ID: 1129527733

View in Genome Browser
Species Human (GRCh38)
Location 15:76232152-76232174
Sequence TTGTAATTATTGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 225}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129527733 Original CRISPR TTGTAATTATTGAGGGCAGA GGG (reversed) Intronic
900691673 1:3984375-3984397 TAACATTTATTGAGGGCAGATGG - Intergenic
900906042 1:5558489-5558511 TTGTTAGTGTTGAGGGCAGAAGG - Intergenic
903374817 1:22859244-22859266 TTCTAAGCAATGAGGGCAGATGG + Intronic
904071963 1:27807063-27807085 TTTTAATTTTTGTGGGCACATGG + Intronic
905718214 1:40172232-40172254 CTGGAAAGATTGAGGGCAGAAGG - Intronic
906975182 1:50562392-50562414 TTGAAATAATTGAGGAGAGAAGG - Intronic
908950289 1:69553048-69553070 GTGTGATAATTGAGGGTAGAAGG - Intergenic
909175427 1:72351640-72351662 CTGTTGTTATTGAGGGCAAAAGG + Intergenic
909710671 1:78645977-78645999 TTGCAAAAATTGAGGGCACAGGG + Exonic
910958734 1:92737687-92737709 ATGTATATATTGAGGGCAGGAGG - Intronic
912895139 1:113578367-113578389 TTGTAATTATCTATGACAGATGG - Intronic
913338746 1:117734851-117734873 TTGTAATCATTGATGACACAGGG + Intergenic
913662509 1:121016788-121016810 GTGTAATTCTGCAGGGCAGAAGG + Intergenic
914013887 1:143799984-143800006 GTGTAATTCTGCAGGGCAGAAGG + Intergenic
914163936 1:145161213-145161235 GTGTAATTCTGCAGGGCAGAAGG - Intergenic
914652510 1:149708603-149708625 GTGTAATTCTGCAGGGCAGAAGG + Intergenic
917717681 1:177754509-177754531 TTCTGCATATTGAGGGCAGAGGG - Intergenic
918051398 1:180976048-180976070 TGATGATTATTGAGGACAGAAGG - Exonic
918656862 1:187037654-187037676 TTGTGGTAATTGAGAGCAGAAGG - Intergenic
918789449 1:188807629-188807651 TTGTAATTATTGAGGGTGGGAGG + Intergenic
919678930 1:200414504-200414526 TAACAATTATTGAGGGAAGAGGG - Intergenic
920797115 1:209150024-209150046 ATGTATTTATTAAAGGCAGATGG - Intergenic
921564305 1:216698122-216698144 TAGGAATTATTGAGGGAAAACGG + Intronic
921565703 1:216715548-216715570 TTGGAATTATGGAGGGCAAAGGG + Intronic
923276232 1:232399371-232399393 ATGTACTTTTTGAGGGGAGAAGG + Intronic
923836804 1:237619768-237619790 TAGAAAGTATGGAGGGCAGAAGG + Intronic
924706738 1:246508422-246508444 ATGTCATTATTAAGGGCAGCTGG + Intergenic
1065129076 10:22602218-22602240 TTGTAATTTTTGAAGACACAGGG - Intronic
1065713485 10:28540424-28540446 TTGTAACCACTGAGGGAAGAAGG - Intronic
1066141748 10:32510479-32510501 ATGGTATTAATGAGGGCAGACGG + Intronic
1067104219 10:43355085-43355107 TTGTAAGGATTAAAGGCAGAGGG - Intergenic
1072540754 10:96396500-96396522 TTGTAATAATTTAAGGCCGAAGG + Intronic
1073249179 10:102111340-102111362 TAGGAATTATTGGGGGCAGGGGG + Intronic
1073366311 10:102945018-102945040 TGTTAATTATTAAGGGAAGAAGG - Intronic
1074799446 10:116984681-116984703 TTGTCATTATTGAGGGTCTAAGG - Intronic
1075152736 10:119949076-119949098 TCGTGCTTATTGAGGGAAGAAGG + Intergenic
1075760548 10:124852500-124852522 ATGTAATAATTCAGGGCAGTGGG - Intergenic
1076056867 10:127382839-127382861 TTGGATTTATTGAGTACAGATGG + Intronic
1080145384 11:28976860-28976882 TTGTATTTATCCTGGGCAGAGGG + Intergenic
1080507347 11:32928580-32928602 TTGTAATTATTGCTGGAAAATGG - Intronic
1084537060 11:69763536-69763558 TTGCAGTTCTGGAGGGCAGAAGG - Intergenic
1086101728 11:83107489-83107511 TTCAAATTATTGAGGAAAGATGG - Intergenic
1087592477 11:100208662-100208684 ATGTAAAAATTGTGGGCAGATGG - Intronic
1091220838 11:133929245-133929267 TTGTAATTTTTGTGGGTACATGG - Intronic
1093406085 12:18806462-18806484 TGATATTTAGTGAGGGCAGATGG - Intergenic
1094224090 12:28026395-28026417 TGGAAATTGTGGAGGGCAGATGG - Intergenic
1098023394 12:66177947-66177969 TTGTAATTATTATTGGCTGAAGG + Intergenic
1099455813 12:82861222-82861244 TGGAAATTATTAAGGCCAGAGGG + Intronic
1099612861 12:84897018-84897040 TTGTATTTTTTTAGGGGAGAGGG - Intronic
1100744781 12:97633748-97633770 TTTTCATTGGTGAGGGCAGAGGG + Intergenic
1103059891 12:117850093-117850115 TTATTATTTTTGAGGGAAGAAGG + Intronic
1106175235 13:27324672-27324694 TAATAATTATTGAAGGAAGAGGG - Intergenic
1106798268 13:33230083-33230105 TTGCAATTATTGGGAGCAGATGG + Intronic
1107002973 13:35572611-35572633 TTGGAAGTATTGAGGGTGGATGG - Intronic
1109086454 13:57977929-57977951 GTGGAATAAGTGAGGGCAGAGGG + Intergenic
1109783998 13:67151052-67151074 TTAAAATAAGTGAGGGCAGAGGG - Intronic
1109928422 13:69179950-69179972 TTGTCTTTATTAAGGGAAGATGG - Intergenic
1110171192 13:72502700-72502722 TTTTAATTACTGAGAACAGAGGG + Intergenic
1110512173 13:76363589-76363611 TTGTTATTTTAGAGAGCAGAAGG - Intergenic
1111651203 13:91092977-91092999 TTTTTGTTCTTGAGGGCAGAGGG - Intergenic
1112402561 13:99088104-99088126 AAGTAATTATTGAGTGCGGACGG - Intergenic
1112772709 13:102808553-102808575 TTGTAATTCTTAAGGGTAGGAGG + Intronic
1112960028 13:105112692-105112714 TGGTGATTAGTGAGGGCGGAGGG - Intergenic
1114861866 14:26532716-26532738 TTGTACCTTTTGAGGGCAGAGGG + Intronic
1115183776 14:30660543-30660565 TTTTAATTACTGATGGCAAATGG + Intronic
1115803761 14:37027473-37027495 TTGTATTTTTTAAGGGCAGTGGG + Intronic
1115894000 14:38063388-38063410 TTGTAAGGATTAAAGGCAGAGGG - Intergenic
1116864393 14:50019654-50019676 TTGTCATAAGTGAGAGCAGAGGG - Intergenic
1117142864 14:52807321-52807343 TTGGAATTTTTGGGGTCAGATGG + Intergenic
1120475385 14:84980147-84980169 TTGAGATTTTGGAGGGCAGAAGG + Intergenic
1120657568 14:87212243-87212265 TTGAAATCATGGAGGCCAGAAGG - Intergenic
1122026629 14:98882254-98882276 TAGTAAATATTGAGGGAATATGG + Intergenic
1122128927 14:99593945-99593967 TAGTAATTATTCAGGGGAAATGG + Intronic
1122378290 14:101283645-101283667 TTGTAATTGTTATTGGCAGAAGG + Intergenic
1125858265 15:42972539-42972561 TTGTATTTATTTAGTGGAGATGG + Intronic
1127577893 15:60310216-60310238 TTGTAATTATAGATTGCTGAGGG - Intergenic
1129527733 15:76232152-76232174 TTGTAATTATTGAGGGCAGAGGG - Intronic
1130612649 15:85375659-85375681 TTTTATTTCTTGGGGGCAGAGGG - Intergenic
1132240524 15:100253943-100253965 TTGAAGTTATTGATGGCAGAAGG - Intronic
1134347465 16:13404155-13404177 TTGTTATTGTTGAGTGAAGAAGG - Intergenic
1138064375 16:53925261-53925283 TTGTAATTTGTGTGTGCAGAGGG + Intronic
1138557598 16:57781573-57781595 TTGTATTTACTGAGAGCAGTTGG - Intronic
1141697428 16:85626685-85626707 TTGTAATTACAGAGCACAGAGGG + Intronic
1144288296 17:13800752-13800774 ATAGAATTATTGAAGGCAGAAGG - Intergenic
1145224707 17:21118343-21118365 TAGAAATAATTGAGTGCAGAAGG + Intergenic
1146394867 17:32456701-32456723 TTGTAATTTTTTAGGAGAGATGG + Intronic
1146744966 17:35320275-35320297 TTGTAGTTATTGTGGGCATTGGG - Intergenic
1147631839 17:41937254-41937276 TTGTAAGGATTGAAGGCAAAGGG - Intronic
1148337236 17:46850266-46850288 TTCTACTTATTGAGGCCACATGG - Intronic
1149261767 17:54887862-54887884 TTGTAGCTATTCAGGGTAGAAGG - Intergenic
1154108162 18:11542492-11542514 TTTTAATTAGTATGGGCAGAGGG - Intergenic
1154177770 18:12096896-12096918 TTTTAATTAGTATGGGCAGAGGG + Intronic
1154295094 18:13140534-13140556 TGGTAATTACTGATGGCAGGGGG + Intergenic
1163504851 19:17699516-17699538 TTGTAATTTTTTAGTGGAGACGG - Intergenic
1164487528 19:28672433-28672455 TTGTAGTTATTTAAGGCAGGAGG - Intergenic
1164894905 19:31866449-31866471 TTTTAATTTTTAAGGCCAGAAGG - Intergenic
1165182512 19:33984893-33984915 TTCTAATTATTCATGGCAGAAGG + Intergenic
1167348556 19:48961733-48961755 TTGTAATTATTGGGGGGTGTGGG + Exonic
1167509012 19:49886298-49886320 TTGTTTTTCTTGAGTGCAGATGG + Intronic
1167805943 19:51785532-51785554 TTGTAAAGATTGAGGGAAAAGGG - Intronic
925979282 2:9164137-9164159 AGCTAATGATTGAGGGCAGAGGG - Intergenic
926383420 2:12313606-12313628 TTGTAAACAATGAGGTCAGAAGG - Intergenic
926942549 2:18153700-18153722 TTGTAAAGAATGAGGGCAGAGGG + Intronic
928893365 2:36233354-36233376 TAGTAATTATGTAGGGCATATGG - Intergenic
930617555 2:53609195-53609217 ATGTAGTTATAGAGGACAGAAGG + Intronic
930684790 2:54296337-54296359 TTCTAATTCTTGAGTACAGATGG - Intronic
931542368 2:63343333-63343355 TAGTAATCATTGAGGCCAGAAGG - Intronic
934929867 2:98413075-98413097 TGACAATTCTTGAGGGCAGAAGG + Intergenic
935156090 2:100484867-100484889 TTGTTGTTATTGAGGACTGAGGG + Intergenic
937379119 2:121360518-121360540 TTGCCATTTTTTAGGGCAGAAGG - Intronic
937576446 2:123428209-123428231 TTGATAGTCTTGAGGGCAGAAGG - Intergenic
940225230 2:151394002-151394024 TTGTAAATATCGTGAGCAGAAGG - Intergenic
940592708 2:155749331-155749353 TTGAGATTATTGAGAGGAGAAGG - Intergenic
941301849 2:163812345-163812367 ATGTCATTATTTATGGCAGAAGG - Intergenic
942073618 2:172337158-172337180 TTGTGATTACTTAGAGCAGAAGG + Intergenic
942218507 2:173746323-173746345 TTGTGATTACTTAGGGCTGAGGG + Intergenic
942250245 2:174041171-174041193 TTTTAAATATTGAGGGGAAAAGG + Intergenic
943793811 2:191966596-191966618 TTGAAAATTTTCAGGGCAGAAGG + Intronic
944634617 2:201662969-201662991 TTGTTATTATTGATGACATATGG - Intronic
945587185 2:211680169-211680191 TTGTTGTTGTTGATGGCAGAAGG + Intronic
947951405 2:234150714-234150736 TTGTTATGATTGATGACAGAGGG + Intergenic
948627164 2:239276277-239276299 TTGGAAGTGTTGAGGGGAGAAGG + Intronic
1169182619 20:3583227-3583249 TTGCAATTTTGGAGGGAAGAAGG - Intronic
1172885647 20:38229120-38229142 TTGTAAGGCTTGAGGGCAGTTGG - Intronic
1173564521 20:44029383-44029405 TTTTCACTATTGAGGGCAGAGGG - Intronic
1174927211 20:54773556-54773578 TTATCATTATTTGGGGCAGAGGG - Intergenic
1176134632 20:63516766-63516788 TTGTAATTTTTTAGTGGAGATGG + Intergenic
1176182375 20:63756719-63756741 GTGTGGTGATTGAGGGCAGAGGG - Intronic
1177314454 21:19438721-19438743 TTGTGATTTTTGAGGGGAGAGGG - Intergenic
1178005556 21:28216159-28216181 TTTTAGATATTGAGAGCAGAAGG + Intergenic
1179204369 21:39260584-39260606 TTGTAGTTGTTTATGGCAGAAGG - Intronic
1181929172 22:26385753-26385775 TGGCAATTATTGAGGGCAAGGGG + Intergenic
1184447400 22:44557316-44557338 TTATAATTATTAACGGCAGCAGG - Intergenic
949101669 3:153037-153059 TTGTCCTTATCGATGGCAGATGG - Intergenic
957836834 3:85605088-85605110 TTCAAATTAATGAGGGCACAGGG + Intronic
960789752 3:121415556-121415578 TGGTAATTATTGAGCACAGATGG + Intronic
961063045 3:123848978-123849000 TGGTAGGAATTGAGGGCAGATGG + Intronic
961078059 3:124000162-124000184 TTGTGATTTTTGTGGGCAGAAGG + Intergenic
961305452 3:125956610-125956632 TTGTGATTTTTGTGGGCAGTAGG - Intergenic
962083326 3:132164049-132164071 ATGAGATTAATGAGGGCAGAGGG - Intronic
962390056 3:134963756-134963778 TTGTAATTTTTGATGGGAGTTGG + Intronic
963016642 3:140830147-140830169 TTTAAATTATTGAGGGGAGGAGG - Intergenic
963338418 3:144003870-144003892 TTGAAATTATTATGGGCAGAGGG + Intronic
964921352 3:161900094-161900116 TTGAAATTATTGAGGTCAAATGG - Intergenic
966404951 3:179587080-179587102 TTGTCCTTATTCAAGGCAGATGG - Intronic
966610208 3:181860544-181860566 TTGAAACTATTGACTGCAGAAGG + Intergenic
966779046 3:183567820-183567842 TTGTAATTCTGGAGGTGAGATGG - Intergenic
966986655 3:185186675-185186697 ATATAATTGTTGTGGGCAGACGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967377184 3:188817651-188817673 TTTGAATTCTTGAGGGCTGAGGG + Intronic
967620703 3:191630150-191630172 TTATACTTTTTGAGTGCAGAGGG + Intergenic
967697567 3:192551062-192551084 TTATAATTGTTTATGGCAGAAGG - Intronic
970879043 4:20906335-20906357 TTGTAATAATTCAGTGCAGACGG - Intronic
972169772 4:36331954-36331976 TTGAAATTATTGACCGCACAAGG + Intronic
974455093 4:62120043-62120065 TAATAATTATTGAGGTTAGAAGG + Intergenic
974617873 4:64313225-64313247 TTGTAAGTATTTAGGTCATATGG - Intronic
975671498 4:76785487-76785509 TTTTAATCTTTGAGGGAAGATGG - Intergenic
975874014 4:78814173-78814195 GAGTAATTCTTGAGGACAGAGGG - Intronic
975947932 4:79730470-79730492 GTGTGATGTTTGAGGGCAGAGGG - Intergenic
977328963 4:95612361-95612383 TTGGGATTGTTGAAGGCAGAAGG - Intergenic
977611809 4:99043273-99043295 TTATAATAATTCAGGGGAGAAGG - Exonic
980131303 4:128818771-128818793 TTGAAATGGTTGAGGGTAGAGGG - Intronic
980997670 4:139795976-139795998 ATGTAATAATTGAGGGCATTTGG + Intronic
981651670 4:147066521-147066543 TTTAAAATATTGAGAGCAGATGG - Intergenic
982057012 4:151561541-151561563 TAGTTATAATTGAGGGCACAAGG + Intronic
984869050 4:184310836-184310858 TTGTTATTGTTGAGGGAATATGG - Intergenic
985284714 4:188323891-188323913 TTGGAATTATATAGGGAAGATGG + Intergenic
987059856 5:14232275-14232297 GTGTATTCATTGAAGGCAGAAGG - Intronic
990938927 5:61180771-61180793 AAGTGATTATTGGGGGCAGAGGG + Intergenic
991491672 5:67189742-67189764 TTGTAATTTTTTAAGGCAAAAGG + Intronic
995762296 5:115576313-115576335 ATTTGATTATGGAGGGCAGAGGG - Intergenic
996704019 5:126478566-126478588 TTGTATTTTTTGAAGACAGAGGG - Intronic
997127697 5:131244782-131244804 TTTTAATTTTTGAGGGCTGGTGG - Intergenic
997397119 5:133570692-133570714 TTATAATTGTTGATAGCAGAAGG - Intronic
997920526 5:137974871-137974893 TTTTAATGATTGTGGGTAGAAGG + Intronic
998627090 5:143858594-143858616 TTAAAATTATCGATGGCAGAAGG - Intergenic
1000489762 5:161896910-161896932 TTGTACTTCTTGATGGCAAAAGG + Intronic
1000694770 5:164367239-164367261 TTATTATTATTGGCGGCAGAGGG + Intergenic
1001297974 5:170512075-170512097 ATGAAATGATTGGGGGCAGAAGG + Intronic
1003702402 6:8482168-8482190 TTCTAGTTATTTAAGGCAGAAGG + Intergenic
1008623696 6:53297213-53297235 TTGTAACTATTGAGGGGCAAAGG - Intronic
1009321689 6:62298282-62298304 TTATAGTTCTTGAGGTCAGAAGG - Intergenic
1009856363 6:69269884-69269906 TTGTAATATTTGATGGAAGAAGG - Intronic
1010709021 6:79150941-79150963 TTGTAGTTATTCAGAGAAGAGGG + Intergenic
1011168424 6:84477529-84477551 TTTTAATTTTTGAAGGTAGAAGG - Intergenic
1012831455 6:104208564-104208586 TAGTAATTATTGACTACAGATGG + Intergenic
1013524699 6:110963433-110963455 TTTTAATTAAAGAGGGGAGAGGG - Intronic
1014259192 6:119196891-119196913 TTGTTACTATTGAGGCCAGATGG - Intronic
1014630582 6:123784763-123784785 CTGTAATAATTCAGGGCAGTAGG - Intergenic
1015221573 6:130810080-130810102 AAGTAATTATTGAGACCAGATGG + Intergenic
1015657547 6:135536384-135536406 GTTTAGTTATTGAGGTCAGAAGG - Intergenic
1016259109 6:142146462-142146484 TTGAAGTCATTGAGGGTAGAAGG + Intergenic
1021000673 7:15326845-15326867 GTTTAATTATTAATGGCAGAGGG - Intronic
1021367578 7:19799681-19799703 TAGTTATTATTGAAGGCTGATGG - Intergenic
1022043082 7:26598966-26598988 TTTTTCTTATGGAGGGCAGAGGG + Intergenic
1022540557 7:31131278-31131300 TAGTAATTACTTAGGGCTGAGGG + Intergenic
1022922496 7:35029924-35029946 ATGTAATTATTGAGTTCAGCAGG - Intronic
1023925322 7:44664715-44664737 TTGTACTTATTGGGGGAATAGGG + Intronic
1024724279 7:52175127-52175149 TTGTAGTTTATGAGGCCAGAAGG - Intergenic
1024751675 7:52473361-52473383 TTGTAATTATTTTTAGCAGAAGG - Intergenic
1025262934 7:57432905-57432927 TTTTGTTTATGGAGGGCAGAAGG - Intergenic
1025733280 7:64125225-64125247 CTGTCATTATTCAGGGAAGAGGG + Intronic
1026273338 7:68855249-68855271 TTGGAAATAATGGGGGCAGAGGG - Intergenic
1028490880 7:91410264-91410286 TTGTTTCTTTTGAGGGCAGAAGG - Intergenic
1030100681 7:105942414-105942436 GTGCAATAATTGAGGACAGAGGG + Intronic
1033914663 7:146309062-146309084 TTTTAAATATTGAGTGCAGGTGG + Intronic
1034617239 7:152429026-152429048 ATGAAATTATTGAGGGAAGGAGG - Intronic
1035434344 7:158848351-158848373 TGGTAAATATTGAGGGTAAAAGG + Intergenic
1035933242 8:3807922-3807944 TTGTAATTTTTGAGGCTAGGTGG + Intronic
1036952666 8:13156355-13156377 TTGTAATTATTTAGCACAGCAGG - Intronic
1037062514 8:14532411-14532433 TAGTAATCATTGAGGACACAGGG - Intronic
1037440663 8:18912993-18913015 TTGAAATTACTCAGGGTAGATGG - Intronic
1038126304 8:24676730-24676752 TTGTCATTAAAGAGGGGAGAGGG + Intergenic
1038166514 8:25090122-25090144 TTATAAATATTGAGGTCAGGAGG + Intergenic
1038317122 8:26495193-26495215 ATGTAATATTTGAGGGTAGAGGG + Intronic
1038970142 8:32624322-32624344 TTGGGGTTAGTGAGGGCAGATGG + Intronic
1041990845 8:63989490-63989512 TTGTATTTTTTGAGGGCACGGGG + Intergenic
1043138825 8:76562219-76562241 TTTTAATTATAGTGGGCGGAAGG + Intergenic
1045844918 8:106622937-106622959 TTGTACCTATTGAGGGTACAGGG - Intronic
1046678237 8:117137027-117137049 ATGTGTTTCTTGAGGGCAGATGG + Intronic
1047542903 8:125787646-125787668 TGGTAAATATTGAAGTCAGAGGG - Intergenic
1047943771 8:129853154-129853176 CTGTAATTATTGAGGGTAAAAGG + Intronic
1048692863 8:136988107-136988129 TGGTAGTTATCGGGGGCAGAAGG - Intergenic
1048771362 8:137898788-137898810 TGGAGATTATTGAGGGGAGAAGG + Intergenic
1050199030 9:3121717-3121739 TTTTAATTGTTGAAGGTAGAGGG - Intergenic
1051532570 9:18121082-18121104 TTGTTTTTATTGATTGCAGATGG + Intergenic
1052021922 9:23535034-23535056 TTGTGATTTCTGGGGGCAGAAGG + Intergenic
1052161077 9:25260531-25260553 TTTTAATTATTTTGGACAGAAGG - Intergenic
1052245458 9:26328997-26329019 TTCTAAATATTGTGGGTAGAAGG - Intergenic
1052250583 9:26392982-26393004 TTGTCATTTTTGAGAGAAGAGGG - Intergenic
1053189937 9:36055821-36055843 TTGTTGTTGTTGAGGGGAGATGG + Intronic
1054746220 9:68856520-68856542 GTGAAATAATTGAGGTCAGAAGG - Intronic
1056404955 9:86264519-86264541 CTTTTATTATTGAGGGGAGAGGG - Intergenic
1060502399 9:124170860-124170882 TTGTATTTTTTTAGTGCAGATGG + Intergenic
1061115660 9:128609736-128609758 TTGTTATTATTGTGGTCACACGG + Intronic
1061372283 9:130204165-130204187 TTGTATTTTTTTAGGACAGACGG + Intronic
1186031956 X:5377878-5377900 TTGTCATTATTGGGGGCAAGGGG + Intergenic
1188916045 X:35912134-35912156 TTGTCATAATTGAGGGGAGGGGG + Intergenic
1193500457 X:82267616-82267638 TTGTAATTTTTGAGGAAAGAAGG + Intergenic
1193938300 X:87650268-87650290 TTGTAATTTTTGTAGGCACAAGG + Intronic
1194322243 X:92462914-92462936 ATGTAATTAGTGAAGTCAGATGG + Intronic
1194803049 X:98294928-98294950 CTGTAAGTTGTGAGGGCAGAGGG + Intergenic
1198217620 X:134570255-134570277 CTCTAGTTATTGGGGGCAGAGGG + Intronic
1199787753 X:151120043-151120065 TTGTAGTCATTGTGGTCAGAAGG + Intergenic
1200630401 Y:5576391-5576413 ATGTAATTAGTGAAGTCAGATGG + Intronic