ID: 1129524381

View in Genome Browser
Species Human (GRCh38)
Location 15:76204579-76204601
Sequence GCTGAAGCTGGGCCACAGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 1, 2: 3, 3: 51, 4: 374}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129524381_1129524390 -6 Left 1129524381 15:76204579-76204601 CCAGCCTGTGGCCCAGCTTCAGC 0: 1
1: 1
2: 3
3: 51
4: 374
Right 1129524390 15:76204596-76204618 TTCAGCAGGGTAGAGTGTGGGGG 0: 1
1: 1
2: 1
3: 26
4: 511
1129524381_1129524388 -8 Left 1129524381 15:76204579-76204601 CCAGCCTGTGGCCCAGCTTCAGC 0: 1
1: 1
2: 3
3: 51
4: 374
Right 1129524388 15:76204594-76204616 GCTTCAGCAGGGTAGAGTGTGGG 0: 1
1: 0
2: 0
3: 14
4: 154
1129524381_1129524389 -7 Left 1129524381 15:76204579-76204601 CCAGCCTGTGGCCCAGCTTCAGC 0: 1
1: 1
2: 3
3: 51
4: 374
Right 1129524389 15:76204595-76204617 CTTCAGCAGGGTAGAGTGTGGGG 0: 1
1: 0
2: 1
3: 16
4: 222
1129524381_1129524392 -4 Left 1129524381 15:76204579-76204601 CCAGCCTGTGGCCCAGCTTCAGC 0: 1
1: 1
2: 3
3: 51
4: 374
Right 1129524392 15:76204598-76204620 CAGCAGGGTAGAGTGTGGGGGGG 0: 1
1: 0
2: 1
3: 49
4: 522
1129524381_1129524391 -5 Left 1129524381 15:76204579-76204601 CCAGCCTGTGGCCCAGCTTCAGC 0: 1
1: 1
2: 3
3: 51
4: 374
Right 1129524391 15:76204597-76204619 TCAGCAGGGTAGAGTGTGGGGGG 0: 1
1: 0
2: 2
3: 24
4: 359
1129524381_1129524387 -9 Left 1129524381 15:76204579-76204601 CCAGCCTGTGGCCCAGCTTCAGC 0: 1
1: 1
2: 3
3: 51
4: 374
Right 1129524387 15:76204593-76204615 AGCTTCAGCAGGGTAGAGTGTGG 0: 1
1: 0
2: 1
3: 21
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129524381 Original CRISPR GCTGAAGCTGGGCCACAGGC TGG (reversed) Exonic
900328198 1:2121294-2121316 GCTTATGCTGGCCCACAGCCAGG - Intronic
900359832 1:2283158-2283180 GCGGAGGCTGGGTCCCAGGCTGG + Intronic
900362652 1:2297375-2297397 TCAGGAGCAGGGCCACAGGCAGG + Intronic
900535172 1:3173506-3173528 GCTGAATCTGGCCCTCACGCAGG - Intronic
900873791 1:5326656-5326678 GCTGTATCTGAGCCACAGGAGGG - Intergenic
901060729 1:6470833-6470855 GCTGAAGCTGAGCGACATGCTGG - Exonic
901063210 1:6483250-6483272 CATGGAGCTGGGCCCCAGGCAGG + Intronic
901288696 1:8104615-8104637 GCTGAAGCTGGGACTCATGTGGG - Intergenic
901639763 1:10687307-10687329 GCTGAGGCTGGGGCACTGCCTGG - Intronic
901791596 1:11656094-11656116 GCTGAAGGTGGGGTACAGGCCGG + Exonic
901865828 1:12106168-12106190 GCTGAAGCTGGGAGAAAGGAGGG - Intronic
902404170 1:16174038-16174060 GCTGATGCTGAGCCCCAGACGGG - Intergenic
902511943 1:16971479-16971501 GCTGGAGCAGAGCCACAGCCCGG + Exonic
902833697 1:19033865-19033887 GCTGATGCTGGGCCAGATCCTGG - Intergenic
903375298 1:22862055-22862077 GCTGAAGCTGGGAGAGGGGCAGG + Intronic
903961234 1:27059070-27059092 GCTGAGGCTGAGCCCCAGCCTGG - Intergenic
904033520 1:27547515-27547537 GCTGCAGCAGGGCCACGGGGTGG + Exonic
904339410 1:29824538-29824560 GCTGAGGCTGGATCACAGGATGG - Intergenic
904353282 1:29922659-29922681 ACAGAAGCTGGGGCACAGGAGGG + Intergenic
904827299 1:33281820-33281842 GCTGCAGCAGGGCAGCAGGCAGG - Intronic
906150124 1:43582776-43582798 GGTGAAAATGGGGCACAGGCAGG - Intronic
907394027 1:54177245-54177267 GCTGCAGCTGTGGCCCAGGCAGG + Intronic
910733135 1:90420924-90420946 GCAGCAGCTTGGCCACAGGGCGG + Intergenic
912331984 1:108828341-108828363 GCTGCAGGTGGGCCACAGGAAGG - Intronic
912546196 1:110453444-110453466 GCTGAGGCTGGGCCACTTGAGGG + Intronic
912763525 1:112388882-112388904 GCTGAAGCTGACCCAAAGGCTGG - Intergenic
912938830 1:114027029-114027051 TCTGAAACTGGGGCACTGGCAGG + Intergenic
913259728 1:116987365-116987387 GCGGAAGCTGGCTCTCAGGCGGG - Exonic
913971701 1:143421963-143421985 GCTGAGCCAGGGCCACGGGCGGG - Intergenic
914066078 1:144247576-144247598 GCTGAGCCAGGGCCACGGGCGGG - Intergenic
914113073 1:144718778-144718800 GCTGAGCCAGGGCCACGGGCGGG + Intergenic
916553941 1:165876804-165876826 GCAGAAGCTGGGAGACAGGACGG - Intronic
917142786 1:171854264-171854286 GAGGAAGCTGAGGCACAGGCAGG - Intronic
917639686 1:176970953-176970975 GCTGAATGTGGGCCAGAAGCAGG - Intronic
919878194 1:201885790-201885812 GCCCAAACTGGGTCACAGGCAGG + Intergenic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
921848388 1:219907855-219907877 GCTGAACCTGAGGAACAGGCAGG + Intronic
922092927 1:222414704-222414726 GCTGAGGATGGGCCACAAGCAGG - Intergenic
922236343 1:223725595-223725617 GCTAAAGCTGGGACCCAGTCGGG - Intronic
922468315 1:225860012-225860034 GCTGTAGCTGGGGTACAGGAAGG + Intronic
1063379574 10:5575924-5575946 GCTGAGGGTGGGCCTCAGGAGGG + Intergenic
1064067597 10:12195922-12195944 CCTGAAGCTAGGTCAAAGGCGGG - Exonic
1064146581 10:12830691-12830713 GCTGAAGCAGGGGCACTTGCAGG - Exonic
1064465267 10:15573532-15573554 CCTGAATCTGGGCCACAGGTTGG + Intronic
1065404751 10:25351325-25351347 GCTGAAGCTGTCACACAGCCTGG - Intronic
1065797874 10:29323711-29323733 TCTGAAGGTGGGTCCCAGGCAGG - Intergenic
1067045559 10:42983312-42983334 GCTGCAGCTGGGCCAGAGGGAGG - Intergenic
1067205642 10:44209787-44209809 GCTGCAGCAGTGGCACAGGCTGG + Intergenic
1067288417 10:44924184-44924206 GCAGAAGCAGGGGCACAGTCGGG - Intronic
1067727168 10:48779057-48779079 TCTGAAGCTGTGCCAAGGGCTGG - Intronic
1067778370 10:49179027-49179049 GCTGCAGCTGGGGTCCAGGCAGG + Intronic
1067937601 10:50624592-50624614 GCGGAAGGTGGGCCCCAGGCGGG - Intronic
1072921884 10:99583624-99583646 GCTGAAACTGGGCAAGAGGGAGG + Intergenic
1073066032 10:100759673-100759695 GCTGAGGCAGGGCAGCAGGCTGG + Intronic
1074007168 10:109438913-109438935 GCTTAAGGTGGGCCACAGGCTGG - Intergenic
1074535428 10:114325420-114325442 GCTGAGGCCAGGCCACAGCCTGG + Intronic
1075455355 10:122581462-122581484 GCTGAAGCTCGGACACTGCCAGG - Intronic
1076165883 10:128282189-128282211 GCTGCTCCTGGGCCACACGCCGG + Intergenic
1076364694 10:129914380-129914402 GGGGAAGGTGGGGCACAGGCTGG + Intronic
1076778183 10:132709592-132709614 GTGGCAGCTGGGCCACAGGCTGG + Intronic
1076812702 10:132897607-132897629 GCTGCATCTGGCCCACAGGATGG + Intronic
1076980654 11:202846-202868 GCTCACCCTGGTCCACAGGCTGG - Intronic
1077308168 11:1877064-1877086 GCTGAGCCAGGGCCACGGGCGGG + Intronic
1077422625 11:2460168-2460190 CCCCCAGCTGGGCCACAGGCTGG - Intronic
1077755274 11:5021893-5021915 GCAGAAGCTGGATCACAGGAGGG + Intergenic
1079341314 11:19613759-19613781 GATGAAACTGGGGCACAGACAGG - Intronic
1079659580 11:23021521-23021543 GCTGAGGCTGGGGCAAAAGCTGG - Intergenic
1081639089 11:44740491-44740513 GCTGGGACTGGGCCACAGGTGGG + Intronic
1081763908 11:45595914-45595936 GCTGAAGATGTTACACAGGCTGG + Intergenic
1083248218 11:61446600-61446622 GCAGAATGAGGGCCACAGGCAGG + Exonic
1083773972 11:64884146-64884168 GTGGCAGCTGGGCCACAGGACGG - Intronic
1083844614 11:65323890-65323912 TGTGAAGCTGGAACACAGGCTGG + Intergenic
1084239090 11:67806225-67806247 GCCGAAGCGGGGCCAGGGGCGGG + Intergenic
1084649126 11:70478299-70478321 GCTGAACATGGGCCAGGGGCTGG + Intronic
1085032285 11:73280060-73280082 GGGCAAGCTGGGCCCCAGGCAGG + Intronic
1085046300 11:73355741-73355763 GCGGAGGCTGGCCCACTGGCTGG - Intronic
1085252153 11:75150997-75151019 GCTGAGGCTGAGCCTCAGGGAGG + Exonic
1085638497 11:78176516-78176538 GCTGAATCTGGTCCACAGGTTGG - Intronic
1089079967 11:115767487-115767509 GCTCAAGCTGGTCCCCAGCCAGG + Intergenic
1089291705 11:117441300-117441322 GCTGTAGCTAGACCACAGGTGGG + Intronic
1089367351 11:117929211-117929233 GCTGAGGCTGGGAGACAGGTGGG - Intronic
1089621065 11:119722528-119722550 GCCCCAGCTGGGCCACAGCCAGG + Intronic
1089764997 11:120756786-120756808 CCTGAGGCTGGGACACAGGTGGG + Intronic
1090884367 11:130862678-130862700 GCTGAGGCTGAGCCCCAGCCAGG - Intergenic
1091235497 11:134019657-134019679 GCTGAAGCTGGACAAGAGGCAGG + Intergenic
1091389513 12:117560-117582 CCTCAAGGTGGGCCACAGGGTGG - Intronic
1092196977 12:6555594-6555616 GCTGCAGCTGGGCGCCCGGCCGG - Exonic
1092526974 12:9315344-9315366 GGTGATGCTGGGGCCCAGGCTGG + Intergenic
1092540298 12:9416434-9416456 GGTGATGCTGGGGCCCAGGCTGG - Intergenic
1094512751 12:31106042-31106064 GGTGATGCTGGGGCCCAGGCTGG + Intergenic
1096579119 12:52573193-52573215 GGTGCAGCTGGGCCTCAGGAAGG - Intronic
1098070911 12:66673766-66673788 GCTGCAGCTGGGTCCCAGGCAGG - Intronic
1100400662 12:94226368-94226390 CCTGAAGCTGGGTCACCTGCTGG - Intronic
1101745396 12:107537873-107537895 CCCTAAGCTGGGCCACAGCCTGG - Intronic
1102190307 12:110982806-110982828 GCTGAAGCTAGCCCACAGACAGG + Intergenic
1102391404 12:112551809-112551831 GCTGAGGATGGGTCATAGGCAGG + Intergenic
1102514602 12:113437909-113437931 GCTAAGGCTGCCCCACAGGCAGG - Exonic
1103916846 12:124380210-124380232 GCTGGAGCTGGGCCTCATGGAGG + Intronic
1104560912 12:129843609-129843631 GCGGAAACAGGGACACAGGCAGG + Intronic
1104641858 12:130472073-130472095 GCTGAAGCTGATCCAGAGGAGGG + Intronic
1104689448 12:130814368-130814390 GCTGCAGCTGTCCCACAGGAGGG + Intronic
1104889370 12:132132899-132132921 GCTGAGGCTGGGACGCAGGTGGG + Intergenic
1104962431 12:132494549-132494571 GCTGCGCCTGGGCCACAGGGAGG + Intronic
1104990150 12:132620110-132620132 GGGGAGGCTGGGCCCCAGGCCGG - Intronic
1105040286 12:132956044-132956066 GCGGAAGGCGGGCCTCAGGCGGG - Intronic
1105291518 13:19056510-19056532 GCTCACGCTGGGCCACATGGAGG - Intergenic
1106480730 13:30135281-30135303 ACTGAAGCTGGGCCCTTGGCTGG - Intergenic
1109480510 13:62945989-62946011 TTTGAAACTGGGCAACAGGCAGG - Intergenic
1109765842 13:66895997-66896019 GCAGGAGCTGGGCCACAGCAAGG + Intronic
1111508437 13:89227540-89227562 GCTAAAGCTGGGCCAGAGACAGG + Intergenic
1112240691 13:97678635-97678657 GCTGAGGCTGGGTCACATGTGGG - Intergenic
1112799973 13:103099878-103099900 ACTGGAGCAGGGCCAAAGGCAGG + Intergenic
1113470516 13:110541677-110541699 GAGGAAGCTGAGCCCCAGGCAGG - Intronic
1113508213 13:110831596-110831618 GCAGGGGCTGGGCCACAGGCTGG - Intergenic
1114500160 14:23162651-23162673 TCTGGAGCAGGGCTACAGGCAGG + Intronic
1115531506 14:34332324-34332346 GCTGAAGCTGGGCTGCAGAGGGG - Intronic
1118350217 14:64968344-64968366 GCTGAAGCTAGGCCTCAGTGTGG - Intronic
1119674557 14:76544195-76544217 GCTGGAGATGGGGCACATGCAGG - Intergenic
1122307809 14:100776732-100776754 GCCGAAGCGGGGACAGAGGCAGG - Intergenic
1122891023 14:104732303-104732325 GCTGAAGCTGGAGGAAAGGCAGG + Intronic
1124374475 15:29121533-29121555 GCTGAAGCTCGGCTCCAGGGCGG + Exonic
1124382239 15:29176698-29176720 GCTGAGGCCGGGCCCCAGGAGGG + Intronic
1124431484 15:29612461-29612483 GCTGAAGGTGTGCCAGAGGCTGG - Intergenic
1125726460 15:41870699-41870721 GCGTAGGCAGGGCCACAGGCGGG - Intronic
1126168193 15:45671679-45671701 GATGTAGCTGGGCCTCTGGCAGG + Intronic
1127772890 15:62244834-62244856 GCTGCAGCTGGTCCACGAGCTGG + Intergenic
1128231091 15:66035991-66036013 ACTGAAGTGGGGCCACTGGCGGG - Intronic
1129030061 15:72611519-72611541 GCTGCAGCTGGTCCACGAGCTGG - Intergenic
1129038286 15:72664267-72664289 GCTGCAGCTGGTCCACGAGCTGG - Intronic
1129152152 15:73696033-73696055 GCAGAAGCAGGGCCACAGGGAGG - Intronic
1129461374 15:75701644-75701666 GCAGAGGCTGGGCCTGAGGCCGG - Intronic
1129524381 15:76204579-76204601 GCTGAAGCTGGGCCACAGGCTGG - Exonic
1129723460 15:77890163-77890185 GCAGAGGCTGGGCCTGAGGCCGG + Intergenic
1129728725 15:77917239-77917261 GCTGCAGCTGGTCCACGAGCTGG + Intergenic
1129839791 15:78736632-78736654 GCTGCAGCTGGTCCACGAGCTGG - Intergenic
1130133797 15:81164889-81164911 GCTGAGTCTGGGGCACAGGATGG + Intronic
1130634441 15:85603930-85603952 GCTGAAGCAGAGTCACTGGCAGG - Intronic
1131721430 15:95172684-95172706 ACTGAAGCTGGGACACAAGATGG - Intergenic
1132583523 16:695834-695856 GCTCAGGCTGGACCACAGCCCGG + Exonic
1132583791 16:697158-697180 GCTGAGGCTGGTCCACCTGCCGG + Exonic
1132608044 16:801651-801673 GCAGAAGCTGGGCCACCCCCGGG + Intergenic
1132679917 16:1135461-1135483 GGTGAGGCTGGGCCACAGAGGGG + Intergenic
1132747350 16:1442583-1442605 GGTGAGGCTGACCCACAGGCTGG + Intronic
1132864529 16:2086889-2086911 AGTGAGGCTGGGCCCCAGGCAGG + Intronic
1132912381 16:2321148-2321170 GCTGAGACTGGGGCCCAGGCAGG - Intronic
1132993719 16:2811774-2811796 GCTGGAGCTGGCCCAGAGGGCGG + Intergenic
1133222230 16:4323689-4323711 GCTGAAGCTGGAAGACGGGCCGG - Intronic
1137926508 16:52546724-52546746 GCCGAAGCTGGGCCCGGGGCCGG + Exonic
1138078684 16:54068070-54068092 GCTGAAGGTAGCACACAGGCAGG - Intronic
1139431509 16:66913351-66913373 GCTGGAGCTGGCCCACCGGAAGG - Intronic
1139439890 16:66961152-66961174 GCTCAGGCTGAGCCAGAGGCAGG - Intergenic
1139810375 16:69610616-69610638 GCTAAAGCTGGGTCCCAGGCAGG - Intronic
1139824048 16:69743022-69743044 GCGGATTCTGGGGCACAGGCAGG + Intronic
1140950898 16:79816389-79816411 GCTGAAGGTGGGACACAGCCTGG - Intergenic
1141480714 16:84304856-84304878 GCTGGGGCTGGGCCACAGGAGGG + Intronic
1141903125 16:87005900-87005922 GCTGAAGGTGCCCCACAAGCTGG + Intergenic
1141958922 16:87391973-87391995 GGGGAGGCTGAGCCACAGGCGGG - Exonic
1142194125 16:88731776-88731798 GCAGTAGTTGGGCCAGAGGCGGG + Exonic
1142518627 17:489889-489911 GCTGGAGCGGGGCCGCAGCCCGG - Intergenic
1142593820 17:1019954-1019976 CCCCAAGGTGGGCCACAGGCAGG + Intronic
1142967021 17:3588106-3588128 GCTGGAGCTGGACCAGGGGCTGG + Intronic
1143017095 17:3896674-3896696 GCTGGGGCTGAGCCACAGGCAGG + Exonic
1143472512 17:7184839-7184861 GCTGATGGAGGGCCTCAGGCTGG - Intergenic
1143522938 17:7455848-7455870 CCGGAAGCAGGGCCACAGCCCGG - Exonic
1144738505 17:17568257-17568279 GGTGATGGTGGGCCATAGGCAGG - Intronic
1144764446 17:17725035-17725057 GCTGACCCTGGGCCTCGGGCAGG + Intronic
1144863921 17:18322980-18323002 GCTGAAGCTGCACTACATGCAGG + Exonic
1145249991 17:21292027-21292049 GCAGGAGCTGGGACCCAGGCTGG + Intronic
1145908254 17:28528086-28528108 GCAGAACCTGCTCCACAGGCAGG - Intronic
1146054745 17:29575466-29575488 TCTGGACCTGGGCCTCAGGCTGG - Exonic
1147142344 17:38466660-38466682 GGTGGAGCAGGGCCACGGGCGGG - Exonic
1147661870 17:42121147-42121169 GCTGCAGCTGGGGCAGGGGCTGG + Exonic
1147667271 17:42156577-42156599 GCTGGAGGTGGGCCAAAGCCAGG + Intergenic
1148419291 17:47531765-47531787 GCTGAGGCTGGGGCTCGGGCTGG + Intronic
1148820265 17:50355943-50355965 GGCGCAGCTGGGCCACAAGCGGG - Exonic
1148865709 17:50627251-50627273 GCTGAAGATGGGCCACCGTTGGG - Exonic
1149058092 17:52389033-52389055 GATGAAGCAGAGACACAGGCTGG + Intergenic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1151365170 17:73612276-73612298 GCTGCACCTGGGCTGCAGGCTGG + Intronic
1151365188 17:73612340-73612362 GCTGCACCTGGGCTGCAGGCTGG + Intronic
1151759126 17:76090687-76090709 GCTGATGCTTGGCCCCAGGGGGG + Intronic
1151982665 17:77523012-77523034 CCTGAGGCTGTGTCACAGGCAGG + Intergenic
1152115781 17:78386158-78386180 GCTGGAGCCGGGCCACGGGCTGG + Intronic
1152549179 17:81020879-81020901 GCTGAGGCTGGGCCTCACGTTGG + Intergenic
1152632647 17:81417448-81417470 ACTGAGGGTGGGGCACAGGCAGG - Intronic
1152937689 17:83150047-83150069 TCTGGAGCTGGGCCACCAGCAGG - Intergenic
1154321782 18:13360040-13360062 GCTGTAGGTGGGCCACAGAATGG + Intronic
1157718873 18:49908073-49908095 GCTTAAGCAGAGCCAGAGGCTGG + Intronic
1158386269 18:56995785-56995807 GCTGACGCTGGGACTCAGTCTGG - Intronic
1159722352 18:71907528-71907550 TCTGAAGCTGGGTCACTGACAGG - Intergenic
1160135211 18:76265932-76265954 GCTGAAGCTGGGCCACTGGCTGG + Intergenic
1160310000 18:77780221-77780243 GCATAACCTGGGCCACAGGTTGG - Intergenic
1160505879 18:79426669-79426691 GCTGCAGCTGAGTCACAGGGGGG - Intronic
1160539700 18:79613838-79613860 CAGGAAGCTGGGCCACAGGCGGG - Intergenic
1161155758 19:2731325-2731347 GCTGCAGCAGGGCCACCGGCCGG + Intronic
1161294411 19:3512466-3512488 GTTGAAGCTGGGACTCAGCCTGG + Intronic
1161635348 19:5385215-5385237 TCTGAAGCAGGTCCAAAGGCAGG - Intergenic
1162758589 19:12874802-12874824 GCTGAAGCTGTGCCCCCAGCAGG + Exonic
1162896349 19:13766673-13766695 GATGAAGGTGGGACTCAGGCAGG - Intronic
1163382331 19:16977331-16977353 ACTGAACCTGGGACACAGCCAGG - Intronic
1163819340 19:19487262-19487284 GCTGAGGCTGTGCCACAGAGTGG + Intronic
1164128967 19:22344649-22344671 TCTGAAGCTGAGACCCAGGCAGG - Intergenic
1165493425 19:36138820-36138842 GCTAAATCTGGCCCCCAGGCAGG - Intergenic
1165591304 19:36972521-36972543 GCTCGGGCCGGGCCACAGGCTGG - Intronic
1166333910 19:42094056-42094078 GCTGATCCTGAGCCACAAGCAGG + Intronic
1167090960 19:47343428-47343450 CCTGAAGCTGTGCCACTGGCTGG + Intergenic
1167904646 19:52648976-52648998 GCTGGAGCTGGGCAAGAGGGTGG - Intronic
1168354519 19:55692900-55692922 GCTGAGGCGGGGCCCCAGGGAGG + Intronic
1168386836 19:55970667-55970689 TCTCCAGCTGGGCCACAGACAGG - Exonic
1168650917 19:58091589-58091611 GCTGAGGGTGGGGCACAGGTTGG - Intronic
925077723 2:1032175-1032197 GCTGCAGCGGGACCACGGGCTGG + Intronic
925299332 2:2799401-2799423 GCTGAGACTGGGCCCCAGGTAGG + Intergenic
925739994 2:6996818-6996840 GCTGTAGCTGGGACCCAGGGAGG - Intronic
926176959 2:10602163-10602185 TCTGAGGAGGGGCCACAGGCCGG - Intronic
926272806 2:11379238-11379260 ACTGAGGCTGGGCCACACCCTGG + Intergenic
927567323 2:24124048-24124070 GCTGAAGCTGCCACACTGGCTGG + Intronic
927852141 2:26506122-26506144 TCTGAAGCTGGGCCTATGGCAGG - Intronic
928085758 2:28345311-28345333 GCTGAAGCGGGGCTCCAGGCTGG - Intergenic
929165326 2:38875891-38875913 GCTGCAGCTGGGCCACCGCAGGG - Exonic
929196567 2:39191100-39191122 TCAGAAGCTGGGCTAGAGGCCGG + Intronic
929575488 2:43049394-43049416 GCTGAAGAGGGGCCAGAGGGAGG + Intergenic
931036635 2:58251506-58251528 ACTGAGGCTGGGGCAGAGGCTGG - Intergenic
931695803 2:64869635-64869657 GCTCAGGCTGGGGCCCAGGCGGG + Intergenic
932738928 2:74276888-74276910 GCTGAGGATTGGCCAAAGGCAGG + Intronic
934176399 2:89582896-89582918 GCTGAGCCGGGGCCACAGGCAGG - Intergenic
934286709 2:91657257-91657279 GCTGAGCCGGGGCCACAGGCAGG - Intergenic
934488281 2:94738065-94738087 CCTGAAGATGGGCTACACGCAGG + Intergenic
935974066 2:108560096-108560118 GCAGATGATGGGCCACAGGGTGG + Intronic
937009784 2:118552185-118552207 TCAGAAGCTGGGCATCAGGCTGG + Intergenic
937096452 2:119238737-119238759 ACTGAAGATGGACCCCAGGCAGG + Intronic
937221300 2:120344544-120344566 GCGGCAGCTGGGACAGAGGCAGG + Intergenic
937296437 2:120812455-120812477 GCTGAAGCTGAGACGCAGGCCGG + Intronic
937980632 2:127612582-127612604 CCTGAGGCTGGGCCGCAGGATGG - Exonic
938107167 2:128540500-128540522 ACTGAAGCTGGCCCACAGCCAGG + Intergenic
938240912 2:129741740-129741762 GTTGCAGCTGGGGAACAGGCAGG - Intergenic
942821689 2:180122703-180122725 GTGGAAGCTAGGCCACAGGTAGG - Intergenic
944662088 2:201929620-201929642 GCTGAAGCTAGGACTCAGGCTGG - Intergenic
945695306 2:213094562-213094584 GCGCAGGCTGGGACACAGGCTGG + Intronic
946432313 2:219632282-219632304 GCTGATGCTGGACCGCAGCCAGG + Exonic
947329540 2:229014122-229014144 CCGGAAGCTGGGACACAGGCAGG + Intronic
947349732 2:229231072-229231094 GCTTCAGCTGGGACACTGGCTGG - Intronic
947534579 2:230932838-230932860 CCTGTAGCTGTGCTACAGGCAGG + Intronic
947747257 2:232514913-232514935 GCTGAAGCTGGGGCGCCTGCAGG - Intergenic
948563246 2:238867654-238867676 GCCGAGGCTGGGGCACAGGCTGG + Intronic
948886529 2:240887788-240887810 GCAGAGCCTGGGCCACAGGGAGG + Intronic
948892922 2:240915957-240915979 GCGGACGCTGGGCCACAGCCTGG + Intergenic
948942142 2:241201900-241201922 CCTGAAGCTGGGCCCCTGCCTGG - Intronic
1168769817 20:408051-408073 GAAGGAGCTGGGCCGCAGGCGGG - Exonic
1169003727 20:2189511-2189533 GATGAAGCTCTGCCACAGGTGGG - Intergenic
1170254574 20:14326165-14326187 GCTTAAACTGGGCCATAGCCCGG - Exonic
1171057414 20:21920922-21920944 GCACAAGGTGGGGCACAGGCTGG + Intergenic
1171179611 20:23083024-23083046 GTGGAGGCGGGGCCACAGGCAGG + Exonic
1172674874 20:36661671-36661693 AGTGAGGCTGGGGCACAGGCTGG + Intronic
1173497625 20:43530741-43530763 GCAGAGGCTGGGCCACAGCAAGG - Intronic
1174037819 20:47678958-47678980 GCTGAATCTGGGCCGCAGAGGGG - Intronic
1175264439 20:57694025-57694047 CCTGCAGCAGGGCCACAGCCTGG + Intronic
1175880189 20:62253527-62253549 GCTACAGCAGTGCCACAGGCTGG + Intronic
1176139085 20:63537338-63537360 GCTCCAGCTGGGCCACAGCCTGG - Exonic
1176239666 20:64070051-64070073 CCTGAAGCTGGGTCTCAGTCAGG + Intronic
1176839504 21:13827436-13827458 CCTGAAGATGGGCTACACGCTGG + Intergenic
1178493448 21:33068756-33068778 GCTGAACCTGAGGCATAGGCAGG + Intergenic
1179046438 21:37849239-37849261 GCTGAATCTTGGAAACAGGCAGG + Intronic
1179405320 21:41121144-41121166 GCTGAAGCTGAGCCTCAGGAAGG - Intergenic
1179422407 21:41247333-41247355 GCTGCAGCTGCGCCAGTGGCTGG - Intronic
1179430771 21:41319618-41319640 GCTGAAGCTGGGACACACTTGGG - Intronic
1180058735 21:45374127-45374149 GGTGCAGCTGGACCACAGCCAGG + Intergenic
1182427516 22:30282784-30282806 GCAGATGCTGGGCACCAGGCTGG + Intergenic
1183103519 22:35598551-35598573 CCTGAAACTGGCCCCCAGGCAGG + Intergenic
1183827725 22:40401604-40401626 GCTGAGAAAGGGCCACAGGCAGG - Exonic
1184238757 22:43200580-43200602 GCTGACCCTGGGCCTCAGGGCGG - Exonic
1184403706 22:44288010-44288032 GGTGTGGCTGGGCCACAGGCTGG + Intronic
1184409947 22:44320674-44320696 GCTGGAGCTGGGCCAAAGAGGGG - Intergenic
1185174169 22:49310516-49310538 GCTGGAGCTGGTCCACAGAGAGG - Intergenic
950459590 3:13113272-13113294 GCTGAAGCTGGGGACCAGGGTGG + Intergenic
950555812 3:13695342-13695364 GCTGAGGCTGGGACACACGGTGG + Intergenic
950669981 3:14520134-14520156 GCTGACTCTGGGGCACAGGCAGG + Exonic
953257365 3:41304881-41304903 CCTGCAGCTGGGCCAAATGCAGG - Intronic
953355039 3:42248754-42248776 GATGAACCTGGGCCAGAGGCTGG + Intergenic
954143449 3:48622005-48622027 TTTGAAGCTGGGCCCTAGGCTGG + Intergenic
954716027 3:52527407-52527429 TCTGTGGCTGGGCCACGGGCCGG + Intronic
956064407 3:65381937-65381959 GCATAAGCTGGACCACAAGCTGG + Exonic
960817935 3:121692523-121692545 GCTGAAGCTGGACCTCTGTCTGG + Exonic
961326713 3:126113332-126113354 GCAGAGGGTGGGACACAGGCAGG + Intronic
961465969 3:127081858-127081880 GCTGAAGAGAGGCCACAGCCTGG - Intergenic
961638573 3:128350259-128350281 GCCCAAGCTGTGCCAGAGGCAGG - Intronic
962181053 3:133206885-133206907 GCTGAAGCTGGGCCCACAGCCGG + Intronic
963074235 3:141331696-141331718 GCTGAGGCTGAGCCTGAGGCTGG + Intronic
964116285 3:153139541-153139563 GCTGAAGGTGGGCTTCAGGGTGG - Intergenic
964310416 3:155386136-155386158 GCCCATGCTGTGCCACAGGCTGG - Intronic
965964089 3:174466190-174466212 GCTGCATGTGGGCCACAGGTTGG - Intronic
966072253 3:175893556-175893578 GCTGATTCTGGCCCACAGGCTGG - Intergenic
966918314 3:184596900-184596922 GCCAAACCTGGGGCACAGGCTGG + Intronic
968452616 4:682336-682358 GCTGAAGAAGGTGCACAGGCCGG + Exonic
968900629 4:3429975-3429997 GCTGCAGCTGGGACCCGGGCGGG + Intronic
968910019 4:3472882-3472904 GCTGAAGCTCAGCCACAACCTGG + Intronic
968957951 4:3728587-3728609 TCCGAAGCTGGGCCAGAGGTGGG - Intergenic
969460089 4:7324409-7324431 GCTCCAACTGGGCAACAGGCCGG + Intronic
975986195 4:80203001-80203023 GCTGGTGCTGGGCCAGAAGCTGG + Exonic
977347180 4:95830876-95830898 TCTTAAGCTGTGCCACAGGAGGG + Intergenic
979582788 4:122379622-122379644 GCTGCTGCTGCGCCTCAGGCCGG - Intronic
979755153 4:124331062-124331084 TCTGGAGATGGGCCACAGGAGGG + Intergenic
980077065 4:128305134-128305156 GCTAAAGCTACCCCACAGGCTGG + Intergenic
981837950 4:149077296-149077318 CCAGAAGCTGGGGCAAAGGCAGG - Intergenic
984219162 4:176952331-176952353 GCGAAAACAGGGCCACAGGCTGG - Intergenic
985590379 5:761464-761486 GCAGAAGCTGGGCCAATGGCAGG + Intronic
985607540 5:866134-866156 GGTGAAGCTGGTCCCCTGGCTGG - Intronic
985682294 5:1262769-1262791 ACTGATGCTGTGCCAGAGGCTGG + Intronic
986191373 5:5499257-5499279 TCTAAAGCTGAGGCACAGGCAGG + Intergenic
986483667 5:8214112-8214134 GCAGAAGCTGGGAGAGAGGCAGG - Intergenic
986909101 5:12532472-12532494 GCTGAGGCTGTGCTACAAGCAGG - Intergenic
987271287 5:16312068-16312090 GCTGAAGATGGGTCACATTCTGG - Intergenic
989308577 5:39986218-39986240 GCTTAAACTGGGCCTGAGGCAGG - Intergenic
991018948 5:61960105-61960127 GGTGAAGCTGGGCCCCAGTCAGG - Intergenic
992484999 5:77186130-77186152 TGTGATGCTGGGACACAGGCTGG - Intergenic
992958235 5:81932292-81932314 GCTATGGCTCGGCCACAGGCAGG + Intergenic
993522547 5:88921190-88921212 GATGAAGCTGGTCCACAGAGAGG - Intergenic
999363925 5:151008974-151008996 GCTGAACCAGGGCCAGAGGAAGG + Intergenic
1000060521 5:157651640-157651662 GCAGAAGCTGGGGCCCAGCCTGG - Exonic
1000145541 5:158449811-158449833 GGTGAGGCTGGGGCCCAGGCCGG - Intergenic
1000255500 5:159534628-159534650 GTTGAAGCTGGGCCACACAGTGG - Intergenic
1001571542 5:172733517-172733539 GGTGAAGCTGTGGCTCAGGCTGG - Intergenic
1002093558 5:176818082-176818104 GCTGCAGCTGGGCTACAGCACGG - Intronic
1002319071 5:178364402-178364424 GGTGAAGCAGGCCCACAGGAGGG + Intronic
1003047151 6:2744380-2744402 GCCGAGGCTGGGCCACTGCCAGG + Intronic
1003426640 6:6002405-6002427 GCTCAAGCTGGGCGACAGCATGG - Exonic
1003729707 6:8807892-8807914 GGTGAAGCTGGAACACAGGGGGG + Intergenic
1003853087 6:10244660-10244682 GATGAAGCTGAGTCACGGGCTGG - Intergenic
1005687305 6:28267224-28267246 CCTGGAGCTGGGCCCCGGGCTGG + Intronic
1006123411 6:31821647-31821669 GCTGGAGCAGGTTCACAGGCTGG + Intergenic
1006669711 6:35722434-35722456 GCTGAGCCTGGGCCAGAGCCAGG - Intronic
1007071624 6:39042271-39042293 CCAGAAGCTGGGACAGAGGCAGG + Intergenic
1007386459 6:41523397-41523419 GCAGGAACTGGGCCACAGACAGG + Intergenic
1007420146 6:41714408-41714430 GCTGAATCTGGAACCCAGGCTGG + Intronic
1007840928 6:44715399-44715421 GCTGAAGCAGGGGCAGAGGCAGG - Intergenic
1007971124 6:46053257-46053279 CCTGGAGCTGGGTGACAGGCTGG + Intronic
1008088516 6:47269115-47269137 GATGAAGCTGAGGCACAGGAAGG - Intronic
1010791559 6:80070626-80070648 GCTGAAGCAGGGACGCTGGCCGG + Intergenic
1013308518 6:108872156-108872178 GCTGATGCTACCCCACAGGCAGG + Intronic
1013512692 6:110858965-110858987 GCTGCAGATGGGCTACACGCAGG + Intronic
1014307349 6:119758637-119758659 GCTGAGGGTGGGGCACAGCCTGG + Intergenic
1014644091 6:123953217-123953239 GCTGCAGATGGGACACAGGTGGG + Intronic
1015732488 6:136362639-136362661 GCTGGAGCTGGGGCCGAGGCTGG + Exonic
1015732494 6:136362657-136362679 GCTGGAGCTGGGGCCGAGGCTGG + Exonic
1015950551 6:138548397-138548419 GCTGCATGTGGGCCACAGGTTGG - Intronic
1017262094 6:152399166-152399188 GCAGAGGCAGGGCCACAGGATGG + Intronic
1018739284 6:166714976-166714998 GCTGAAGAAGGAGCACAGGCCGG - Intronic
1019062346 6:169265491-169265513 CCTGAAGCTGGCACAAAGGCAGG + Intergenic
1019153979 6:170026533-170026555 GCTGAAGCGGGGGCAGAGCCCGG - Intergenic
1019158406 6:170053680-170053702 GCTCCAGCTGGGGCAGAGGCCGG + Intergenic
1019161112 6:170067356-170067378 GCAGAGGGTGGGCCGCAGGCTGG + Intergenic
1019265689 7:116377-116399 GGTGCAGGTGGGGCACAGGCTGG - Intergenic
1019652776 7:2169704-2169726 GCAGAGGCTGGACCACAGTCTGG + Intronic
1019659761 7:2217609-2217631 GCTGGAGCTGGGTCTCAGTCAGG - Intronic
1019718585 7:2554771-2554793 GCTGCAGGTGGGCCAGAGTCAGG + Intronic
1019725035 7:2597186-2597208 GCAGGATCTGGGCCACAGGGTGG + Intronic
1019821734 7:3248858-3248880 GATGAGGCTGGGCCAGAAGCAGG + Intergenic
1020427622 7:8087023-8087045 CCTGAAGCTAGGCCATAGGGTGG - Exonic
1021483781 7:21145912-21145934 GCTACAGCTGGGCCACAGGTGGG + Intergenic
1022224112 7:28345750-28345772 GATGAAGATAGGCCAGAGGCAGG + Intronic
1022705325 7:32796640-32796662 ACTGAACCTGAACCACAGGCAGG - Intergenic
1024043936 7:45574882-45574904 GCTGCAGCTGGGGCACCTGCAGG - Exonic
1024247245 7:47479769-47479791 ACAGAAGCCTGGCCACAGGCGGG - Intronic
1024359620 7:48454847-48454869 GCGGAAGCTGGGCCTTGGGCCGG - Intronic
1025097528 7:56107937-56107959 GCTGTTGCTGGGACACAGGAAGG - Intergenic
1026310108 7:69175886-69175908 GCAGGAGGTGAGCCACAGGCAGG + Intergenic
1026479053 7:70763159-70763181 GCTGGAGCTGGGCCTCAGGAGGG - Exonic
1027578257 7:79958669-79958691 TCTGAAGATGGACCACAGGAGGG + Intergenic
1028381767 7:90208215-90208237 CCAGAAGCTGGACTACAGGCAGG - Intronic
1028689525 7:93636102-93636124 CCTGAGGCTGTGTCACAGGCAGG - Intronic
1029125877 7:98295027-98295049 GGTGTGGCCGGGCCACAGGCTGG - Intronic
1029351401 7:100015659-100015681 GCTGACTCTGGGGCTCAGGCCGG - Exonic
1029363455 7:100102659-100102681 GGTGATGCTGAGACACAGGCAGG - Exonic
1030074927 7:105728712-105728734 GCTGATTCTGGGGCAGAGGCAGG + Intronic
1030112366 7:106037873-106037895 GCTGGAGGTGGGCTAGAGGCAGG - Intergenic
1032073230 7:128822703-128822725 TCTGAAAATGGGCCCCAGGCAGG + Intergenic
1032305946 7:130733074-130733096 GGTGAAGCTGGGCGCCGGGCCGG + Exonic
1034451581 7:151139861-151139883 ACTGTAGCTGGGCCACACTCAGG - Intronic
1035440261 7:158891294-158891316 GTGGAAGCTGGACCAGAGGCCGG + Exonic
1035487442 7:159237039-159237061 CCTGAGGCTGGGAGACAGGCGGG + Intergenic
1035599951 8:891510-891532 GCAGCTGCTGGGCCACAGGATGG + Intergenic
1036122546 8:6034041-6034063 GCTGAAAGTGGGCCAAAGGCAGG - Intergenic
1036659445 8:10698482-10698504 GCTGGAGCTGGGGCCCAGGGAGG + Intronic
1036696544 8:10978909-10978931 GCTGAAGCTGGGCCAGTGGCAGG - Intronic
1037638196 8:20719447-20719469 GCTGGGGCTGGGCCCCAGGTAGG + Intergenic
1038013920 8:23497400-23497422 GCTGAGCCTGGGTCCCAGGCAGG + Intergenic
1038507202 8:28094628-28094650 GCTGAGGCTGAGGCAGAGGCGGG + Intronic
1039564928 8:38544469-38544491 CCTGAAGCTAGGACACAGGGTGG + Intergenic
1040291661 8:46128656-46128678 GCAAAATCTGGGCCACAGGGTGG - Intergenic
1040296475 8:46151621-46151643 GCGGCAGCTGAGCCACAGGCAGG - Intergenic
1040304085 8:46203074-46203096 GCGAAAACAGGGCCACAGGCTGG + Intergenic
1040308432 8:46224158-46224180 GCGGAAACAGGGCCACAGGGTGG + Intergenic
1040314817 8:46255326-46255348 GCGAAAACGGGGCCACAGGCAGG + Intergenic
1040316467 8:46263506-46263528 GCAGAAACAGGGCCACAGGGTGG + Intergenic
1040332967 8:46401648-46401670 GCAGCAGCAGGGCCACAGGCAGG - Intergenic
1040374867 8:46815182-46815204 TCTGTGGCTGTGCCACAGGCAGG - Intergenic
1044441717 8:92231189-92231211 CCTGCACTTGGGCCACAGGCCGG - Intergenic
1045582824 8:103499490-103499512 GCTGAAGGTGGGTGACAGGGAGG - Intergenic
1049007233 8:139863332-139863354 GCTGCAGCTGGGCAGCGGGCAGG - Intronic
1049298416 8:141855991-141856013 CCCCAAGCTGGGCCACTGGCTGG + Intergenic
1049410088 8:142470029-142470051 GCTGAAAATGGGCCACGGGCTGG - Intronic
1049560036 8:143305576-143305598 GCTGGAACTGGGTAACAGGCCGG - Intronic
1049605158 8:143525942-143525964 GCTGAAGCGGGGCCAGTGCCAGG - Intronic
1053919303 9:42972541-42972563 CCTGAAGATGGGCTACACGCAGG - Intergenic
1054380640 9:64486319-64486341 CCTGAAGATGGGCTACACGCAGG - Intergenic
1054515107 9:66029992-66030014 CCTGAAGATGGGCTACACGCAGG + Intergenic
1056547947 9:87628478-87628500 ACTGAAGCTGGGACACAGGAAGG - Intronic
1056680557 9:88714089-88714111 GCTGAGACGGGGCCACAGGATGG + Intergenic
1057155577 9:92835848-92835870 CCTGAAGCTAGGCCAGAGACAGG - Intergenic
1057533627 9:95876415-95876437 GCTTAATATGGGCCACACGCGGG - Intronic
1060514819 9:124258805-124258827 GCTGCGGCAGGGCCACTGGCAGG + Intronic
1060716371 9:125933620-125933642 GCTGAAGCAGGGATACAGGGAGG + Intronic
1061034791 9:128107474-128107496 GCTGATCCTGGGCCGCAGCCTGG + Exonic
1061062848 9:128259229-128259251 GCTGCAGCTGGTCCACGAGCTGG + Exonic
1061406487 9:130395341-130395363 GCTGCAGGTGGGCGCCAGGCAGG + Intronic
1061759941 9:132843617-132843639 GATGAAGCTGAACCGCAGGCAGG + Intronic
1061942251 9:133890090-133890112 GCTGAGGCAGGTCCCCAGGCAGG + Intronic
1061954308 9:133953646-133953668 TCTGAAGCTGGGCCCCATGGTGG - Intronic
1062029758 9:134356913-134356935 GCTGAGGCTGGGAGACAGGCAGG - Intronic
1203577795 Un_KI270745v1:21655-21677 GGAGGAGCTGGGCCACACGCGGG - Intergenic
1185862060 X:3588963-3588985 GATGCAGTTGGGCCCCAGGCTGG - Intergenic
1187114155 X:16332210-16332232 GATGGAGCTGGGCCATGGGCAGG + Intergenic
1187141066 X:16594141-16594163 GTTTAAGCTGTGCCACAGGTAGG + Intronic
1188001910 X:24990698-24990720 GCTGAAGCTGATCCAGTGGCTGG + Intronic
1189768131 X:44393006-44393028 GCTGAATCTGGGACACAGCTTGG - Intergenic
1191197905 X:57744427-57744449 GCTGGAGCTTGGCAACAGGAGGG + Intergenic
1191722736 X:64248313-64248335 GCTGGCAGTGGGCCACAGGCAGG + Intergenic
1195095106 X:101494074-101494096 GCTGAGGCTGGGGCTGAGGCTGG + Exonic
1195884638 X:109625491-109625513 GCTGTATCTGGGCCAAAGCCTGG - Intronic
1197831341 X:130646382-130646404 GCTGAAGCTGGGCCCCAGGAGGG - Intronic
1199460075 X:148074653-148074675 GCAGGACTTGGGCCACAGGCTGG - Intergenic