ID: 1129517131

View in Genome Browser
Species Human (GRCh38)
Location 15:76163610-76163632
Sequence CCAGCTGGCCACTTGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 163}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129517119_1129517131 1 Left 1129517119 15:76163586-76163608 CCCCGCCCTTGGCTGAGGCCAGG 0: 1
1: 0
2: 2
3: 22
4: 289
Right 1129517131 15:76163610-76163632 CCAGCTGGCCACTTGGAACTGGG 0: 1
1: 0
2: 1
3: 7
4: 163
1129517116_1129517131 12 Left 1129517116 15:76163575-76163597 CCAAAGCGCAGCCCCGCCCTTGG 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1129517131 15:76163610-76163632 CCAGCTGGCCACTTGGAACTGGG 0: 1
1: 0
2: 1
3: 7
4: 163
1129517123_1129517131 -4 Left 1129517123 15:76163591-76163613 CCCTTGGCTGAGGCCAGGCCCAG 0: 1
1: 1
2: 6
3: 43
4: 400
Right 1129517131 15:76163610-76163632 CCAGCTGGCCACTTGGAACTGGG 0: 1
1: 0
2: 1
3: 7
4: 163
1129517122_1129517131 -1 Left 1129517122 15:76163588-76163610 CCGCCCTTGGCTGAGGCCAGGCC 0: 1
1: 0
2: 4
3: 28
4: 319
Right 1129517131 15:76163610-76163632 CCAGCTGGCCACTTGGAACTGGG 0: 1
1: 0
2: 1
3: 7
4: 163
1129517121_1129517131 0 Left 1129517121 15:76163587-76163609 CCCGCCCTTGGCTGAGGCCAGGC 0: 1
1: 1
2: 4
3: 50
4: 418
Right 1129517131 15:76163610-76163632 CCAGCTGGCCACTTGGAACTGGG 0: 1
1: 0
2: 1
3: 7
4: 163
1129517124_1129517131 -5 Left 1129517124 15:76163592-76163614 CCTTGGCTGAGGCCAGGCCCAGC 0: 2
1: 0
2: 8
3: 66
4: 544
Right 1129517131 15:76163610-76163632 CCAGCTGGCCACTTGGAACTGGG 0: 1
1: 0
2: 1
3: 7
4: 163
1129517115_1129517131 15 Left 1129517115 15:76163572-76163594 CCTCCAAAGCGCAGCCCCGCCCT 0: 1
1: 0
2: 2
3: 23
4: 229
Right 1129517131 15:76163610-76163632 CCAGCTGGCCACTTGGAACTGGG 0: 1
1: 0
2: 1
3: 7
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129517131 Original CRISPR CCAGCTGGCCACTTGGAACT GGG Intronic
900591618 1:3462795-3462817 CCACCTGGTCCCTTGGAGCTCGG + Intronic
900923859 1:5690937-5690959 CCAGCTAGCCACTTCCAAATGGG + Intergenic
901493669 1:9609309-9609331 TCAGCCAGCCACTTGGAATTGGG + Intronic
902576054 1:17378341-17378363 CCAGATGCCCACTGCGAACTGGG - Intronic
904327951 1:29739635-29739657 CCAGCTCTCCACTTGGGAGTAGG - Intergenic
904585427 1:31577188-31577210 CTGGCTGGCCACTTGGCTCTGGG + Exonic
904608984 1:31714929-31714951 CCAGCTGTCTACTTGGAAAAGGG + Intergenic
905458132 1:38102636-38102658 ACACCTGGCCAGTAGGAACTAGG - Intergenic
905656595 1:39689979-39690001 CCAGCTGGCCACCTACAATTTGG + Intronic
906853855 1:49282985-49283007 CCAGCTGGGAAGCTGGAACTGGG + Intronic
907468004 1:54652306-54652328 CCAGCTGGCCACATGTGACAGGG - Intronic
908805477 1:67926966-67926988 CCAGCTTGTCACTAGAAACTGGG - Intergenic
910184328 1:84520398-84520420 TAAGTTGGCCACTTGGCACTTGG - Intergenic
916143143 1:161717128-161717150 CCAGCTATGCACTTGGAAGTGGG + Intergenic
917617284 1:176758984-176759006 CCTGCTGGCCTCTAGGACCTTGG - Intronic
922566446 1:226604617-226604639 CCAGCTGGCCACTCAGACCAGGG + Exonic
923190093 1:231611927-231611949 CCAGCTGGGCACAGGGAGCTGGG + Intronic
1063619291 10:7631004-7631026 CCAGGTGGCAGCTTGGAAATGGG + Intronic
1064096434 10:12427593-12427615 CCATCTTGGAACTTGGAACTTGG + Intronic
1067225485 10:44373445-44373467 CAAGGTGGCAACTTGGAAGTAGG - Intronic
1071517468 10:86308251-86308273 CCAGCTGGCCACTCAGAGGTGGG - Intronic
1071538772 10:86459884-86459906 CCGGCAGGCCACTTGAAACTAGG + Intronic
1073011682 10:100365050-100365072 CCAGCTGGCAACTTGGCCCTGGG + Intergenic
1073254919 10:102144806-102144828 CCAGCCTGCCTCTTGGAATTGGG + Intronic
1075395571 10:122124550-122124572 CTAGCTGGACACTTGGGGCTGGG - Intronic
1075823175 10:125331349-125331371 CCAGATGGCCACTTTGACCTTGG - Intergenic
1077173579 11:1178946-1178968 CCAGCCGGCCACTTGGGGATGGG + Intronic
1081287108 11:41284462-41284484 GCTGCTGGCCATTTGGAAGTGGG + Intronic
1089565406 11:119368744-119368766 CAAGCTGGGCACCTGCAACTCGG - Intronic
1090750206 11:129739986-129740008 CCAGCTGCACACTTGGATTTTGG - Intergenic
1091096321 11:132825626-132825648 TCAGCTTGCCACTTGGAAGGCGG + Intronic
1098362896 12:69672444-69672466 CCAGCTGGACACTGGGAGCCTGG - Intronic
1100040646 12:90313217-90313239 CCACCTGGCCATTTGGAAAGTGG + Intergenic
1100958849 12:99939881-99939903 TTAGCTGTCCATTTGGAACTAGG - Intronic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1105598219 13:21860338-21860360 CAAGTTGGAAACTTGGAACTTGG - Intergenic
1106019158 13:25898673-25898695 CCAGCTGGGAAGCTGGAACTGGG - Intronic
1110587371 13:77209917-77209939 CCACATGGCCTCTTAGAACTTGG + Intronic
1111078923 13:83276871-83276893 CCAGCGGGCCACGTGGAGCATGG - Intergenic
1111884347 13:94000567-94000589 CAAGTTGGACAGTTGGAACTGGG + Intronic
1113273208 13:108698154-108698176 CCAGCTGGAAATTTGGAATTGGG - Intronic
1113671966 13:112181673-112181695 CCACGGGGCCACTTGGAAGTCGG - Intergenic
1113792475 13:113036469-113036491 CCAGCTGCCCACAGGCAACTGGG + Intronic
1114531923 14:23401889-23401911 CCAGCTTGACACTTTGATCTGGG + Intronic
1114680675 14:24481722-24481744 CCAGCTGGCCACCTGGAACATGG - Intergenic
1115738492 14:36361482-36361504 CCAGATGTCCATTTGGCACTAGG + Intergenic
1116029521 14:39554057-39554079 GCAGATTGCCACTTGGACCTGGG - Intergenic
1119259310 14:73228162-73228184 CCATCTTCCCACTGGGAACTTGG + Intergenic
1119482288 14:74965561-74965583 CCAGCTGGCCCCTCGGGCCTTGG + Intergenic
1123477097 15:20597937-20597959 ACAGCTGTCCACGTGGACCTGGG + Intergenic
1123640916 15:22402427-22402449 ACAGCTGTCCACGTGGACCTGGG - Intergenic
1126960685 15:53990835-53990857 CCACCTGGCCACTTTAGACTTGG - Intergenic
1129517131 15:76163610-76163632 CCAGCTGGCCACTTGGAACTGGG + Intronic
1131806768 15:96130581-96130603 ACTGCTGGCTACTTGGAAATGGG + Intergenic
1132216152 15:100063167-100063189 GGAGCTGGCCACTAGGAATTTGG + Intronic
1132625842 16:891114-891136 CCAGCTGGCCACGTGGACACAGG + Intronic
1133966051 16:10532390-10532412 CCTGCTTCTCACTTGGAACTTGG + Exonic
1134832543 16:17335258-17335280 CCTACTGGCCACCTGGAACAAGG + Intronic
1136517868 16:30778696-30778718 TCAGATGGGAACTTGGAACTGGG - Exonic
1138369973 16:56519385-56519407 TCTGCTTGTCACTTGGAACTCGG - Intronic
1139824695 16:69747757-69747779 CCACCTGGGCACTGAGAACTTGG - Intronic
1144083666 17:11787289-11787311 ACAGCTGGCCACCTGCAATTGGG + Intronic
1147121534 17:38338004-38338026 AGAGCTGGCCACTAGGAAATGGG - Intronic
1147153955 17:38533856-38533878 ACAGCGGGCCATTTGGGACTAGG - Intronic
1148566575 17:48636504-48636526 CCAGCTGGGGTCTAGGAACTCGG - Intergenic
1148685913 17:49501210-49501232 CCATGTGGCCACTGGGAACAGGG - Intronic
1149181380 17:53941440-53941462 CAAGCTGGCCAGTTGGCACATGG + Intergenic
1151833102 17:76567311-76567333 CCAGCAGCACTCTTGGAACTGGG + Intronic
1152424284 17:80210541-80210563 CCAGCTGGCCAAGTGGCAGTGGG - Exonic
1154942834 18:21131972-21131994 CCAGGTTTCCACTGGGAACTTGG + Intergenic
1157291959 18:46415983-46416005 CCAGCTGGCCACTCAGGGCTGGG + Intronic
1164749228 19:30639472-30639494 CCATGTGGCTACTGGGAACTTGG - Intronic
1165350669 19:35273452-35273474 CCATCTACTCACTTGGAACTGGG - Intronic
1165819582 19:38666045-38666067 CCAGCTGCCGACCTGGAACGTGG + Intronic
1166829823 19:45632633-45632655 CCAGCTGGGCCCTAGGCACTGGG + Intronic
1167803298 19:51760615-51760637 ACAGGTGGCCACCTGGGACTTGG + Intronic
1167880552 19:52453930-52453952 CCTTCTGGCCTCTTGGAGCTCGG + Intronic
926121219 2:10242152-10242174 CCAACTGGCCACATGGAATCTGG - Intergenic
926753747 2:16219827-16219849 CCAGCAGGCCAGTTGGCACCTGG - Intergenic
930339222 2:50091348-50091370 CCAGCTGTCCACCTGCAACGTGG + Exonic
934963542 2:98699390-98699412 TCGGCTGGCCTCTGGGAACTTGG - Intronic
937170736 2:119864861-119864883 ACAACTGGACTCTTGGAACTTGG - Intronic
938555140 2:132417104-132417126 CCAGGTGGCCACCTCAAACTCGG - Exonic
938835576 2:135100329-135100351 ACAGCTGGGCACTGGGAGCTGGG - Intronic
940196781 2:151103783-151103805 TCAGCTGGGGACCTGGAACTCGG - Intergenic
941721679 2:168819445-168819467 CACGCTTGCCACTTGGAACATGG + Intronic
941732138 2:168930446-168930468 TCAGCAGGCCATCTGGAACTGGG + Intronic
945258281 2:207820577-207820599 CTAGCTGGCCACCTGGCACTTGG + Intergenic
946227470 2:218271622-218271644 TCAGCTCGCCACCTGAAACTTGG - Intronic
949017553 2:241722000-241722022 CCAGCTGTCCACCTGGCACAGGG - Intronic
1170511961 20:17086557-17086579 CCAGGGGGCCACATGGACCTGGG - Intergenic
1170786640 20:19472976-19472998 CTTGCTGGCCACTGGGCACTGGG + Intronic
1171427395 20:25057553-25057575 CGAGCTGGGCACGTGGATCTGGG + Intronic
1171981931 20:31634458-31634480 GGAGCTGGACTCTTGGAACTCGG + Intergenic
1173359196 20:42325053-42325075 CAACCTGGCCACTGGGTACTGGG + Intronic
1176108257 20:63399519-63399541 CCAGCAGCCCTCATGGAACTCGG + Intergenic
1176126706 20:63478769-63478791 ACAGATGGCCACTTTGACCTGGG + Intergenic
1178229592 21:30766331-30766353 CCAGCTGGAAACTGGGAACAGGG - Intergenic
1184131089 22:42516830-42516852 CGAGCTGGACACTTGCCACTGGG + Intronic
1184141261 22:42578689-42578711 CGAGCTGGACACTTGCGACTGGG + Intergenic
950727018 3:14923195-14923217 CCACCAGGCCACTTGGAAGAAGG - Intronic
952673728 3:36001114-36001136 CCAGCCAGCCACTTGCAACAGGG - Intergenic
952886833 3:38017422-38017444 CCAGTTTGCCTCTTGGGACTGGG - Intronic
954079518 3:48205341-48205363 CTAGCGGGCAACTGGGAACTTGG - Intergenic
954413444 3:50381254-50381276 CCAGCTGGGCCCTAGGAAATAGG - Intronic
954979642 3:54733309-54733331 CCAGCTGCCCTCTTGGCACAAGG - Intronic
958868037 3:99524429-99524451 CCAGAGGCCCACTGGGAACTTGG - Intergenic
959462439 3:106643853-106643875 CCAGCTGGCCACTCTGAATGCGG - Intergenic
962973967 3:140429974-140429996 CCAGCTGACCCCTGGGGACTGGG - Intronic
967409560 3:189153665-189153687 CCAGCTGGCAAATGGGATCTGGG + Intronic
968502632 4:958148-958170 CCAGCTGGCCATGTGGACCACGG + Exonic
971209104 4:24599237-24599259 CCAGCTGGGCTCCTGGGACTTGG - Intergenic
972153157 4:36121758-36121780 CCAGCTTGGCACCTGGAATTTGG - Intronic
972977937 4:44660530-44660552 CCAGCTGGGGACTTGAAAATCGG - Intronic
973097920 4:46225596-46225618 CCAGTTGTGCACCTGGAACTGGG - Intergenic
976902119 4:90191385-90191407 CCAGCTTGGCACTAGGAACTGGG - Intronic
977577250 4:98688455-98688477 CCACCTCACCACTTTGAACTGGG + Intergenic
982087311 4:151848765-151848787 CCAGATGGACACTTGAAAATGGG + Intergenic
984771001 4:183436283-183436305 CCCGCTGGCCAGTTGCAATTCGG - Intergenic
985629339 5:1006691-1006713 CCACCTTGTCACTTGGAACTAGG - Intergenic
986735782 5:10666282-10666304 CCATCCAGCCACTTGGAACTAGG + Intergenic
988509720 5:31854979-31855001 CCAGCTGCCCTCCTGGAACGCGG - Intronic
993864634 5:93177781-93177803 CCACCTGCTCACTGGGAACTAGG - Intergenic
994274608 5:97821504-97821526 TGTGCTGGCCACCTGGAACTGGG + Intergenic
997968744 5:138382958-138382980 TCAGCTGGCCAAATAGAACTGGG + Intronic
1002204449 5:177553530-177553552 CCAGCTTGCCACCTGGAAGAAGG - Intronic
1004019454 6:11763533-11763555 CCGGCTGGGCATTTGGTACTAGG - Intronic
1004546722 6:16604880-16604902 CCAGCTGACCACCTGGATTTTGG + Intronic
1006787499 6:36678536-36678558 CCGGCTGGCCTGCTGGAACTCGG + Intronic
1007648882 6:43404436-43404458 GGAGCTGGCCACTTGGAGGTGGG + Intergenic
1008541710 6:52551668-52551690 CCAGCTGGCAACCTGGAGATGGG + Intronic
1008727519 6:54440879-54440901 CCAGATGGCACCTTGGACCTCGG - Intergenic
1011639319 6:89404400-89404422 CCAGATCAGCACTTGGAACTGGG + Intronic
1017893779 6:158661210-158661232 GCACCTTGCCACTTGGCACTTGG + Intronic
1023244526 7:38187113-38187135 CCAGCTGGCATGTTGGAGCTGGG - Intronic
1024169872 7:46773651-46773673 CCAGCTGGCTGCATGGAGCTTGG + Intergenic
1024966197 7:55023976-55023998 CAAGCTGGCCAGTTTGAATTTGG + Intronic
1025211626 7:57022403-57022425 CCATCAAGCCACTTGGAACCTGG - Intergenic
1025660330 7:63554424-63554446 CCATCAAGCCACTTGGAACCTGG + Intergenic
1026649828 7:72206856-72206878 CCACCTGGCCACCTGGAAGCTGG + Intronic
1028928710 7:96389137-96389159 CCAACTGGTCACTTGGAATGTGG + Intergenic
1029233918 7:99096190-99096212 CCAGGTGGCCACCTGGAGCCTGG - Intronic
1029525411 7:101090988-101091010 CCTGCAGGCCAAGTGGAACTTGG + Intronic
1041260548 8:56017651-56017673 ACAGCAGGCCACATGGAGCTTGG - Intergenic
1043184617 8:77130986-77131008 CTAGCTGGCCACTTGCAATAAGG + Intergenic
1045911397 8:107414714-107414736 TCAGATGGGCACTTGGAAGTGGG - Intronic
1046521412 8:115330845-115330867 CCAGCCGGCCACTTGGAGTGTGG + Intergenic
1046694697 8:117326614-117326636 ACAGCTGGCTCCTTAGAACTTGG + Intergenic
1046887875 8:119388268-119388290 CAAGCTGGACACTTGTCACTGGG + Intergenic
1048503868 8:135003299-135003321 ACAACTGGCTAGTTGGAACTTGG - Intergenic
1048522427 8:135169170-135169192 CCGAGTGGCCACTTGGAGCTGGG + Intergenic
1049881570 8:145068028-145068050 CTAACTGTCCACTAGGAACTTGG + Intergenic
1053752003 9:41266576-41266598 CCAGGTGGCCCCTTAGACCTGGG - Intergenic
1054257524 9:62830906-62830928 CCAGGTGGCCCCTTAGACCTGGG - Intergenic
1054333789 9:63784816-63784838 CCAGGTGGCCCCTTAGACCTGGG + Intergenic
1055603745 9:77947133-77947155 CCAGCTGGCCTCTGGGGAGTTGG - Intronic
1057682778 9:97205629-97205651 GCAGCTGGGAAGTTGGAACTGGG + Intergenic
1057970799 9:99555464-99555486 CCAGCTGGACACTAAGACCTGGG - Intergenic
1058450644 9:105093025-105093047 CCAGCAAGCTACTTGGTACTTGG + Intergenic
1059398229 9:114052244-114052266 CCAGCTCTCCCCTTGAAACTTGG + Exonic
1059948375 9:119436414-119436436 CCAGCTGGCCAGTGAGAGCTGGG - Intergenic
1060731088 9:126037451-126037473 CCAGCTGGCCTCTCGGCACCAGG - Intergenic
1060933002 9:127500629-127500651 CCAGATGGCCACATGGCCCTGGG + Intronic
1061215269 9:129218115-129218137 ACAGCTGGCCTTGTGGAACTCGG - Intergenic
1061275252 9:129566502-129566524 CAAGCTGGCCTGTTGGGACTGGG - Intergenic
1061400454 9:130365504-130365526 CAAGCTGCCCACTTGGAGCACGG - Intronic
1061589274 9:131588341-131588363 CTTGCTGGCCACCTGGAAGTGGG - Intronic
1062467608 9:136687936-136687958 CCAGGTGGCCACTGGTCACTCGG - Intergenic
1189804680 X:44723303-44723325 CTATCTGGCCCCTTGGAAGTAGG + Intergenic
1197067561 X:122251977-122251999 CAGGCTGGCCAAGTGGAACTAGG + Intergenic
1200880492 Y:8207284-8207306 CCAACTGGGCACTTGGCCCTGGG + Intergenic
1201545596 Y:15158556-15158578 CCAGCTGGGAAACTGGAACTGGG - Intergenic