Intronic
1151529761 17:74696720-74696742 TCAGGTGGGCTGTAAGCTGCAGG + Intronic
1152223114 17:79080103-79080125 TCAGGTGATACTGAAGCTGCTGG + Intronic
1152934011 17:83125468-83125490 GCAGGTGGGAAGGAGGCTGCAGG - Intergenic
1154107424 18:11534450-11534472 TCGGGTGGGTAGGAAGCTTTGGG + Intergenic
1154170218 18:12046152-12046174 TTGGGTGGGTAGGAAGCTTCAGG - Intergenic
1154172605 18:12062095-12062117 TTGGGTGGGTAGGAAGCTTCGGG + Intergenic
1154491734 18:14927487-14927509 TTAGCTGGTTAGGAAGGTGTTGG - Intergenic
1155172228 18:23275464-23275486 TCAGGTGATGGGGAAGCTGGTGG - Intronic
1155509096 18:26559493-26559515 TCAGGTGATTATGCTGCTGCTGG + Intronic
1156211498 18:34948816-34948838 TCAGGTGGTATTGATGCTGCTGG + Intergenic
1156402528 18:36752842-36752864 TGAAGTGGTTAGCTAGCTGCAGG + Intronic
1162936344 19:13983497-13983519 TCAGGTGGTTCAGCAGGTGCAGG - Exonic
1165772729 19:38388311-38388333 TAAGGAGGTTTGGATGCTGCAGG - Intergenic
1166098806 19:40558512-40558534 TCAGATGGAAATGAAGCTGCAGG + Intronic
1166411660 19:42559771-42559793 TCAGGTGGAGAAGGAGCTGCTGG + Intronic
925058470 2:873215-873237 TCAGGTGGGAAGGAAGCTGCCGG - Intergenic
925144244 2:1570278-1570300 ACAGGTGGTGGGGCAGCTGCTGG + Intergenic
925987752 2:9229993-9230015 TCAAGAGGTAAAGAAGCTGCTGG + Intronic
926355693 2:12038887-12038909 TCAGGTGGGTGGAAGGCTGCAGG + Intergenic
927242811 2:20933340-20933362 TTAGGTGGGCAGGAACCTGCAGG - Intergenic
927633344 2:24793329-24793351 TCGGGTGGTCAGGAAGATGGCGG - Exonic
928239389 2:29573208-29573230 TCAGGTGTTTATGGAGCAGCTGG - Intronic
931201756 2:60104413-60104435 GAAGATGGTCAGGAAGCTGCTGG - Intergenic
932373797 2:71216604-71216626 TCAGGTGATTCTGATGCTGCTGG - Intronic
932975956 2:76599839-76599861 TGAGGTGCTTAGGAAGCTCTTGG + Intergenic
933223380 2:79716656-79716678 TCTGGTGGTCAGGGAGCTCCAGG + Intronic
934631216 2:95925189-95925211 TCAGGTGGTGCTGATGCTGCTGG - Intronic
934802829 2:97183795-97183817 TCAGGTGGTGCTGATGCTGCTGG + Intronic
934833374 2:97556774-97556796 TCAGGTGGTGCTGATGCTGCTGG - Intronic
937095250 2:119231090-119231112 TCAGGTGGTGAGGGAGCTGGTGG - Intronic
938242403 2:129753450-129753472 CCAGGTGGTGATGAAGTTGCCGG + Intergenic
940367712 2:152866958-152866980 TCAGGTGGTCAGGAATTTGCAGG + Intergenic
940584288 2:155625149-155625171 TCAGGTGTTTCCGATGCTGCTGG + Intergenic
941404241 2:165069299-165069321 TGGGGAGGTTAGGAAGCTGATGG + Intergenic
942561076 2:177219243-177219265 TCAGGTGGTTATGGATCTGGTGG + Exonic
945267099 2:207901350-207901372 GCAGGTGATTAGCAAGGTGCTGG - Intronic
945283102 2:208055847-208055869 TCAGATACTTAGGAAGCTTCAGG + Intergenic
946030703 2:216701855-216701877 TCAGGCGTTTAGGAAGATGTTGG - Intergenic
946524694 2:220505866-220505888 TCATGTGGTTACAAAGCGGCTGG - Intergenic
947226215 2:227842954-227842976 TGAGGAGGTTAGGAATCTGGTGG - Intergenic
947815671 2:233034688-233034710 TCAGCTGGTGAAGAAGCTGGTGG + Exonic
948797271 2:240411491-240411513 TCTGGGGGACAGGAAGCTGCAGG + Intergenic
949009195 2:241668804-241668826 TCACGTGGTTGGGAATCTGAAGG + Intronic
1169251602 20:4065067-4065089 TCAGGTGATTCTGATGCTGCTGG + Intergenic
1169873318 20:10270371-10270393 TCAGGTGATGCTGAAGCTGCTGG - Intronic
1171393332 20:24815360-24815382 TGAGGTGGGGAGGAAGCGGCTGG + Intergenic
1174446114 20:50592487-50592509 CAAGGTGGTCCGGAAGCTGCAGG - Exonic
1174845436 20:53938743-53938765 TCAGGTGGTGCTGAGGCTGCTGG + Intronic
1175224847 20:57439158-57439180 TCAGGGGGTTAGGGAGGTGGGGG - Intergenic
1176070641 20:63224545-63224567 ACAGGGGCTTGGGAAGCTGCAGG + Intergenic
1176227534 20:64010121-64010143 TCATGTGGTGAGCATGCTGCTGG - Intronic
1176785522 21:13251953-13251975 TCAGGAGGTCAGGAGGCTGAGGG - Intergenic
1177587563 21:23118251-23118273 ACAGATGGTTATGAAGCTGTTGG - Intergenic
1179103350 21:38376466-38376488 TGATGTGGTTGGGAAGGTGCAGG - Intergenic
1180241427 21:46509291-46509313 TCAGGGTGTTCAGAAGCTGCTGG - Exonic
1180289581 22:10784484-10784506 TGGGGTGGGTAAGAAGCTGCTGG - Intergenic
1180305316 22:11068315-11068337 TGGGGTGGGTAAGAAGCTGCTGG + Intergenic
1180720687 22:17906100-17906122 TCACGTGGTTCGGAGGATGCAGG - Intronic
1181474181 22:23158559-23158581 TCACGGGGTTTGGAAGTTGCTGG - Intronic
1181632246 22:24157289-24157311 TCAGGAAGATAGGGAGCTGCTGG + Intronic
1181980066 22:26759974-26759996 TCAGGGCGTCAGGAAGCTGAGGG + Intergenic
1182391839 22:30004200-30004222 TCAAGTGGTAAGGATGCTACAGG + Intronic
1182677731 22:32052927-32052949 TCAGGAGGTTAGAAGGGTGCTGG + Intronic
1182685455 22:32119640-32119662 TGGGCTGGGTAGGAAGCTGCGGG - Intergenic
1182686506 22:32124285-32124307 TGGGGTGGGTAGGAAGCTGTGGG + Intergenic
1182697691 22:32207527-32207549 TGGGGTGGGTAGGAAGCTGTGGG + Intergenic
1182715187 22:32352617-32352639 TGGGGTGGGTAGGAAGCTGTGGG - Intergenic
1184963258 22:47947143-47947165 TCAGGTGGTGCTGAGGCTGCTGG + Intergenic
950140988 3:10615162-10615184 TCAGGACATCAGGAAGCTGCTGG + Intronic
950146834 3:10656156-10656178 AAAGGTGGTGAGGAAGTTGCTGG + Intronic
952445156 3:33373992-33374014 TCAGGTGCCTAGGGGGCTGCAGG - Intronic
952792529 3:37211636-37211658 TCATGTGGTTGGCAAACTGCTGG + Intergenic
952866873 3:37861005-37861027 TCAGGTTGTTCGGATGCTGGCGG - Intergenic
953872895 3:46642904-46642926 TCAGCTGCTTAGGAGGCTGAGGG - Intergenic
954580848 3:51702296-51702318 TGAGGTGGTCAGGGAGCTGGGGG - Intronic
955728358 3:61957558-61957580 TCCCGTGGTTAGGAAGGAGCTGG - Intronic
959871083 3:111329276-111329298 TCAGGTGGTGCTGATGCTGCTGG + Intronic
962831916 3:139150076-139150098 TCAGCTGCTTAGGAGGCTGAGGG + Intronic
966595134 3:181719264-181719286 TCAGGTGATTTGAAAGCTGGAGG + Intergenic
967267415 3:187702595-187702617 TCAGGGGGTGTGGAAGCAGCAGG - Intronic
968962294 4:3751794-3751816 TCGGGAGGTTTGGAAGCTGAGGG - Intergenic
970656440 4:18235488-18235510 ACAGATGGTCAGGAAGCTGAGGG + Intergenic
972265911 4:37459596-37459618 CCAGATGGTTATGATGCTGCTGG - Intronic
973279231 4:48341772-48341794 CCAGGAGGTGCGGAAGCTGCAGG + Exonic
975716335 4:77208955-77208977 TGAGGTGGCTATGAAGCTACAGG - Intronic
976380287 4:84391009-84391031 TCAGGGGGTTAGGGAGGGGCAGG + Intergenic
976928677 4:90534905-90534927 TCAAGTGATTTGGATGCTGCTGG - Intronic
978459086 4:108930281-108930303 CCAGGGGGTTAGGAATCTGTGGG + Intronic
979318926 4:119300542-119300564 TAGGGTTGTTACGAAGCTGCAGG - Exonic
979636362 4:122958852-122958874 TAAGGGAGTTAGGAAGCTGGAGG + Intronic
980480883 4:133385534-133385556 GCAGGAGGGTAGGAAGCTCCAGG - Intergenic
980984476 4:139682459-139682481 TCAGGAGGTTAGGGGGCTGCAGG + Intronic
981467147 4:145086463-145086485 CCAGGTGGTAATGATGCTGCTGG - Intronic
982726809 4:158915198-158915220 TTAGGTGGTTTGGAAGCTCTTGG + Exonic
983865475 4:172760617-172760639 GGAGGTGGCTAGGAAGTTGCAGG - Intronic
984476806 4:180245653-180245675 TCAGGTGGGAAAGAAGCTGCTGG + Intergenic
985244255 4:187963906-187963928 TCAGGTGGTTAGCCAGCATCAGG - Intergenic
985930787 5:3056074-3056096 ACAGGTGGCTGGGATGCTGCCGG + Intergenic
986204857 5:5613930-5613952 TCAGGTGCTGGGGATGCTGCTGG + Intergenic
986507793 5:8470781-8470803 TCAGGTGGTTTGGGGCCTGCAGG - Intergenic
986543866 5:8874192-8874214 TCAGGTGTCCAGGAGGCTGCAGG - Intergenic
987684287 5:21176942-21176964 TCAGTTTGTTGGGAAGATGCAGG + Intergenic
988109959 5:26807509-26807531 GCAGGTGCTTTGGAACCTGCAGG - Intergenic
988599210 5:32623893-32623915 TGAGGTGGCCAGGGAGCTGCAGG + Intergenic
989342244 5:40389084-40389106 TCAGGTAATCAGGAAGCTACTGG + Intergenic
990356764 5:54975425-54975447 TCAGGTGGTGCAGATGCTGCTGG - Intergenic
995512611 5:112923541-112923563 TCAGGCAGATAGGAAGTTGCTGG - Intergenic
999739849 5:154541893-154541915 TGAGGTGGGTAGGAACCTGAGGG + Intergenic
1000197482 5:158973437-158973459 TGAGCTGGTTAGGAAGGTGAGGG - Intronic
1000683739 5:164220813-164220835 TTAGGTCATTAAGAAGCTGCTGG + Intergenic
1001845484 5:174917728-174917750 TCAGCTGGTTGGGGGGCTGCAGG - Intergenic
1001980439 5:176034374-176034396 TGGGGTGTGTAGGAAGCTGCTGG - Intronic
1002237022 5:177809691-177809713 TGGGGTGTGTAGGAAGCTGCTGG + Intergenic
1002724216 5:181283673-181283695 TGGGGTGGGTAAGAAGCTGCCGG + Intergenic
1002843654 6:926957-926979 TCAGGTGCTGAAGGAGCTGCTGG + Intergenic
1003065783 6:2902910-2902932 GCAGGTGGGGAGGAGGCTGCAGG + Intronic
1003086388 6:3064329-3064351 GCAGGTGGGGAGGAGGCTGCAGG - Intronic
1003184169 6:3816139-3816161 GCAGGTGGACAGGAAGCAGCTGG + Intergenic
1003888800 6:10544981-10545003 TGAGGTGGTCAGAGAGCTGCTGG + Intronic
1004245891 6:13974929-13974951 TCCAGAGGTTAGGAAGCTGATGG - Intronic
1005186906 6:23172651-23172673 TCAGGTTGTTGGGGAGTTGCTGG + Intergenic
1005872073 6:29982000-29982022 TCAGGTGTAAAGGAAACTGCAGG + Intergenic
1005895124 6:30171614-30171636 CCAGGTGGTGGGGATGCTGCTGG + Intronic
1006989099 6:38198201-38198223 TCAGGTGGGCAGGAATTTGCTGG + Intronic
1008136276 6:47780643-47780665 TGAGATGGTTAGAAAGCTGTAGG - Intergenic
1010099459 6:72087081-72087103 TTATCTGGTTAAGAAGCTGCAGG - Intronic
1014732068 6:125043984-125044006 TAAGGTAGTTAAGAAGTTGCAGG - Intronic
1015562271 6:134529195-134529217 TCAAATATTTAGGAAGCTGCTGG - Intergenic
1015868732 6:137754139-137754161 TGGGGAGGTTAGGAAGATGCTGG + Intergenic
1017491758 6:154951494-154951516 GGAGGTGGTTTGGAAGCTACAGG - Intronic
1017791355 6:157802338-157802360 TCACCTCATTAGGAAGCTGCTGG - Intronic
1021537731 7:21724332-21724354 TCAGCTGGTTTGGAAGATGGTGG + Intronic
1022569798 7:31441210-31441232 TCAGGTGGTACTGATGCTGCTGG - Intergenic
1023076369 7:36486401-36486423 GGAGGTGGTTAGGAAGAAGCAGG - Intergenic
1023104322 7:36748519-36748541 TCAGGAGGTTATGCAGCTGTAGG - Intergenic
1024304174 7:47913047-47913069 TCAGGTGGTCATGATGCTGCTGG + Intronic
1026420032 7:70225571-70225593 GCAAGTGGTTAGGAAGATGTTGG + Intronic
1026510220 7:71021240-71021262 TCAAGAGGTTAGGAAGCAGATGG + Intergenic
1027215188 7:76179030-76179052 TCAGGGTGGGAGGAAGCTGCTGG + Intergenic
1029245501 7:99196721-99196743 TCTGGTGGTTGGGAGGCTGTTGG - Intronic
1032501969 7:132406486-132406508 TCATGTGGTCAGGAGGCTCCTGG - Intronic
1033282131 7:140013791-140013813 TCAGGTGTGTTGGAGGCTGCTGG - Intronic
1033515580 7:142102281-142102303 TGAGCTGGTTAGGAAGATGCTGG + Intronic
1033564839 7:142568375-142568397 TCTGGAGGTTTGAAAGCTGCTGG - Intergenic
1035661188 8:1350110-1350132 TCAGCTGGTTATTAAACTGCAGG + Intergenic
1035678318 8:1470349-1470371 TCAGGTTGTAAGGAACCAGCGGG - Intergenic
1044294813 8:90515799-90515821 TCAGGTGATTCTGATGCTGCTGG + Intergenic
1046997992 8:120545423-120545445 CCAGGTGGTTCTGATGCTGCTGG - Intronic
1048490007 8:134883850-134883872 TCAGGAGTTTAGGAGGCTGCAGG - Intergenic
1049930552 9:452179-452201 TCAGGTGATGCTGAAGCTGCTGG - Intronic
1052209940 9:25892240-25892262 TCATGTGATATGGAAGCTGCTGG + Intergenic
1052472311 9:28915437-28915459 TAAGGAGATAAGGAAGCTGCTGG + Intergenic
1052621681 9:30919031-30919053 TCAAGTGTTTAAGCAGCTGCAGG + Intergenic
1053886357 9:42647106-42647128 TGGGGTGGGTAAGAAGCTGCTGG + Intergenic
1054225377 9:62454555-62454577 TGGGGTGGGTAAGAAGCTGCTGG + Intergenic
1055772341 9:79730767-79730789 TCAGGAGGCTGGGAAGTTGCAGG + Intergenic
1056026278 9:82498998-82499020 CCAGATGGTCAGTAAGCTGCAGG - Intergenic
1057722671 9:97545554-97545576 TCAGGAGGTTAGAAGGCAGCGGG + Intronic
1059770195 9:117416592-117416614 TCAGGTGGTCAGGGAGGTGAAGG + Intergenic
1062267190 9:135692575-135692597 GCAGGAGGTTAGGAGGCTCCAGG - Intergenic
1186737993 X:12486262-12486284 CCAGGTGGTGTTGAAGCTGCTGG - Intronic
1186932716 X:14412576-14412598 TCAGGTGGTGACAATGCTGCTGG + Intergenic
1190899905 X:54661207-54661229 TCAGATGGCTACTAAGCTGCTGG + Intergenic
1192555451 X:72085449-72085471 ACAGGTGGTTAAGAAGGTGCAGG - Intergenic
1195776331 X:108410029-108410051 TCAGGTGGCTATTAAGCAGCAGG + Intronic
1195821783 X:108953524-108953546 TCAGGTGGTGCTGATGCTGCTGG - Intergenic
1198422825 X:136484872-136484894 CCAGGTGATGAGGATGCTGCTGG - Intergenic
1199769434 X:150964947-150964969 CCAGGTGGTTTGGTACCTGCCGG - Intergenic