ID: 1129525098 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:76208683-76208705 |
Sequence | GAGCCTGAGCACTCCCTGGG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 274 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 31, 4: 241} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1129525088_1129525098 | 20 | Left | 1129525088 | 15:76208640-76208662 | CCTACAGTTATGGCTGGCGGGCA | 0: 1 1: 0 2: 0 3: 3 4: 36 |
||
Right | 1129525098 | 15:76208683-76208705 | GAGCCTGAGCACTCCCTGGGAGG | 0: 1 1: 0 2: 1 3: 31 4: 241 |
||||
1129525084_1129525098 | 26 | Left | 1129525084 | 15:76208634-76208656 | CCATATCCTACAGTTATGGCTGG | 0: 1 1: 0 2: 0 3: 5 4: 95 |
||
Right | 1129525098 | 15:76208683-76208705 | GAGCCTGAGCACTCCCTGGGAGG | 0: 1 1: 0 2: 1 3: 31 4: 241 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1129525098 | Original CRISPR | GAGCCTGAGCACTCCCTGGG AGG | Intronic | ||