ID: 1129525098

View in Genome Browser
Species Human (GRCh38)
Location 15:76208683-76208705
Sequence GAGCCTGAGCACTCCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129525088_1129525098 20 Left 1129525088 15:76208640-76208662 CCTACAGTTATGGCTGGCGGGCA 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1129525098 15:76208683-76208705 GAGCCTGAGCACTCCCTGGGAGG 0: 1
1: 0
2: 1
3: 31
4: 241
1129525084_1129525098 26 Left 1129525084 15:76208634-76208656 CCATATCCTACAGTTATGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1129525098 15:76208683-76208705 GAGCCTGAGCACTCCCTGGGAGG 0: 1
1: 0
2: 1
3: 31
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129525098 Original CRISPR GAGCCTGAGCACTCCCTGGG AGG Intronic