ID: 1129518330

View in Genome Browser
Species Human (GRCh38)
Location 15:76170540-76170562
Sequence CTCTAACTCTCCAGCGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129518330_1129518335 6 Left 1129518330 15:76170540-76170562 CCTGCCCCGCTGGAGAGTTAGAG 0: 1
1: 0
2: 1
3: 11
4: 102
Right 1129518335 15:76170569-76170591 CACTGGACACAGCTGAGATGCGG 0: 1
1: 0
2: 2
3: 28
4: 263
1129518330_1129518337 13 Left 1129518330 15:76170540-76170562 CCTGCCCCGCTGGAGAGTTAGAG 0: 1
1: 0
2: 1
3: 11
4: 102
Right 1129518337 15:76170576-76170598 CACAGCTGAGATGCGGGTTCCGG 0: 1
1: 0
2: 1
3: 10
4: 127
1129518330_1129518336 7 Left 1129518330 15:76170540-76170562 CCTGCCCCGCTGGAGAGTTAGAG 0: 1
1: 0
2: 1
3: 11
4: 102
Right 1129518336 15:76170570-76170592 ACTGGACACAGCTGAGATGCGGG 0: 1
1: 0
2: 1
3: 30
4: 218
1129518330_1129518339 30 Left 1129518330 15:76170540-76170562 CCTGCCCCGCTGGAGAGTTAGAG 0: 1
1: 0
2: 1
3: 11
4: 102
Right 1129518339 15:76170593-76170615 TTCCGGGCTCCTGTTCCCCTCGG 0: 1
1: 0
2: 0
3: 18
4: 163
1129518330_1129518338 14 Left 1129518330 15:76170540-76170562 CCTGCCCCGCTGGAGAGTTAGAG 0: 1
1: 0
2: 1
3: 11
4: 102
Right 1129518338 15:76170577-76170599 ACAGCTGAGATGCGGGTTCCGGG 0: 1
1: 0
2: 0
3: 5
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129518330 Original CRISPR CTCTAACTCTCCAGCGGGGC AGG (reversed) Intronic
901954958 1:12777381-12777403 TCATAACTCTCCAGAGGGGCAGG - Exonic
901960797 1:12825111-12825133 CCATAACTTTCCTGCGGGGCAGG + Exonic
901967394 1:12879713-12879735 CCATAACTCTCCCGGGGGGCAGG + Exonic
901972675 1:12920222-12920244 TCATAACTCTCCAGAGGGGCAGG - Exonic
901982792 1:13049977-13049999 CCATAACTCTCCCGCGGGGCAGG + Intronic
901986230 1:13077361-13077383 CCATAACTCTCCCGTGGGGCAGG - Exonic
901995582 1:13149406-13149428 CCATAACTCTCCCGTGGGGCAGG + Intergenic
901999297 1:13178941-13178963 CCATAACTCTCCCGCGGGGCAGG - Intergenic
902012505 1:13281540-13281562 TCATAACTCTCCAGAGGGGCAGG + Exonic
902030848 1:13421067-13421089 TCATAACTCTCCCGCGGGGCAGG - Exonic
903950802 1:26994753-26994775 CTCTCACTCTCCAGATGGTCGGG - Intronic
905921192 1:41720013-41720035 CTCAAACTGTGGAGCGGGGCTGG + Intronic
907385237 1:54121672-54121694 CTCTTTCTCTCCAGGGTGGCCGG + Intergenic
907472806 1:54685394-54685416 CTCTAACACTCCTGTGGGGCTGG + Intronic
908595796 1:65687678-65687700 CTCTAAATCTCCAAGGGGTCAGG + Intergenic
910820409 1:91338924-91338946 CTCTAACCCTCCAGTGCAGCAGG + Intronic
914811214 1:151029661-151029683 CTCAAACTTTCCAGCTCGGCTGG - Intronic
915052085 1:153085635-153085657 GTCTACCTCTCTAGCTGGGCTGG - Intergenic
916160961 1:161914274-161914296 CTCAAAGTCTGCAGCAGGGCAGG + Intronic
916551677 1:165855799-165855821 TTCCAACTCTCCAGAGGGCCAGG - Intronic
923651174 1:235875468-235875490 TTCTGACTCTCCAGAGTGGCTGG + Intronic
1067166710 10:43871137-43871159 CCCCAAGTCTCCAGCGGGGCCGG - Intergenic
1074763999 10:116687190-116687212 CTGTCCCTCTCCAGCTGGGCTGG + Intronic
1075709635 10:124523748-124523770 CCCTTTCTCTCCACCGGGGCTGG - Intronic
1075895140 10:125988622-125988644 CTCACACTCCCCAGAGGGGCTGG - Exonic
1076709095 10:132321310-132321332 CTCTTACTCTGCAGGTGGGCTGG - Intronic
1078364233 11:10693410-10693432 CTTTAACTTTCCAGGGGAGCTGG - Intronic
1083200564 11:61118756-61118778 CTCTAAGCCTCCTGCGAGGCGGG - Intronic
1083779776 11:64911831-64911853 CTCCAACTCACCAGCTGGGTGGG + Exonic
1085308324 11:75500924-75500946 CCCTGACTCTCCAGCAGGCCTGG + Intronic
1089499103 11:118922413-118922435 CTCTAACTGGCCAGAGGAGCCGG - Intronic
1101331013 12:103758002-103758024 CTCAAACTCTCCCACGGCGCAGG + Intronic
1102101589 12:110282042-110282064 CCCTTTCTCTCCCGCGGGGCCGG - Intronic
1102637762 12:114339295-114339317 GTCTAGCTCTCCAGCCAGGCTGG - Intergenic
1104409269 12:128544264-128544286 CTCTGCCTCTGCAGCAGGGCGGG + Intronic
1105244795 13:18639761-18639783 CTCTAACTATCCAGTGGCTCTGG - Intergenic
1107759715 13:43664985-43665007 CACAAAATCTCCTGCGGGGCTGG + Intronic
1117657618 14:57972737-57972759 CTCTCACTCTCCTGCCTGGCTGG - Intronic
1121236429 14:92394488-92394510 CTCAAACTCTCCTGCGTGGCTGG - Intronic
1124428959 15:29589656-29589678 CTGTAAATCCGCAGCGGGGCAGG - Intergenic
1125373216 15:39000357-39000379 CCCTGACTCTCCAGAGGAGCAGG - Intergenic
1125919646 15:43517914-43517936 GTCCACCTCTCCAGCTGGGCGGG + Intronic
1126849855 15:52790295-52790317 CTCAAGCTGGCCAGCGGGGCGGG - Intronic
1129518330 15:76170540-76170562 CTCTAACTCTCCAGCGGGGCAGG - Intronic
1129884093 15:79026640-79026662 TTCTCCCTCTCCAGCCGGGCTGG - Intronic
1136028598 16:27486206-27486228 CTGTCACTCTGCAGAGGGGCAGG + Intronic
1139640866 16:68290558-68290580 CTCTCACTCCCCAGCTTGGCTGG + Intronic
1140405863 16:74711010-74711032 CTGTAACTGTCCAGTGGGGTTGG - Intergenic
1140504660 16:75464039-75464061 CTCTGACTCCTCAGCGCGGCCGG + Intronic
1140512206 16:75516824-75516846 CTCTGACTCCTCAGCCGGGCCGG + Intergenic
1142018527 16:87765667-87765689 CTCCAGCTCTCCCGCAGGGCCGG + Intronic
1142860235 17:2756363-2756385 CTCTGACTTCCCAGCGGGCCAGG - Intergenic
1143319297 17:6057708-6057730 CTGTAACTCCCCAGTGTGGCCGG - Intronic
1146146833 17:30426315-30426337 CTCCAATTCTCCTGCGTGGCTGG - Intronic
1148462025 17:47844391-47844413 CTCATACTTTCCAGCTGGGCAGG + Intergenic
1149595494 17:57862411-57862433 CTCTGACTCCCCAGCTGGACTGG - Exonic
1152714322 17:81891287-81891309 CTCCCACTCTCCGGCGCGGCCGG + Intronic
1153557275 18:6328803-6328825 CTCTGACTCTCCAGCTTAGCTGG + Intronic
1153949401 18:10045517-10045539 CACTGACTCTCCAGGGGGGCAGG + Intergenic
1154444146 18:14420129-14420151 CTCTAACTATCCAGTGGCTCTGG + Intergenic
1163654116 19:18535762-18535784 CTGTAACTTTCCAGGGGGGAGGG + Intronic
1166317313 19:41996415-41996437 CTCTTGCTCTCCAGCTGGGCCGG + Intronic
1167463205 19:49637036-49637058 CCCTCACTGTCCAGCCGGGCTGG + Exonic
1167716922 19:51148078-51148100 ATCTACCTCTCTAGCAGGGCTGG + Intronic
926782457 2:16486218-16486240 CTCTAATTCTTCTGAGGGGCTGG - Intergenic
930033581 2:47072378-47072400 CTCTCCCTCTCCAGAGGCGCTGG - Intronic
931355930 2:61537828-61537850 CCCTCACTCCCCAGCCGGGCGGG - Exonic
939099982 2:137884735-137884757 CTCTAACTATCCAGTGGCTCAGG - Intergenic
946192380 2:218014302-218014324 CTCTATCTCTCCAGCGGGTGGGG - Intergenic
1173711847 20:45164802-45164824 CTCTAACTCTGGAGTGGGGGTGG - Intergenic
1176451836 21:6869728-6869750 CTCTAACTATCCAGTGGCTCTGG - Intergenic
1176830008 21:13734779-13734801 CTCTAACTATCCAGTGGCTCTGG - Intergenic
1179070428 21:38065918-38065940 CTCTAAGTCTGCAGAGAGGCTGG - Intronic
1179544906 21:42107440-42107462 CTCTCACTCTGCAGAGGGGATGG - Intronic
1183706101 22:39475696-39475718 CCCCATCTCTCCAGCGGTGCTGG + Intronic
949472361 3:4409703-4409725 CTTTTACTTTCCAGCGGGGCTGG - Intronic
949743492 3:7263288-7263310 CTCTCCCTCTCCAGCGCAGCAGG - Intronic
950376357 3:12575482-12575504 CTCAAATTCTCCAGCAGGACAGG + Intronic
957445482 3:80309427-80309449 CTTTAACACTTCAGTGGGGCCGG - Intergenic
962013054 3:131411982-131412004 CTCTAAATCTCTAGCAAGGCCGG - Intergenic
962877800 3:139549241-139549263 CTCTATCTCTCCAGAGGCACTGG - Intergenic
970354531 4:15238907-15238929 CTCTACCACTCCAAAGGGGCAGG + Intergenic
971393073 4:26203972-26203994 GTCTCACTCTCCCACGGGGCTGG + Intronic
975000915 4:69222891-69222913 CTTTAACACTTCAGTGGGGCTGG + Intergenic
975004530 4:69269377-69269399 CTATAACACTTCAGTGGGGCTGG - Intergenic
975394350 4:73857402-73857424 ATTTAACTTTCCAGCTGGGCTGG - Intergenic
976391451 4:84508930-84508952 ATCTAACTCTCCCATGGGGCTGG - Intergenic
980998234 4:139802122-139802144 CTCTAACTCTCCAGCTCCACTGG + Intronic
988554321 5:32223275-32223297 CTCCAACTCTCCAGTGAGGTGGG + Intergenic
989030368 5:37112456-37112478 CTTTCACTGTCCAGTGGGGCAGG - Intronic
997339529 5:133131991-133132013 ATCAAAGTCTCCAGCAGGGCCGG + Intergenic
999645756 5:153715430-153715452 CTTGAACTCTGCAGCAGGGCCGG + Intronic
1002297973 5:178241796-178241818 CTCCAGCTCTACAGAGGGGCTGG + Intronic
1007626331 6:43248255-43248277 CTCTAACACTCCAGGGGTGGGGG - Intronic
1012536501 6:100304635-100304657 CTCTAACCCTTTAGCAGGGCTGG - Intergenic
1012650229 6:101743150-101743172 CACTAACCCTCCAGTTGGGCTGG - Intronic
1021481107 7:21118200-21118222 GTCTAACTCTCTAGCAAGGCTGG + Intergenic
1028730436 7:94141854-94141876 CTCTAATTTTCCAGTGAGGCAGG - Intergenic
1029705256 7:102272677-102272699 CTCTCACCCTCCTGCAGGGCAGG + Intronic
1033123142 7:138684044-138684066 CTCTATCTCGGCAGGGGGGCAGG + Intronic
1042271809 8:66962604-66962626 ATCAAACCCTCCGGCGGGGCGGG + Intergenic
1042397194 8:68306430-68306452 CTCCACCTCCCCAGCGTGGCAGG + Intronic
1043424531 8:80135427-80135449 CTCTAACTCTCCTGGGGGGCAGG - Intronic
1047536526 8:125725197-125725219 CTCTAAGTCTCCAGAGGGCAAGG - Intergenic
1048164915 8:132053929-132053951 CTCTATCCCTCCAGCAGGACGGG - Intronic
1049772584 8:144390633-144390655 GCCTCAGTCTCCAGCGGGGCAGG - Intronic
1050716346 9:8530882-8530904 CTCTGGCTCTCCCGCTGGGCAGG + Intronic
1060404336 9:123365829-123365851 CTCTAACTCTGGAGCAGGCCTGG + Intronic
1062383750 9:136300013-136300035 CTCTGCCTCTCCAGTGGGGCAGG - Intronic
1203517345 Un_GL000213v1:14787-14809 CTCTAACTATCCAGTGGCTCTGG + Intergenic
1185622859 X:1464235-1464257 CTCTGACTCTCCAGGGGTGCTGG - Exonic
1199298353 X:146184738-146184760 ATCTAAATCTCCAGCAAGGCCGG + Intergenic
1199675903 X:150189220-150189242 CTCTACCTCCCCAGAGAGGCAGG + Intergenic
1200014565 X:153148300-153148322 CTGTAACTCTGCCGTGGGGCAGG - Intergenic
1200025037 X:153251654-153251676 CTGTAACTCTGCCGTGGGGCAGG + Intergenic