ID: 1129523874

View in Genome Browser
Species Human (GRCh38)
Location 15:76202001-76202023
Sequence GGCTGGACTGCACTGGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 322}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129523874_1129523886 0 Left 1129523874 15:76202001-76202023 CCAGCACCCAGTGCAGTCCAGCC 0: 1
1: 0
2: 2
3: 26
4: 322
Right 1129523886 15:76202024-76202046 CCTGGGGCAGGTGAGACAGGTGG 0: 1
1: 1
2: 7
3: 112
4: 1185
1129523874_1129523882 -3 Left 1129523874 15:76202001-76202023 CCAGCACCCAGTGCAGTCCAGCC 0: 1
1: 0
2: 2
3: 26
4: 322
Right 1129523882 15:76202021-76202043 GCCCCTGGGGCAGGTGAGACAGG 0: 1
1: 0
2: 3
3: 50
4: 574
1129523874_1129523888 21 Left 1129523874 15:76202001-76202023 CCAGCACCCAGTGCAGTCCAGCC 0: 1
1: 0
2: 2
3: 26
4: 322
Right 1129523888 15:76202045-76202067 GGTCCCCATGGAGAACTAAGAGG 0: 1
1: 0
2: 0
3: 3
4: 118
1129523874_1129523887 9 Left 1129523874 15:76202001-76202023 CCAGCACCCAGTGCAGTCCAGCC 0: 1
1: 0
2: 2
3: 26
4: 322
Right 1129523887 15:76202033-76202055 GGTGAGACAGGTGGTCCCCATGG 0: 1
1: 0
2: 2
3: 28
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129523874 Original CRISPR GGCTGGACTGCACTGGGTGC TGG (reversed) Intronic
900431689 1:2605811-2605833 GGCTGGACTGGAGAGGGTGGCGG + Intronic
900432900 1:2611388-2611410 GGCAGGACTGGAGTGGGTGTGGG + Intronic
900468039 1:2835334-2835356 TGGTGGACTGCAGTGGGGGCAGG - Intergenic
900509904 1:3053831-3053853 GGCTGGAGGGCACTGGATGAGGG - Intergenic
900919826 1:5663055-5663077 GGCGGGACTGGCCTGGGTGTGGG - Intergenic
901188541 1:7390064-7390086 TGCCGGACGGCTCTGGGTGCAGG + Intronic
901604946 1:10451797-10451819 GACTGGACTGTGCTGAGTGCGGG + Exonic
902512217 1:16972625-16972647 GGCTGGACTGCAGGTGTTGCTGG - Exonic
903169195 1:21541648-21541670 GGCTTCATGGCACTGGGTGCTGG + Intronic
903281483 1:22252501-22252523 GGCTGGACTGGGCTGGGGGCTGG + Intergenic
903999986 1:27333478-27333500 GACTGGACAGTCCTGGGTGCGGG + Intronic
904414131 1:30345432-30345454 GGCTGGAGTGCAGTGGTGGCAGG - Intergenic
904533861 1:31186444-31186466 GGCTGGAGGGCAGTGGATGCTGG + Intronic
906034377 1:42741295-42741317 TCCTGGACTGCACTGGGGGAAGG + Intergenic
906244245 1:44262062-44262084 GGCTGGGCTGCGGTGGGTGGAGG - Intronic
906801255 1:48739147-48739169 TGGTGAACTGCACTGGGAGCTGG - Intronic
907586059 1:55619023-55619045 TGCTGGACTGCAGTAGGTTCTGG + Intergenic
910797798 1:91116165-91116187 GTGTGGAGTGCACTGGGTGCTGG + Intergenic
911789646 1:101997052-101997074 GGTTGGGCTGCAGTGGGCGCTGG + Intergenic
911895561 1:103429230-103429252 GGCTGGAATGAAGTGAGTGCTGG - Intergenic
913490816 1:119378193-119378215 GGCTGGAGTGCAGTTGGTTCTGG - Intronic
917803120 1:178588203-178588225 AGCAGGACTGCACTCGATGCTGG - Intergenic
920365419 1:205445695-205445717 GGCTGGAAAACACTGAGTGCAGG - Intronic
921423781 1:214978933-214978955 GGCTGGACTACACTCTGTGAAGG + Intergenic
922467512 1:225854262-225854284 GGCTGGACAGCAGTGGGCGAGGG + Intronic
922554475 1:226522225-226522247 GGCTGAGCTGGGCTGGGTGCAGG - Intergenic
923338800 1:232991050-232991072 GGCTGCACTGTCCTAGGTGCCGG + Intronic
1063365720 10:5489052-5489074 GGCCTGACTGCACTGGGCCCAGG + Intergenic
1065814678 10:29473106-29473128 GGCTGGAGTGGCCTGGGTGGAGG + Intronic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1065976773 10:30848591-30848613 GGCTGCAGTTCACTGGGCGCAGG + Exonic
1067362371 10:45594598-45594620 GGCTGGGCTGGGCTGGGTGGGGG - Intronic
1067690212 10:48497011-48497033 GGCAGCACTGCACTGGGCCCTGG + Intronic
1067726901 10:48777259-48777281 GGATGGACTGCAGCTGGTGCTGG - Intronic
1069942105 10:71963575-71963597 GGCTGGGCAGCACCGGCTGCGGG - Intergenic
1070792265 10:79196522-79196544 GGCTGGACTGAACTGGCTTCTGG - Intronic
1070807921 10:79281498-79281520 GGCAGCAGGGCACTGGGTGCTGG - Intronic
1071565453 10:86669269-86669291 GGCTGGGCTGGACTGAGTACTGG + Intronic
1072004531 10:91231570-91231592 GGCTGGACAGCAGTGAGTGAAGG + Intronic
1073331719 10:102674349-102674371 GGGTGTGTTGCACTGGGTGCAGG + Exonic
1073578427 10:104642972-104642994 GGCTGCACAGCGCTGGGTGCCGG - Intronic
1075018199 10:118926691-118926713 GGCTGGACTGAGCTGGGGACAGG - Intergenic
1075719949 10:124578770-124578792 TGCTGGGCTGCACTGGATGGTGG - Intronic
1076150383 10:128157506-128157528 GGCTGGAGTTCAGTGGGGGCAGG + Intergenic
1076534623 10:131168710-131168732 GGCTGGTCTGCCCTTAGTGCCGG + Intronic
1076765609 10:132631335-132631357 GGCTGGGCTGCAACGGGTGCTGG - Intronic
1076806797 10:132862817-132862839 GGCCGGGCTGCACTGGCTGAGGG + Intronic
1076921794 10:133458175-133458197 GTCTGCTCTGCTCTGGGTGCCGG + Intergenic
1077419136 11:2441431-2441453 GGCTGGGCTGGGCTGGGTGTGGG - Intergenic
1077502711 11:2916587-2916609 GCCTCGGCTGCACAGGGTGCGGG - Intronic
1081650471 11:44820352-44820374 GGGTGGACTGCTCTGGGCACAGG + Intronic
1083304783 11:61756597-61756619 CCCTGCCCTGCACTGGGTGCTGG - Intronic
1083647859 11:64183527-64183549 TGTTGCACTGCTCTGGGTGCAGG - Intergenic
1083674505 11:64318029-64318051 GCCTCGTTTGCACTGGGTGCTGG - Exonic
1083688129 11:64389837-64389859 TGCTGGAATGCACGGGATGCTGG + Intergenic
1083727058 11:64634159-64634181 GGCTGGAAAGCTCTGGGTGAGGG - Intronic
1084530266 11:69723169-69723191 GGGTGAACTGCACTGGGTGCAGG + Intergenic
1084714037 11:70862472-70862494 GCCTGGACTGGACTGGCTGATGG + Intronic
1084714062 11:70862622-70862644 GACTGGACTGGACTGGCTGATGG + Intronic
1085119661 11:73958931-73958953 CGCAGGACGGCCCTGGGTGCCGG - Intronic
1087507864 11:99050091-99050113 AGCTGTACTGCAATGGGTTCCGG - Intronic
1090183456 11:124720295-124720317 GGCTGGGCTGCAATGGGTCATGG + Intergenic
1090827960 11:130401153-130401175 GGCTGGGCAGCTCTGGGGGCTGG + Intergenic
1091025566 11:132137862-132137884 GGTCGGCCTGCACTGGGTGGTGG + Intronic
1091696357 12:2630689-2630711 AGCTGGAATGCAGTGGGTGAGGG - Intronic
1096080560 12:48829694-48829716 GGAGGGACACCACTGGGTGCGGG - Intergenic
1097275626 12:57811579-57811601 GGCTGGGCTGGGCTGAGTGCAGG - Intronic
1099085623 12:78242891-78242913 GGCAGGACTGTACTTGGTTCTGG - Intergenic
1102826079 12:115948838-115948860 GGATGGACTGCACTGGGTGTGGG + Intergenic
1103756060 12:123208140-123208162 GGCTGGAGTGCAGTGGTTCCAGG - Intronic
1104043943 12:125148315-125148337 GGTGGGTCTGCACTGGGCGCTGG + Intergenic
1104899043 12:132178338-132178360 GGCTGGAGTGCAGGGGGTGGGGG - Intergenic
1104959544 12:132481950-132481972 GGCTGGACAACACCGGATGCCGG + Intergenic
1105029892 12:132874836-132874858 GGGTTCCCTGCACTGGGTGCTGG - Intronic
1109589142 13:64454038-64454060 TGCTGGAATGCACTGCCTGCTGG - Intergenic
1112050468 13:95640377-95640399 TGCTGGAGAGAACTGGGTGCAGG - Intronic
1113832904 13:113310910-113310932 AGCTGGGCTGCAGTGGCTGCGGG + Intronic
1118197726 14:63643525-63643547 GGCTGGAGTGCACTGGCAGGAGG + Intergenic
1121307367 14:92915526-92915548 GCCTGGATTGAACTGGGTCCAGG + Intergenic
1122940537 14:104979061-104979083 GGCGGCACTGCCCTGGGGGCGGG + Intergenic
1124637839 15:31376158-31376180 AGATGGACTGCACAGGGTCCCGG + Exonic
1124645098 15:31432995-31433017 GGCTGGAGTGCAGTGGGCGCTGG - Intronic
1128161171 15:65423404-65423426 GGCTGGAATGGACTGGGCTCGGG - Intergenic
1129523874 15:76202001-76202023 GGCTGGACTGCACTGGGTGCTGG - Intronic
1129955889 15:79636540-79636562 GGCTGGGCTGCCCTTGGGGCTGG - Intergenic
1130396666 15:83508426-83508448 GGCTGGAGTGCAGTGAGTGAGGG + Intronic
1132673677 16:1113001-1113023 GGCTGGACGGCATGGGGTGATGG - Intergenic
1132749531 16:1451052-1451074 GGCAGCACTGTACTGCGTGCAGG + Intronic
1133058879 16:3161525-3161547 GGCCGGACTGCACAGGTGGCAGG + Intergenic
1134635815 16:15791001-15791023 GGCTGGAGTGCAGTGTGTGATGG + Intronic
1135964612 16:27025290-27025312 GGCTGGAGTGCAGTGGCGGCGGG - Intergenic
1136639692 16:31553062-31553084 TGCTGGACTGGAGTGAGTGCAGG - Intergenic
1136665070 16:31803436-31803458 TGCTGGACTGGAATGAGTGCAGG + Intergenic
1138281027 16:55772417-55772439 GGCTGCCCTGCACTGGGTCCAGG + Intergenic
1138287503 16:55821451-55821473 GGCTGCCCTGCGCTGGGTCCAGG - Exonic
1138497359 16:57416504-57416526 AGCTGGACTGCAGTGAGTGCAGG - Intergenic
1138596195 16:58030315-58030337 GGCTGGACAGCTCTGAGTGACGG + Intronic
1139446479 16:67001356-67001378 GGCGGCTCTGCGCTGGGTGCAGG + Exonic
1140758395 16:78089360-78089382 TGCTGGACAGCACCGGGGGCAGG - Intergenic
1141248565 16:82333728-82333750 GGCTCGTCTGTACTGGGTGCTGG + Intergenic
1141657735 16:85425039-85425061 GGCTGGACTGGACTGGGCTGGGG + Intergenic
1142067117 16:88068988-88069010 GGCTGGGCTGGGCTGGGTGCAGG - Intronic
1142758729 17:2030631-2030653 GCCAGGCCTGCGCTGGGTGCAGG + Intronic
1143002798 17:3805648-3805670 GCGAGGGCTGCACTGGGTGCTGG + Intergenic
1144035186 17:11358708-11358730 GGCTGGAGTGCAGTGGCGGCGGG + Intronic
1144834740 17:18150918-18150940 GCCTGGCCTGCCCAGGGTGCAGG + Intronic
1144867386 17:18345227-18345249 GGCTGGAGGGAACTGGGTGCGGG + Intronic
1145959590 17:28879694-28879716 GGCTGCACTGTCCTGGGTGTTGG - Exonic
1146915489 17:36675798-36675820 GGAGGGTCTGCACTGGGTGGAGG + Intergenic
1147119495 17:38327590-38327612 GACTGGTCAGCACTGGGGGCAGG - Exonic
1147714210 17:42493397-42493419 AGCTGGCCTGCCCTGGGAGCAGG + Intronic
1147738205 17:42654333-42654355 GGCTGGAGTGCAGTGGCAGCGGG + Intergenic
1147793261 17:43025866-43025888 GGCTGGGCTGGACGGGGTGTGGG + Intronic
1147885282 17:43680112-43680134 GGCTGGGCTGCACTGCATGCAGG - Intergenic
1148216349 17:45835838-45835860 GCCTGGACTCCACAGGGGGCTGG + Intergenic
1148913672 17:50956899-50956921 GGCTGGTAGGCTCTGGGTGCTGG + Intergenic
1149531703 17:57400791-57400813 AGCTGGGCTTGACTGGGTGCAGG + Intronic
1150106320 17:62465014-62465036 GGCTGGACGCCCCTGGATGCTGG + Intronic
1151343448 17:73486692-73486714 GACTGCACTCCACTGGGTACAGG - Intronic
1151376924 17:73695517-73695539 GGCTGGTCTGCATGGGGTGAAGG + Intergenic
1151578069 17:74962862-74962884 GGGCGGATTGCACTGGGGGCCGG - Intronic
1151743837 17:76001159-76001181 GGCTGAACTGGGCTGGGTGAAGG + Intronic
1152277036 17:79363905-79363927 GGCTGGAGTGGAGTGGGTGAGGG - Intronic
1152800574 17:82328888-82328910 GTGTGGGCTGCACTGGGAGCTGG - Intronic
1152994842 18:396904-396926 TGTTGGACTGCACTGAGGGCAGG + Intronic
1153499339 18:5732133-5732155 GGCTGGACTCATCTGGTTGCTGG - Intergenic
1154145257 18:11861454-11861476 GCCAGGCCTGCACTAGGTGCTGG + Intronic
1154202223 18:12307855-12307877 GGCTTGGCTGGACTGGGCGCGGG + Intronic
1154290530 18:13102398-13102420 TGGTGGAGTGTACTGGGTGCTGG - Intronic
1156463811 18:37336268-37336290 GGCTGGAGTGCAGTGGGCTCAGG + Intronic
1156701611 18:39832890-39832912 GGCAGCATTGAACTGGGTGCAGG - Intergenic
1157389333 18:47288116-47288138 GGCTGGGCTCCACTGGGGGTGGG + Intergenic
1157570634 18:48709950-48709972 GCCTGGACTGGATTGAGTGCAGG - Intronic
1158177235 18:54670387-54670409 AGATGGTTTGCACTGGGTGCTGG - Intergenic
1160006021 18:75069574-75069596 TGCTGGTCTTCACTGGGTGAAGG + Intergenic
1160404756 18:78637918-78637940 GTCTGCACTGCGGTGGGTGCGGG - Intergenic
1160449337 18:78951580-78951602 GGCTGGAGCCCACTGGGTGTGGG - Intergenic
1161587558 19:5113816-5113838 GGCTGGACTGCACGGGGGTGAGG - Intronic
1161966164 19:7550392-7550414 GACTGGACTGCAGTGGAGGCGGG + Exonic
1162181378 19:8871421-8871443 TCCTGGACTGCAGTGGGGGCTGG + Intronic
1162444303 19:10712871-10712893 GGCAGGATGGCACTGGGAGCTGG + Intronic
1162476625 19:10904346-10904368 GGCTGGAGTGGAGTGGCTGCAGG + Intronic
1162576650 19:11503216-11503238 GGCTGGACTGCAATGAGTGAGGG - Intronic
1162798199 19:13097558-13097580 GGCTGGACTGCTCCGGCCGCGGG + Intronic
1165946007 19:39442747-39442769 GGCTGGAGTGCACCGGCTGGTGG + Intronic
1166620140 19:44290193-44290215 GGCTGGGCTGGACTGGTTTCTGG - Intronic
1166682220 19:44776111-44776133 GGCTGGAGTGCAGTGGTTGTTGG - Intergenic
1166936016 19:46333407-46333429 AGCTGGACTCCACTCGCTGCAGG - Intronic
1167169896 19:47824094-47824116 GCCTGGCCTGCAGTGGGAGCAGG + Intronic
1167969553 19:53179492-53179514 GGCTGGAGTGCAGTGGGTTCAGG + Intronic
926736515 2:16077629-16077651 CCCAGGACTGCACTGGGTGCAGG + Intergenic
927483042 2:23469315-23469337 AGTTGGACTGCGGTGGGTGCGGG - Intronic
927516909 2:23677184-23677206 GGCTGCACACCAGTGGGTGCGGG - Intronic
927710704 2:25324091-25324113 GGCTTGTCTGCAGTGGGAGCGGG + Intronic
928361572 2:30666172-30666194 GGGTGGTGTGCACTGTGTGCTGG + Intergenic
928646350 2:33356601-33356623 GGCTGGAGTGCAGTGGATCCGGG - Intronic
929587954 2:43127824-43127846 GTGTGGACAGCACTGGGTCCTGG + Intergenic
929806927 2:45154231-45154253 GGCTGGCCTGCAAGGGCTGCTGG - Intergenic
930105075 2:47633054-47633076 GGCTGGGCTGGGCTGGGTGAGGG - Intergenic
930408814 2:50997317-50997339 GGCTGGAGTGCAATGGCAGCTGG - Intronic
930489164 2:52045699-52045721 TGCTGAATTGCTCTGGGTGCTGG + Intergenic
930724420 2:54668418-54668440 TGCTGGCGTGCTCTGGGTGCTGG - Exonic
932161736 2:69466310-69466332 TGCTGGACTGCAGTGGGTCTCGG - Intronic
935217556 2:100986440-100986462 GGTGGGACTGCACTGAGTACAGG + Intronic
936520716 2:113210491-113210513 GGCTGGTCCACCCTGGGTGCAGG + Intergenic
937456226 2:122044007-122044029 GGAGGGCCTGCACTGGGGGCTGG + Intergenic
937976723 2:127586945-127586967 AGGGGGGCTGCACTGGGTGCTGG - Intronic
938243213 2:129758904-129758926 AGCTGGGCTGCTGTGGGTGCTGG - Intergenic
940418884 2:153455589-153455611 GGCTGGAGTGAACTCCGTGCAGG + Intergenic
943476685 2:188366096-188366118 GGTTGGCCTGCTCTGGCTGCTGG - Intronic
946037296 2:216754357-216754379 GGCTGGACTGCACTAGAATCTGG + Intergenic
946157795 2:217818306-217818328 CGCTGCACTGCTCTGGGGGCTGG + Exonic
946165139 2:217859050-217859072 GGCTGGGCTGGACTGGGACCCGG - Intronic
947397487 2:229700844-229700866 GGCTGGAGTGCAGTGGCTCCTGG - Intronic
948056500 2:235012632-235012654 GGCTGGGCTGCAGTGCCTGCAGG + Intronic
948630518 2:239299737-239299759 AGCTGGACTGTGCTGGGTCCAGG - Intronic
1170628830 20:18050798-18050820 GGCACTACTGCACTGGTTGCTGG + Intronic
1172231994 20:33342948-33342970 GGCCTGACTGCACAGGGTGGAGG - Intergenic
1172393285 20:34581128-34581150 TGCTGGACAGCACTGGGTAGGGG + Intronic
1172572144 20:35979106-35979128 GGCTGGCCTGCAGTGAGTGAAGG + Intronic
1172773474 20:37394623-37394645 CCCTGGGCTGCACTGGATGCTGG + Intronic
1173799300 20:45884966-45884988 GGCTGGAGTGCAGTGGCAGCAGG - Exonic
1174067101 20:47873433-47873455 GGTGTGACTGCAGTGGGTGCTGG + Intergenic
1174114765 20:48219344-48219366 GGCTGGTCTACCGTGGGTGCTGG + Intergenic
1174339139 20:49885077-49885099 AGCAGCACTGCACTGGGTGAGGG - Intronic
1174445795 20:50590356-50590378 CGCTGGACTCCACTGCGGGCCGG - Intronic
1174593674 20:51666760-51666782 GGCGTGACTGCAGTGGGAGCAGG + Intronic
1175496748 20:59419793-59419815 GGCTGGACTGCACAGCCGGCCGG + Intergenic
1175751445 20:61500855-61500877 GGCATGCCTGCACTGGGGGCTGG - Intronic
1176042632 20:63073372-63073394 GGCCGGACTGCCCTGGGGCCAGG - Intergenic
1176103029 20:63373097-63373119 GGTGGGTCTGCACTGGGTGGCGG - Intronic
1176242576 20:64081854-64081876 TGCTGGCCTTCTCTGGGTGCTGG + Intronic
1176310129 21:5145050-5145072 GGCTGGACTCCAGTGGGAGGAGG - Intronic
1178061654 21:28859703-28859725 GGCTGGACTCCCATGGATGCTGG + Intergenic
1179537531 21:42062077-42062099 CCCTGGACTGCACCCGGTGCTGG + Intergenic
1179846927 21:44116986-44117008 GGCTGGACTCCAGTGGGAGGAGG + Intronic
1179911366 21:44450700-44450722 GGCTGGAGATGACTGGGTGCTGG - Intergenic
1180174383 21:46080647-46080669 GGCTGGGCTGCAGTGGGAGCTGG - Intergenic
1180181311 21:46119804-46119826 GCCTGGGCTGCCCTTGGTGCCGG - Exonic
1180847729 22:18993400-18993422 GGCTGGGCTGAACTGGCTCCTGG - Intergenic
1181032190 22:20153992-20154014 GGCAGGACAGCAGTGGGAGCTGG - Intergenic
1181164637 22:20976778-20976800 GGCTCCAAGGCACTGGGTGCTGG - Intronic
1182161538 22:28127330-28127352 GGCATGATTTCACTGGGTGCAGG + Intronic
1182452964 22:30432251-30432273 GGCTGCTCTGAACTGGGTGGTGG - Intergenic
1183173459 22:36204824-36204846 GGCTGGACTGCAGGAGGTGCTGG - Exonic
1183178204 22:36239637-36239659 GCCTGGACTGCAGGTGGTGCTGG - Intronic
1183517117 22:38272994-38273016 GGCTGCACTCCACTGGGCCCGGG - Exonic
1183746863 22:39697196-39697218 GGCTGGCCTCCTCTGGGTGTGGG + Intergenic
1184072635 22:42155316-42155338 GTATGGATTGTACTGGGTGCTGG + Intergenic
1184110190 22:42389681-42389703 GGCTGGGCTGGGCTGGGGGCTGG + Intronic
950282265 3:11719048-11719070 GCGAGGCCTGCACTGGGTGCAGG + Intronic
950303391 3:11900651-11900673 GGCTGGAGTGCAGTGGCTCCCGG - Intergenic
950387404 3:12670984-12671006 GGCTGGCCTGGGCTGGGTGCTGG + Intergenic
950875945 3:16273429-16273451 GGCTGGAGTGCAGTGGGTACAGG + Intronic
951218675 3:20047131-20047153 GGCTGGAGTGCAGTGGGCTCAGG + Intronic
951610866 3:24491740-24491762 GACTAGACTTCACTGGGTGATGG - Intronic
952223454 3:31349244-31349266 GGCTGGAGTGCAGTGGCAGCTGG - Intergenic
954270027 3:49500511-49500533 GTGGGTACTGCACTGGGTGCTGG + Intronic
954285496 3:49616276-49616298 GGCTGTAGAGCAGTGGGTGCTGG - Intronic
954361105 3:50123295-50123317 GGCTGGCCTGCATTGCGTGTGGG - Intergenic
954715584 3:52525173-52525195 GGCTGGGCTGCAGTGGGGGAGGG - Intronic
955965021 3:64380294-64380316 CGGTGGCCTGCGCTGGGTGCTGG + Intronic
956178897 3:66500234-66500256 CGCTGGACTGCGGTGGGCGCGGG - Exonic
962716340 3:138129120-138129142 GGGTGGACTGTCCTGGGTGGAGG - Intronic
965334080 3:167414037-167414059 GCCTGAATTGCACAGGGTGCTGG + Intergenic
967888459 3:194348206-194348228 GGGTGGGCTGAACTGGGTGGGGG - Intronic
968477681 4:820153-820175 GGCTGGGCTGAGCTGGGTCCGGG - Intronic
968477692 4:820193-820215 GGCTGGGCTGAGCTGGGTCCGGG - Intronic
968477703 4:820233-820255 GGCTGGGCTGAGCTGGGTCCGGG - Intronic
968641607 4:1717654-1717676 GGCTGAACTCCACTGAGTACGGG - Exonic
968818424 4:2833459-2833481 GTCTGAAGTGCTCTGGGTGCAGG + Intronic
968874340 4:3257445-3257467 GCTTGGACTCCACTGGGTGTGGG + Intronic
969118378 4:4888801-4888823 GCCTGGCCGACACTGGGTGCCGG + Intergenic
969724708 4:8912204-8912226 GGCAGGAGTGGACAGGGTGCTGG + Intergenic
970204866 4:13645599-13645621 GGCTGGACAGCGGTGGGTGAGGG + Intergenic
971056060 4:22914043-22914065 GTCTGGACTGCACTCAGTGCTGG + Intergenic
971910044 4:32784214-32784236 GGCTGGACTGCACTCTGATCTGG + Intergenic
977923034 4:102666829-102666851 GGCCTGGCTGCACTGGGTGGTGG - Intronic
978560120 4:110024365-110024387 GGCTGGTTTGCACTGAGTTCAGG - Intergenic
979536156 4:121823278-121823300 GTCTGGAGTGCAGTTGGTGCTGG - Intronic
980579863 4:134735330-134735352 GGCTGGAGTGCAGTGGCTCCTGG + Intergenic
980962844 4:139493389-139493411 GGCTGGAGTACAGTGGGTGGGGG + Intergenic
981717584 4:147766659-147766681 GGCTGGAGTGCAGTGTGTGTGGG - Intronic
982370329 4:154626909-154626931 GGCTGGGCTGGGCTGGGGGCCGG - Intergenic
985604428 5:850768-850790 GGCTGGGCTGGAGTCGGTGCAGG + Exonic
985631782 5:1017755-1017777 GCCTGGAGGGCTCTGGGTGCTGG + Intronic
990801264 5:59606622-59606644 GGCTGGACAGGACTGGTTGGAGG + Intronic
996416363 5:123215110-123215132 GGCTGGAGTACAGTGGCTGCAGG + Intergenic
997212403 5:132085190-132085212 GGCTGCACTCCACAGTGTGCTGG - Intergenic
997537070 5:134630730-134630752 GGCTGGAGTGCAGTGGCTCCAGG - Intronic
997690357 5:135823907-135823929 GGCTGGACTGGACAGAGTGAAGG + Intergenic
1000470376 5:161632533-161632555 GGCTGGAGTGCAGTGGCTCCTGG - Intronic
1001334047 5:170783212-170783234 GGCTGGAAAGCACTAGGTCCTGG + Intronic
1002439012 5:179254395-179254417 GGAGTGACTGCTCTGGGTGCAGG + Intronic
1003487273 6:6590515-6590537 GGCTGTACTGTACTGGGGGTTGG + Intronic
1005021983 6:21427079-21427101 GGCTGGACTGTAATGAATGCTGG + Intergenic
1005649619 6:27874598-27874620 GGCTGGAGTGCATGGAGTGCAGG - Intergenic
1006510995 6:34521068-34521090 GCCGGCACTGCACTGGATGCTGG + Intronic
1006718085 6:36132683-36132705 AGTTGGGCTGCACTGGGTTCTGG + Intronic
1007230344 6:40343763-40343785 GGGTGAACTGCTCTGGGGGCTGG + Intergenic
1007581459 6:42962681-42962703 GGCAGGACTGCACTTGGTGGAGG + Intronic
1008673531 6:53795968-53795990 GGCTGGCCTGCGGTGGCTGCGGG + Intronic
1009581411 6:65538843-65538865 GGCTGGAATGCAGTGAGTGAAGG - Intronic
1011172145 6:84517027-84517049 CACTGGACCCCACTGGGTGCAGG - Intergenic
1013087014 6:106865523-106865545 GTCAGGACTACACTGGGGGCTGG + Intergenic
1014989129 6:128052427-128052449 GGCTGGACTGCGCAGGCTGAAGG - Intronic
1015940667 6:138448484-138448506 GGGTGTATTGAACTGGGTGCTGG - Intronic
1015984205 6:138869451-138869473 AGCTGTCCTGCACTGGGTGGGGG + Intronic
1016334202 6:142986915-142986937 GGCTGGAGTGCACTGAGGGTGGG - Intergenic
1018225735 6:161626877-161626899 AGCAGGACTGCTCTGGGTGGTGG - Intronic
1018838894 6:167505222-167505244 GGTTGGACTGCAGTGGGTTTGGG + Intergenic
1019665358 7:2249528-2249550 GGCTGGACTCCACTGGGCCTGGG + Intronic
1019692399 7:2423583-2423605 GGTTGGAGTCCTCTGGGTGCTGG + Intronic
1019875159 7:3803792-3803814 GGCTGGAGTGCAGTGGTGGCTGG + Intronic
1020094775 7:5362121-5362143 GGGGAGACTGCACTGGGAGCTGG + Intronic
1022496074 7:30853946-30853968 GGCAGGGCTGCTCTGGGTGGGGG + Intronic
1022529833 7:31059933-31059955 GGGTGGACTGTAATGGGTGTGGG + Intronic
1023702874 7:42910417-42910439 TGCTATACTGCACTGGCTGCTGG + Exonic
1023758156 7:43439573-43439595 GGCGGCAGTGCACTGGGTGCTGG - Intronic
1025101090 7:56135868-56135890 GGCTTTACTGCACTGGGTAAGGG - Intergenic
1026130081 7:67612903-67612925 GGAGGGACTGCAGTGGGTACAGG + Intergenic
1026889600 7:73974237-73974259 GCCTGGACTGCATGGGGTGCTGG + Intergenic
1027157054 7:75775883-75775905 GGCTGGAGTGCAGTGGCTGAAGG + Intronic
1028248790 7:88515047-88515069 GTCTGCTCTGCAATGGGTGCTGG + Intergenic
1029545402 7:101207772-101207794 GGCTGGACTGCCCTGGGGTGGGG - Intronic
1030110496 7:106022587-106022609 GGCTGGACTGGAGTAGCTGCAGG + Intronic
1030359564 7:108580459-108580481 GGGTGGACAGCTCCGGGTGCCGG - Intergenic
1031197797 7:118638889-118638911 GGCTGGATTGCACTGGGCACTGG - Intergenic
1032529311 7:132607175-132607197 AACTGGAATGCTCTGGGTGCGGG - Intronic
1034214862 7:149397595-149397617 GGGTGGGCTGCACAGGGTGTGGG + Intergenic
1035281741 7:157782874-157782896 GCCTTGAGTGCACTCGGTGCTGG + Intronic
1035326359 7:158068396-158068418 GGCTGGACTGCAGCTGGGGCAGG + Intronic
1036203740 8:6790670-6790692 GGCTGGAGTGCGCTGGCTGAGGG + Intergenic
1036203753 8:6790740-6790762 GGCTGGAGTGCGCTGGCTGAGGG + Intergenic
1036203766 8:6790810-6790832 GGCTGGAGTGCGCTGGCTGAGGG + Intergenic
1036619470 8:10415181-10415203 GGCTGGACAGGGCTGGCTGCAGG - Intronic
1036635729 8:10548497-10548519 CGCGGGGCTGCACTGGGTCCTGG + Intronic
1036687983 8:10924480-10924502 GTCAGCACTGCACTGGGGGCCGG + Intronic
1036802736 8:11804648-11804670 GGCTGGAGTGCAGTGGTGGCGGG + Intronic
1037924503 8:22833796-22833818 GGCTGGGCCCCACTGGGTGGAGG + Intronic
1038610659 8:29057683-29057705 GGCTGGAATGCAGTGGGGGCCGG - Intronic
1039066762 8:33615482-33615504 GGCTGGAGTGCAGTGGAGGCAGG - Intergenic
1040360369 8:46658984-46659006 GGCTGGCCTGCAGATGGTGCTGG + Intergenic
1043574449 8:81642018-81642040 GGCTGGAGTGTAGTGGGTGATGG - Intergenic
1043863732 8:85352240-85352262 GGCTAGACAGCACTGAGTGTGGG + Intronic
1045506569 8:102782757-102782779 GGCTTGTCTACACTGGGTGGAGG - Intergenic
1045847820 8:106658151-106658173 GGCTGGACGGCGCCGGGGGCCGG - Intronic
1046771404 8:118120055-118120077 GGCTGGAGTGTAATGAGTGCAGG + Intergenic
1047003367 8:120595086-120595108 GGCTTGACTGCACAGGTTCCTGG + Intronic
1048364422 8:133725996-133726018 GGCTGGAGTGCAGTGGCAGCAGG - Intergenic
1049164541 8:141117905-141117927 GGCTGGCCTGCACGGGCTCCTGG + Intronic
1049247334 8:141569791-141569813 GGCTGGCCTGTGATGGGTGCTGG - Intergenic
1049344052 8:142129065-142129087 GCCTGAGCTGCTCTGGGTGCTGG - Intergenic
1049546600 8:143234604-143234626 AGCTGCACTGCCCTGGGTCCAGG - Intergenic
1049647801 8:143743882-143743904 GGCTGGAGTGCACTGGGGCTTGG + Intergenic
1049777773 8:144414349-144414371 TGCTGACCTGCACTGGCTGCAGG - Exonic
1053560743 9:39191311-39191333 GGCTGGAGTGCAGTGGCTACAGG - Intronic
1053824843 9:42011561-42011583 GGCTGGAGTGCAGTGGCTACAGG - Intronic
1054136376 9:61427644-61427666 GGCTGGAGTGCAGTGGCTACAGG + Intergenic
1054605729 9:67175802-67175824 GGCTGGAGTGCAGTGGCTACAGG + Intergenic
1057222799 9:93266910-93266932 GTCTGGACCCCACTGGGTGGTGG + Intronic
1057291408 9:93809688-93809710 GGCTGAACAGACCTGGGTGCTGG + Intergenic
1058910966 9:109519638-109519660 GGCTGGACTCCTCATGGTGCAGG + Intergenic
1059268822 9:113060166-113060188 GGCCGCCCTGCACTGGGCGCTGG - Intergenic
1059269958 9:113065615-113065637 GGCCGCCCTGCACTGGGCGCTGG - Intergenic
1059271092 9:113071063-113071085 GGCCGCCCTGCACTGGGCGCTGG - Intergenic
1059272225 9:113076509-113076531 GGCCGCCCTGCACTGGGCGCTGG - Intergenic
1059273360 9:113081951-113081973 GGCCGCCCTGCACTGGGCGCTGG - Intergenic
1059274496 9:113087397-113087419 GGCCGCCCTGCACTGGGCGCTGG - Intergenic
1060050398 9:120374534-120374556 GGCTGGACTGCTCTGAGTTTTGG - Intergenic
1061615376 9:131775550-131775572 GGCAGAGCTGCACTGGGGGCAGG - Intergenic
1061675093 9:132211116-132211138 GGCTTGACTGCCCTGGGCTCAGG + Intronic
1062013910 9:134281820-134281842 GGGTGGACGGCACTGGGCCCAGG - Intergenic
1203441691 Un_GL000219v1:15611-15633 CGCTGGACTCCGCTGGGGGCCGG + Intergenic
1203512501 Un_KI270741v1:134520-134542 CGCTGGACTCCGCTGGGGGCCGG + Intergenic
1203584514 Un_KI270746v1:52531-52553 TGCTGGACTTCAATGTGTGCGGG - Intergenic
1188931325 X:36114710-36114732 GAATGGACTGCACTGGGTGGGGG + Intronic
1189224021 X:39397729-39397751 GGCTGCTCTGCATTGGCTGCCGG + Intergenic
1189819189 X:44853791-44853813 GGCTGGACTGCACTGCAGCCTGG - Intergenic
1190741670 X:53292844-53292866 GGCTGGTGTTCACTGCGTGCAGG + Intronic
1192557373 X:72101345-72101367 GGCTGGAGAGCACTGGGGACAGG + Intergenic
1194226056 X:91259321-91259343 GGCTGGAGTGCAGTGGTGGCAGG + Intergenic
1194514192 X:94829556-94829578 GACTGGAGTGCAGTGGGTGATGG + Intergenic
1198343918 X:135741183-135741205 GGCTGCACTGCATCGGGTGTCGG + Intergenic
1199612700 X:149631618-149631640 GGCTGTGCAGCACGGGGTGCGGG - Exonic
1199699596 X:150365407-150365429 GAGTGGACTGCACTGCGAGCTGG + Intronic
1199704421 X:150411517-150411539 GGCTGAACTGGACTTGCTGCTGG - Intronic
1199790859 X:151153755-151153777 GGCGGGACTACAATGGGTGGGGG + Intergenic
1200100535 X:153687643-153687665 GCCTGGGCTGCACTAGGAGCCGG + Intronic
1200135115 X:153871046-153871068 GGATGAACAGCAGTGGGTGCCGG - Exonic
1200153384 X:153962550-153962572 GCCAGGACTGCACTCTGTGCTGG + Intronic