ID: 1129520098

View in Genome Browser
Species Human (GRCh38)
Location 15:76180417-76180439
Sequence CAGGGTAAGCCTGGGGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 266}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129520087_1129520098 9 Left 1129520087 15:76180385-76180407 CCCCTCTGTTGGGATTCGTCTGA 0: 1
1: 0
2: 7
3: 33
4: 142
Right 1129520098 15:76180417-76180439 CAGGGTAAGCCTGGGGTTGTGGG 0: 1
1: 0
2: 4
3: 33
4: 266
1129520088_1129520098 8 Left 1129520088 15:76180386-76180408 CCCTCTGTTGGGATTCGTCTGAT 0: 1
1: 1
2: 32
3: 111
4: 342
Right 1129520098 15:76180417-76180439 CAGGGTAAGCCTGGGGTTGTGGG 0: 1
1: 0
2: 4
3: 33
4: 266
1129520089_1129520098 7 Left 1129520089 15:76180387-76180409 CCTCTGTTGGGATTCGTCTGATG 0: 1
1: 1
2: 25
3: 109
4: 305
Right 1129520098 15:76180417-76180439 CAGGGTAAGCCTGGGGTTGTGGG 0: 1
1: 0
2: 4
3: 33
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129520098 Original CRISPR CAGGGTAAGCCTGGGGTTGT GGG Intronic
900164658 1:1239873-1239895 CAGGGTCGGCCTGCGGTTCTGGG + Intergenic
901514022 1:9733220-9733242 CAGGTTACACCTGGGCTTGTTGG - Intronic
901562952 1:10087589-10087611 CATGATAAGACTGGGGTTGTGGG + Intronic
901940132 1:12655632-12655654 CTGGGTGACCCTGGGTTTGTGGG + Intronic
902905559 1:19554158-19554180 AGGTGTAAGCCTGGAGTTGTTGG + Intergenic
903065139 1:20695550-20695572 AAGGGTAGGACTGGGGCTGTGGG - Intronic
903187007 1:21634517-21634539 CAGGGTCCCCCTGGGGGTGTGGG + Intronic
903471679 1:23591843-23591865 CAGGCCAAGCCTGGGGGTGGGGG + Intronic
904033444 1:27547242-27547264 CTGGGTGAGTCTGGGGATGTGGG - Exonic
906131917 1:43465302-43465324 CAGGGTAAGACTGGGAAGGTGGG - Intergenic
908050448 1:60224090-60224112 CAAGGTAAGCATGGGGTAGGAGG + Intergenic
908111006 1:60897265-60897287 CACCGTGAGCCTGGGGTGGTGGG + Intronic
908437408 1:64120220-64120242 CATGGAAAGCCTGGAGTTGGGGG + Intronic
910219167 1:84872961-84872983 CATGATTAGCCTGGGGTTATGGG - Intronic
910945381 1:92586045-92586067 CATGGTAAGACTAGGGTTATGGG + Intronic
912276141 1:108260934-108260956 CAGAATAAGCCTGTGGGTGTTGG + Intergenic
912292087 1:108433424-108433446 CAGAATAAGCCTGTGGGTGTTGG - Intronic
912312070 1:108632882-108632904 CAGGCTGAGCCCGGGGTTGAAGG - Intronic
914204057 1:145511525-145511547 CAGGAGAAGCTTGGGGTTGGGGG + Intergenic
914483181 1:148084679-148084701 CAGGAGAAGCTTGGGGTTGGGGG + Intergenic
915674253 1:157515794-157515816 CAGGGTGGGCCTGGGGGTGGGGG + Intronic
916533666 1:165682352-165682374 CAGGGTGAGCCTGGTGTATTGGG - Intronic
917198963 1:172495750-172495772 CTGGCTAAGCCTGGTGTTATAGG - Intergenic
919851701 1:201677295-201677317 TGGGGTGAGCCTGGGGTTGGGGG - Intronic
922933165 1:229405690-229405712 CATGATTAGCCTGGGGTTGTGGG - Intergenic
923498547 1:234545449-234545471 CAGTGTGAGCCTGGGGGAGTGGG - Intergenic
1063114320 10:3063501-3063523 CAGGCTGGGCCTGAGGTTGTCGG + Intergenic
1067085645 10:43236910-43236932 CAGGGCCAGCCTGGCCTTGTGGG + Intronic
1067363604 10:45604371-45604393 CATGGTTACACTGGGGTTGTGGG + Intergenic
1067703640 10:48590848-48590870 CAGGGTAGGGCTGGGGTGGGTGG + Intronic
1069798665 10:71069113-71069135 CAGAGCAGGCCTGGGGTTGTTGG + Intergenic
1070436491 10:76398693-76398715 CAGGGAATGCCTTGGGTTTTTGG + Intronic
1071439960 10:85681515-85681537 CTGGGGAAGCCTCGGGTCGTGGG - Intronic
1071563914 10:86661987-86662009 CAGGGAGAGCCTGGGGATGTTGG - Intronic
1071610510 10:87027334-87027356 CAGAGTCAGCCTGGGGGTGATGG + Intergenic
1071667558 10:87575871-87575893 CAGGGTAATACTGGCCTTGTAGG + Intergenic
1072749442 10:97966822-97966844 CAGGGTTAGACTGGGGTTAGTGG + Intronic
1074423467 10:113329892-113329914 CAAAGTAAGCCTGGGGGTGGGGG + Intergenic
1075991304 10:126841198-126841220 CAGGCTAAGCCTGGGGAGGCTGG - Intergenic
1076024338 10:127100037-127100059 AAGGGTGAGTCTGGGGTGGTGGG + Intronic
1076525565 10:131110469-131110491 CAGGGTAAACCTGGGGCTCCTGG - Intronic
1077034413 11:487904-487926 CAGGGTGAGCGTGGGGTGGGTGG - Intronic
1080397490 11:31903271-31903293 CAGAGGCAGCCTGGGGCTGTAGG - Intronic
1083300702 11:61738320-61738342 CAGGGTGTGGCTGGTGTTGTGGG + Intronic
1083686979 11:64382394-64382416 CAGGGTAAGCCTGGGAGCCTCGG - Intergenic
1084008227 11:66334248-66334270 CAGGGGAAGACTGGGGGTATGGG + Intronic
1088798275 11:113283013-113283035 GAGGGTAAGTCAGGGGTTGCTGG + Intergenic
1089050469 11:115540733-115540755 CCTGGTTAGCCTGGGGTTCTTGG - Intergenic
1089350404 11:117818772-117818794 CAGAGAAGGCCTGGGGTTGTGGG - Intronic
1089463627 11:118668243-118668265 CAGGGTAATACTGGCTTTGTAGG - Intronic
1090071973 11:123551628-123551650 CATGGTAAACCTGGGATTGTGGG + Intronic
1092008636 12:5090062-5090084 CATGATTAGGCTGGGGTTGTGGG + Intergenic
1092171011 12:6374150-6374172 CTGGGTGAGCCTGGGGTGCTAGG + Intronic
1092252133 12:6905366-6905388 CAGGAAAGGCCTGGGGGTGTGGG + Intronic
1092866076 12:12762638-12762660 CAGGGTAAGGCTGGGCGTGGTGG - Intronic
1093054779 12:14545188-14545210 AACGGTAAGCTTGGGGGTGTGGG - Intronic
1096477125 12:51915140-51915162 CAGGGTCAGGGTGGGGTTGGGGG - Intronic
1096656281 12:53094475-53094497 AAGTGTAATCCTGGGGTGGTGGG + Intergenic
1096870622 12:54589993-54590015 CAGGGTAAGGCTGGGGTTATGGG + Intergenic
1101558179 12:105830570-105830592 CAAGGTAAGCCAAGGATTGTTGG - Intergenic
1103146376 12:118598498-118598520 CAGGGTCAGCCCTGGTTTGTGGG + Intergenic
1104731235 12:131106576-131106598 CAGGATAAGCCTGTGGTCTTAGG + Intronic
1104834927 12:131783408-131783430 CAGAGTTAGCCTGGGCTTCTGGG + Intronic
1104965187 12:132505764-132505786 CAGGGTAAGGCTGGCCCTGTGGG - Intronic
1105719598 13:23100797-23100819 CAGGAACAGCCTGGGTTTGTTGG - Intergenic
1106414769 13:29537323-29537345 CATGGTTAGCCTGGGGCTGTGGG - Intronic
1107549540 13:41462084-41462106 CAGGGAATGGCTGGGGGTGTGGG - Intronic
1108621599 13:52190290-52190312 CAGGGGAGGCCTGGGGGTGCTGG + Intergenic
1108665087 13:52621588-52621610 CAGGGGAGGCCTGGGGGTGCTGG - Intergenic
1113452900 13:110424731-110424753 CAGGGTCAGCCTGGGCCAGTGGG + Exonic
1113982796 13:114290232-114290254 CAGGGACAGTCTGTGGTTGTAGG - Intronic
1116282732 14:42929105-42929127 CATGGCAAGCCTTGGGGTGTGGG + Intergenic
1118920177 14:70143025-70143047 CAGGGTAAGCTGGGGGTAGCTGG - Intronic
1119263106 14:73249909-73249931 TAGGGTAAGCCTTGGGTCTTGGG + Intronic
1122439473 14:101720091-101720113 CATGGTTAGACTGGGGTTATGGG - Intergenic
1122691067 14:103532398-103532420 CAGGGCTAGCCTGGGGCTTTAGG + Intronic
1123012494 14:105356162-105356184 CAGGCTGGGCCTGGGGGTGTGGG - Intronic
1123192833 14:106587340-106587362 CAGAGTAAGCCTGGGTATCTGGG + Intergenic
1124407944 15:29408381-29408403 CTGGGAAATCCTGGGCTTGTAGG + Intronic
1126009999 15:44293607-44293629 CAGGATTAGACTGGAGTTGTGGG + Intronic
1126336585 15:47591652-47591674 CAGGTTAAGCCTGAGACTGTAGG + Intronic
1126522024 15:49605845-49605867 GAGGGATAGCCTGGGGCTGTGGG + Intronic
1127085135 15:55417498-55417520 CAGGGTTAGCCTGGGTATGTGGG - Intronic
1127932755 15:63607891-63607913 CAGGGTGAGCCTGTGTTTCTGGG - Intergenic
1128060495 15:64732474-64732496 CAGGGAAAGCTGGGGGTTATTGG - Intergenic
1128108242 15:65059775-65059797 GTGGGAAAGCCTGGGGTTCTGGG - Intronic
1128310919 15:66631356-66631378 CAGGGTCAGTCTGGGGTGGGTGG + Intronic
1128603076 15:69014402-69014424 CAGGGCCTGCCTGGAGTTGTTGG + Intronic
1128740703 15:70082038-70082060 CAGGGAAAGGCTGGGGTGGGAGG + Intronic
1129520098 15:76180417-76180439 CAGGGTAAGCCTGGGGTTGTGGG + Intronic
1130726776 15:86447367-86447389 CAGGGAAAGCCTGAAGCTGTTGG + Intronic
1130957727 15:88639175-88639197 CAGGGTAAGGCAGGGGATGGGGG + Intronic
1131398055 15:92102584-92102606 CAGTGTAAGCCTGGAGTACTTGG - Intronic
1132234483 15:100208897-100208919 CAGGTAAAGCCTGGTGTTGCAGG - Intronic
1132355578 15:101169015-101169037 CAGGGCAGGCCTGGGCTTGGGGG - Intergenic
1132389574 15:101428458-101428480 CAGGGTAAGCATGGTGTTGTAGG - Intronic
1132410636 15:101575855-101575877 CAGTGGTAGCCTGGGGTTGGGGG + Intergenic
1132671350 16:1103374-1103396 CAGGCTCAGCCTGGCGTTGGGGG + Intergenic
1132738445 16:1398878-1398900 CAGGGCGACCCTTGGGTTGTTGG + Exonic
1133150646 16:3826589-3826611 CATGGTAAGACTGGGCTTATGGG - Intronic
1134236735 16:12472231-12472253 CAGGGGAAGGCTGGGGGTGGTGG + Intronic
1135671418 16:24378720-24378742 GAGGATAAGCCTGGGGTAGTAGG - Intergenic
1136111310 16:28065028-28065050 CTCGGCAAGCCGGGGGTTGTCGG - Intergenic
1136593110 16:31229565-31229587 CAGGGTCTCCCTGGGGATGTAGG + Intergenic
1138324640 16:56154341-56154363 CATGATTAGGCTGGGGTTGTGGG + Intergenic
1138598854 16:58043409-58043431 CTGGGTAGGCCTGAGGTTGAGGG - Intronic
1139884004 16:70196097-70196119 CAGGGTGGGCCAGGTGTTGTAGG + Intergenic
1140740139 16:77934308-77934330 CAGGGTCATCTTGGGGGTGTGGG - Intronic
1140840137 16:78830860-78830882 GAGGGTAAGGATGGGGCTGTAGG - Intronic
1141896318 16:86960949-86960971 CAGGGTTGGCCTGGGGTGCTTGG - Intergenic
1142811628 17:2398144-2398166 CAGGGTAAGCCTTGGAGAGTTGG + Intronic
1143015826 17:3890674-3890696 GAGAGTAAGTGTGGGGTTGTGGG - Intronic
1143107413 17:4536585-4536607 CAGGGTCAGCCTGGAGCTGTGGG + Intronic
1143757246 17:9075971-9075993 AAGGGTGAACCTGGGGTTGAGGG - Intronic
1143976208 17:10831804-10831826 CAGGAGAAGCCTGGAGTTGCAGG + Intronic
1145939910 17:28737867-28737889 CAGTGTATGCCTGGGGTGGTGGG + Exonic
1147544752 17:41392761-41392783 CTGGGAAAGCCTGGTGTGGTGGG + Intronic
1147627034 17:41906987-41907009 CTGGGGAGGCCTGGGGTTGGGGG - Intronic
1150480309 17:65503996-65504018 CAGGGAAAGCCTGGGGATGGAGG + Intergenic
1150536074 17:66042440-66042462 CATGATTAGACTGGGGTTGTGGG - Intronic
1150636771 17:66918651-66918673 CTGGGTCAGCCTGGGGTTCAAGG - Intergenic
1151192796 17:72410916-72410938 CGGGGTATGCCTGGGATTGGGGG + Intergenic
1151360168 17:73584001-73584023 CAGAGGAAACTTGGGGTTGTGGG + Intronic
1152636575 17:81432791-81432813 GAGGGTGGGCCTGGGGATGTGGG - Intronic
1155526527 18:26721514-26721536 CAGGGAAAGCCTAGGGATGCAGG - Intergenic
1157485047 18:48080810-48080832 CAGGGGAAACCTGGGGCTCTCGG - Intronic
1157949118 18:52014758-52014780 CATGGGAAGACTGGGGTTCTTGG - Intergenic
1158919831 18:62179091-62179113 CATGGTAAGTCTGGGGTTATGGG + Intronic
1159693829 18:71527958-71527980 CACAGTTAGCCTGGGGTTATGGG + Intergenic
1160205507 18:76828139-76828161 CAGTGTAAGCTAGGGGTAGTAGG + Intronic
1160403561 18:78629130-78629152 CATGGTGAGGCTGGGGTTGGAGG + Intergenic
1160580690 18:79883215-79883237 CTGGGAAAGCCAGGGGTTGGGGG + Intronic
1160787442 19:907604-907626 CAGGGTAGCTCTGGGGTTCTGGG - Intronic
1161342539 19:3751124-3751146 CAGGGCAGGCCTGGGCTCGTGGG + Intronic
1161596216 19:5152279-5152301 CAGGGGAAGCCCGGGGGTCTGGG + Exonic
1161903184 19:7135113-7135135 CACGATAAGCATGGGGTTGTTGG - Intronic
1162050312 19:8028784-8028806 CAGGGCAGGCCTGGGGTTGGGGG + Intronic
1162318980 19:9959803-9959825 CAAGGTGAGCCTGGGGAGGTGGG + Exonic
1162495989 19:11023715-11023737 CAGGGCAGGCCTGGGACTGTGGG - Intronic
1162972701 19:14190608-14190630 CAGGGGAAGGCGGGGGATGTAGG - Intronic
1163258752 19:16173748-16173770 CAAGGTGAGGCTGGGGTTATGGG + Intergenic
1163496573 19:17649413-17649435 CATGGTCAACCTGGGGTTGGGGG - Intronic
1164028804 19:21381470-21381492 AAAGGTAAGCCTGAGCTTGTAGG - Intergenic
1164646434 19:29861892-29861914 CAGTGTAAGCCTGGAGCTGCTGG - Intergenic
1165435391 19:35792225-35792247 GAGGGTAAGTCTGGGGTGGCTGG + Intergenic
1165474971 19:36025165-36025187 GAGGGTGGGCCTGGGGGTGTAGG + Intronic
1165723448 19:38095955-38095977 CTGGGTGGCCCTGGGGTTGTGGG - Intronic
1166373466 19:42314703-42314725 CAGGCTCAGCCTGGGGGAGTGGG + Intronic
1166387241 19:42389205-42389227 CAGGGACAGACTGGGGTTGCCGG - Intronic
1167234296 19:48304211-48304233 CGGGGTCAGCCAGAGGTTGTGGG + Intronic
1168170773 19:54587211-54587233 CTGTGTAATCCTGGGGGTGTTGG - Exonic
925335799 2:3098385-3098407 CAGTGTAAGCCTTGTGGTGTTGG - Intergenic
926285152 2:11482524-11482546 CAGGGTAAGACTGGGGTTCCAGG + Intergenic
926326271 2:11786850-11786872 CAGGGCAAGGCTGAGGATGTTGG - Intronic
927828419 2:26326743-26326765 CATGGTAAACCTGTGGTTATGGG - Intronic
929210996 2:39357000-39357022 CAGGATAAGCCTGTGAATGTGGG - Intronic
931422737 2:62143222-62143244 CAGGGTCAGCCTGGGGCTCCAGG - Intronic
931638947 2:64364437-64364459 CAGGTGAAGCCTGGGGATGTGGG - Intergenic
932887526 2:75560850-75560872 CAGGGCTGGCCTGGGGATGTGGG + Intronic
933647226 2:84822575-84822597 CTGGGTAAGCCTGAGGTCATGGG - Intronic
934874312 2:97901476-97901498 TACGGTAAACCTGGGGTTGCAGG - Intronic
937287674 2:120763419-120763441 CAGAGAAAGCCTGGGGAAGTGGG + Intronic
937469396 2:122162383-122162405 CAGGGTGAGCCTCGGGATGAAGG + Intergenic
937727514 2:125185647-125185669 CAGGGTAAACAAGGTGTTGTAGG + Intergenic
938024427 2:127933809-127933831 CAGGGTAATACTGGACTTGTAGG - Intergenic
938654167 2:133413700-133413722 CAGGGTGGGCCTGGTGTTGCCGG - Intronic
940316271 2:152330799-152330821 CAGGGTAATCCAGTGGTGGTGGG - Intergenic
942187749 2:173440436-173440458 CATGATTAGCCTGGGGTTGTGGG + Intergenic
942268291 2:174248893-174248915 CTGGGAAAGCTTGGGGCTGTAGG - Intergenic
942309027 2:174636774-174636796 CTTGGTAAGACTGGGGTTATGGG + Intronic
942994676 2:182246697-182246719 CAGGGTAAGGCTGGGCATGGTGG - Intronic
946006602 2:216530580-216530602 CATGATTAGCCTGGGGTTTTGGG + Intronic
947137081 2:226986079-226986101 CATGGTTAGACTGGGGTTATGGG - Intronic
947796401 2:232896604-232896626 GAGGGTAAGGTTGGGGTTGAGGG + Intronic
947894708 2:233658631-233658653 CATGGTTAGACTGGGGTTATAGG + Intronic
949063758 2:241976596-241976618 CATGGTTAGCCTGAGGTGGTGGG + Intergenic
1168975484 20:1962514-1962536 AAGGGGAAGCCTGGGGGGGTTGG + Intergenic
1170873712 20:20231725-20231747 CAGGGCAAGGCTAGGGCTGTGGG + Intronic
1171186551 20:23127588-23127610 CAGGGAAACCCAGGGGCTGTGGG + Intergenic
1172433614 20:34913184-34913206 CAGGGTGAGTGTGGGGGTGTGGG + Exonic
1173012549 20:39195455-39195477 CAGGGCAAGCCTGGGGCAGATGG - Intergenic
1173459280 20:43229930-43229952 CATGGTAAGGCTGGGGTGGTTGG + Intergenic
1173898845 20:46572165-46572187 CAGGGTGAGCCTGGGTGTGTGGG - Intronic
1174577356 20:51545984-51546006 CAGGGTAAGCCTCAGGGTGGAGG - Intronic
1174938011 20:54893526-54893548 CAGTGTAACCCTGGGGTTCCAGG + Intergenic
1175257866 20:57657804-57657826 CTGGGGACGCCTGGGGTTGGTGG - Intronic
1178290429 21:31363295-31363317 CAGGGTAAGGCTGGGGTTAGGGG - Intronic
1178534820 21:33403121-33403143 CAGGGAAAGCCCGGGGGTCTGGG + Exonic
1179334835 21:40441020-40441042 CTGAGTAAGCTTGGGGTTGGGGG - Intronic
1179444338 21:41420747-41420769 CAGCGTGGGCCTGGGGTTGCCGG + Exonic
1179489717 21:41733470-41733492 CTGGATATGCCTGGAGTTGTGGG + Intergenic
1179918946 21:44496755-44496777 CAGGGGAAGACTGGGGAGGTGGG + Intergenic
1180638395 22:17278752-17278774 CAGAGTAAGACTGGGCTTGGTGG - Intergenic
1180869535 22:19138421-19138443 CAGGGCAAGGCTGGGGCTCTGGG + Intronic
1180970854 22:19814672-19814694 CAGGTTAAGACTGGGGTGATGGG - Intronic
1181495243 22:23283929-23283951 CAGGGCCAGCCTGGGGTGATGGG - Intronic
1183501252 22:38181069-38181091 CGGGGCAAGCCTGTGGGTGTGGG - Intronic
1184430060 22:44437426-44437448 CAGGGGCAGCCGGGGCTTGTGGG + Intergenic
1184801712 22:46764782-46764804 CAAGGAAAGCCAGGGGTTGCTGG + Intronic
1184995561 22:48205020-48205042 CATGGTAAGGCTGGTGTTCTTGG - Intergenic
1185072900 22:48667028-48667050 CAGGGACAGCCTGGGATTGAGGG + Intronic
1185153629 22:49180312-49180334 CAGAGGGAGCCTGGGGTTTTGGG - Intergenic
1185337355 22:50276565-50276587 CAGGCTCAGCATGGGGTAGTGGG + Intronic
950342588 3:12260593-12260615 CACGGTTCGACTGGGGTTGTGGG - Intergenic
951841149 3:27035495-27035517 CATGATTAGACTGGGGTTGTGGG - Intergenic
952095697 3:29950150-29950172 CAGGGTAAGCCTGGGATGGCTGG + Intronic
952367059 3:32684403-32684425 CATGGTTAGACTGGGGTTTTGGG - Intergenic
954553866 3:51503453-51503475 CAGGGTGAGGATGGGCTTGTGGG - Intergenic
954710262 3:52501953-52501975 CAGGGTAAGCGGAGGGTTCTGGG + Intronic
956692507 3:71891096-71891118 CAGGGGAACTCTGGGGTTCTTGG + Intergenic
960301939 3:116013161-116013183 TAGGGTAGGAGTGGGGTTGTAGG + Intronic
961125027 3:124409632-124409654 CAGGGTAAGCCTGGGAAGCTAGG + Intronic
961559699 3:127720145-127720167 TAGGGTAAGCCTGTGGGTGACGG + Intronic
963833890 3:150036826-150036848 TTGGGTAAGCCTGGAGTTGTTGG + Intronic
963861077 3:150311308-150311330 CTGGATAAGCCTGGGGCTGTGGG - Intergenic
964488550 3:157210180-157210202 GAGGGTGAGACTTGGGTTGTGGG + Intergenic
967036461 3:185651955-185651977 CAGGGTGAGCCTGAGCTTGGTGG + Intronic
967216584 3:187215735-187215757 CATGATTAGCCTGGGGTTATGGG + Intergenic
969125337 4:4943801-4943823 CAGGCTGAGGCAGGGGTTGTGGG + Intergenic
969176485 4:5402799-5402821 CAGAGCAAGCATGGGGCTGTGGG + Intronic
977437417 4:97016404-97016426 CAGGGTAAAAGTGGTGTTGTGGG + Intergenic
978960229 4:114668766-114668788 CATGGTAAGCCTGGTGTTGCTGG + Intronic
979499041 4:121418269-121418291 CAGGGAAAGCCTGGGGCTGAAGG + Intergenic
980520846 4:133932014-133932036 CAGGGTAAACCAGGGGCTGTGGG - Intergenic
985067605 4:186138698-186138720 CATGGTGAGACTGGGGTTATGGG + Intronic
985534524 5:456563-456585 CAGGGTGAAGCTGGGGTTGGAGG + Intronic
985842467 5:2318787-2318809 CAGGGCCAGCCAGGGGTTGGGGG - Intergenic
986199706 5:5569959-5569981 CAGGGCAGGCCTGTGCTTGTGGG + Intergenic
987049293 5:14136014-14136036 CAGGGGAAGTGTGGGGTTGGCGG - Intergenic
988437480 5:31193542-31193564 AAGGGAAAGCCTGGGGCTGAAGG + Intergenic
992100353 5:73401735-73401757 CATGGTTAGGCTGGGGTTATAGG - Intergenic
992892974 5:81221017-81221039 CAGGGTTAGCCTGGGGTTATGGG + Intronic
993687683 5:90960166-90960188 CAGTGTATGCCTAGGGTGGTAGG + Intronic
994520481 5:100828156-100828178 CTGGGAGAGCCTGGGGTTCTGGG + Intronic
997363649 5:133311661-133311683 CAGGTAAAGGCTGGGGTTGAGGG + Intronic
999289448 5:150414092-150414114 CAGAGTAAGCCTGGGTGTGGTGG + Intergenic
999858411 5:155619845-155619867 CTGGGTAAGCCTGGGGCAGCCGG - Intergenic
1002874894 6:1202032-1202054 CAGGGTAGGCCTGGGGGCGGGGG - Intergenic
1003399263 6:5778571-5778593 CAGGGTCAGCCTTGAGTTGACGG + Intergenic
1004239134 6:13902869-13902891 CAGGGTTAGGCTGGGGCTGGAGG - Intergenic
1005306569 6:24519831-24519853 CAGTGTAAGCTGTGGGTTGTGGG + Intronic
1005485014 6:26291203-26291225 CATGGGAAGCTTGGGCTTGTTGG + Intergenic
1005898584 6:30198357-30198379 CAGGGTGAGCCTGGGCAAGTAGG - Intronic
1007713299 6:43838494-43838516 CAGGGGCAGCCTGGGGCTGGGGG - Intergenic
1007767486 6:44169622-44169644 CAGGGTCAGAATGGGGTAGTGGG - Intronic
1010129851 6:72478722-72478744 TAGGCCTAGCCTGGGGTTGTGGG - Intergenic
1010326871 6:74574281-74574303 AAGGGTAAACCTGGTATTGTGGG + Intergenic
1015423829 6:133041270-133041292 CAGGGTAGGCCAGGGGGTGGGGG - Intergenic
1017706961 6:157132411-157132433 CAGCGCAAGCCTGCAGTTGTTGG + Intronic
1017951603 6:159139863-159139885 AAGGGTAAGCTTGGGTTTGTAGG + Intergenic
1019474754 7:1238727-1238749 CAGTGGAAGCCAGGAGTTGTCGG + Intergenic
1022143650 7:27515153-27515175 CAGGGTAAGGCTGAGGTCCTTGG + Intergenic
1022467655 7:30662337-30662359 CAGGGCACCCCTGGGGTTGTGGG - Intronic
1022869768 7:34463984-34464006 CATGATTAGCCTGGGGTTATGGG + Intergenic
1023117442 7:36876040-36876062 CAGGTTAAGAATGGGGCTGTGGG + Intronic
1024044993 7:45580021-45580043 AAGGATAAGCCTGGGGGTGAAGG - Intronic
1024366562 7:48527201-48527223 CAGGGTAGGCCTGGGGGAGACGG + Intronic
1025297395 7:57786925-57786947 AAGGGTAAACCTGGGGTGGGGGG - Intergenic
1026727364 7:72879882-72879904 GAGGGTAAGTCTTGGGTTTTCGG + Exonic
1027116491 7:75485845-75485867 GAGGGTAAGTCTTGGGTTTTTGG - Exonic
1027121781 7:75527546-75527568 GAGGGTAAGTCTGGGATTTTCGG - Intergenic
1027275335 7:76549858-76549880 GAGGGTAAGTCTTGGGTTTTTGG + Intergenic
1029721046 7:102364408-102364430 GAGGGTAAGTCTTGGGTTTTTGG + Exonic
1031081229 7:117258938-117258960 CTGGATCAGCCTGGGGTTGCGGG - Intergenic
1031235061 7:119165025-119165047 CAGGGTAATGCTGGTTTTGTAGG + Intergenic
1031351005 7:120731003-120731025 CAGAGTAAGCATGGAGTAGTTGG + Intronic
1032860783 7:135877231-135877253 CAGGTGAAGCCTGGAGGTGTAGG - Intergenic
1033188388 7:139251596-139251618 CAGGGTTAGGCTGGGGTTATAGG + Intronic
1034412400 7:150948209-150948231 CAGGGCAAGCCTAGGCTTTTTGG - Intronic
1034763286 7:153693942-153693964 CAGGGTTTGCCAGGGGCTGTCGG - Intergenic
1034947431 7:155272032-155272054 CACCGTTAGACTGGGGTTGTGGG - Intergenic
1035092883 7:156329213-156329235 GATGGGAAGCCTGGGGCTGTGGG - Intergenic
1036402445 8:8422068-8422090 CATGGTTAGACTGGGGTTGTGGG + Intergenic
1036496653 8:9276266-9276288 CAGGGATGGCCTGAGGTTGTAGG - Intergenic
1037276818 8:17189290-17189312 CAGGGAAAGCCGAGGGTAGTGGG - Intronic
1037923491 8:22826018-22826040 CAGGGTTGGCGTGGGGTGGTGGG + Intronic
1040573544 8:48630423-48630445 CATGGTTAGACTGGTGTTGTGGG + Intergenic
1044109423 8:88253513-88253535 CATGATTAGACTGGGGTTGTAGG - Intronic
1044536751 8:93365680-93365702 CAGAGTAAATCTGGGGGTGTGGG - Intergenic
1047197824 8:122737647-122737669 CAGGGTAGGCAGGGGCTTGTGGG - Intergenic
1047267207 8:123316761-123316783 TAGGGAATGCCTGGGGTTGGGGG + Intergenic
1047810540 8:128403848-128403870 CAGGGTAAGCCTTGTGGTGAAGG + Intergenic
1048375474 8:133818928-133818950 CAGGGTCAGCTTGGGGTGGGGGG + Intergenic
1049337293 8:142093305-142093327 AAGGGAAAGCCTGGGGCTGTGGG + Intergenic
1049410731 8:142472925-142472947 CAGGGTCAGGCTTGGTTTGTGGG + Intronic
1050928602 9:11297256-11297278 CCTGGTAAGCCTGGGGATATGGG + Intergenic
1051421023 9:16889448-16889470 CAGGGTCACCCTGTGGTTGAAGG + Intergenic
1057841877 9:98492746-98492768 CATGGTTAGACTGGGGTTATGGG + Intronic
1060884558 9:127141199-127141221 CAGGGAATGCCAGGGGTTGTGGG + Intronic
1060911831 9:127357374-127357396 CAGGGTAAGCCAGCGGTTGTGGG + Exonic
1062364371 9:136202002-136202024 CAGCGTAAGGCTGGGGTCGCGGG - Intronic
1062697227 9:137881603-137881625 CAGGGTTGGCATGGGGGTGTCGG - Intronic
1186433101 X:9521322-9521344 CAGGGAAAGCCAGAGGTGGTGGG + Intronic
1189891035 X:45602914-45602936 AAGGATCTGCCTGGGGTTGTGGG + Intergenic
1189891848 X:45610857-45610879 CATGGTAAGCCTGGGGGAATGGG + Intergenic
1190708517 X:53049264-53049286 CTGGGTAGGGCTGGGGGTGTTGG - Exonic
1194577072 X:95626344-95626366 CAGGGTTAGACTGGGGTTTGGGG - Intergenic
1195165122 X:102212183-102212205 CAGGGTAATACTGGCATTGTAGG + Intergenic
1195193736 X:102474908-102474930 CAGGGTAATACTGGCATTGTAGG - Intergenic
1195761631 X:108252650-108252672 CAGGGTAATGCTGGCCTTGTAGG - Intronic
1195858591 X:109357005-109357027 AATGGTAAGCCTGGGGGTGGGGG + Intergenic
1197308994 X:124881026-124881048 CAGGGTAATGCTGGCCTTGTAGG + Intronic
1199716820 X:150512586-150512608 CAGGCTGAAGCTGGGGTTGTTGG - Exonic
1200286755 X:154830143-154830165 CAATGTAAGGCTGGGGATGTTGG + Intronic