ID: 1129530040

View in Genome Browser
Species Human (GRCh38)
Location 15:76258376-76258398
Sequence GATGCTTCCCTGCAGCTGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 188}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129530040_1129530041 -3 Left 1129530040 15:76258376-76258398 CCGGTCAGCTGCAGGGAAGCATC 0: 1
1: 1
2: 1
3: 11
4: 188
Right 1129530041 15:76258396-76258418 ATCCTCCCCTCAACTTCTCCTGG 0: 1
1: 1
2: 1
3: 19
4: 231
1129530040_1129530046 7 Left 1129530040 15:76258376-76258398 CCGGTCAGCTGCAGGGAAGCATC 0: 1
1: 1
2: 1
3: 11
4: 188
Right 1129530046 15:76258406-76258428 CAACTTCTCCTGGCCTAGACAGG 0: 1
1: 0
2: 1
3: 13
4: 167
1129530040_1129530048 13 Left 1129530040 15:76258376-76258398 CCGGTCAGCTGCAGGGAAGCATC 0: 1
1: 1
2: 1
3: 11
4: 188
Right 1129530048 15:76258412-76258434 CTCCTGGCCTAGACAGGGTACGG 0: 1
1: 0
2: 4
3: 13
4: 160
1129530040_1129530047 8 Left 1129530040 15:76258376-76258398 CCGGTCAGCTGCAGGGAAGCATC 0: 1
1: 1
2: 1
3: 11
4: 188
Right 1129530047 15:76258407-76258429 AACTTCTCCTGGCCTAGACAGGG 0: 1
1: 1
2: 1
3: 13
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129530040 Original CRISPR GATGCTTCCCTGCAGCTGAC CGG (reversed) Intronic
900891040 1:5449823-5449845 GAGGCATCCCTGCAGCTCCCTGG - Intergenic
900946594 1:5834435-5834457 GCTGCTCCCCTGTTGCTGACTGG - Intergenic
902500543 1:16908190-16908212 GAAGCTTCTCTGCAGGTCACAGG - Intronic
903731031 1:25495466-25495488 GATGCTTCCTTGAAGCTTAGGGG + Intronic
912480574 1:109979423-109979445 AATCCTTTCCTGCAGCAGACGGG + Intergenic
912861907 1:113220795-113220817 GATGCCTCCCAGCAGCCGAGAGG + Intergenic
913072959 1:115317761-115317783 AATGCATCCCTGCCGCTGGCAGG + Intronic
914006733 1:143738673-143738695 GAAGCTTCTCTGCAGGTCACAGG + Intergenic
914095745 1:144543250-144543272 GAAGCTTCTCTGCAGGTCACAGG + Intergenic
914302775 1:146390719-146390741 GAAGCTTCTCTGCAGGTCACAGG - Intergenic
914645557 1:149649158-149649180 GAAGCTTCTCTGCAGGTCACAGG + Intergenic
915093791 1:153444884-153444906 CATCCTTTCCTGCAGCTTACTGG + Intergenic
916052077 1:161043459-161043481 GATTGTCCCCTGCAGATGACTGG - Intronic
916726294 1:167526740-167526762 TGTGCCTCCCTTCAGCTGACTGG + Intergenic
917608495 1:176661471-176661493 CATGCTGCCCAGCAGCTGTCTGG + Intronic
922182986 1:223250748-223250770 GAGGCTTCCCTGTATCTGTCAGG - Intronic
924141115 1:241024393-241024415 GCTATTTCCCTGCAGCTGAATGG + Intronic
1063938901 10:11107456-11107478 GATGCTACCCTACAGAAGACTGG + Intronic
1063959010 10:11291134-11291156 GAGGCTTCCCTTCAACTCACAGG - Intronic
1068669941 10:59712114-59712136 AATGCTCCCCTGCAGATGATGGG - Intronic
1069568421 10:69479297-69479319 CCTGCTTCCCAGCAGCTGCCTGG + Intronic
1072668973 10:97415340-97415362 GATGCTTTTCTGCAGCTCAGTGG + Intronic
1072757179 10:98029421-98029443 GATGCTTCCGTTCTCCTGACAGG - Intronic
1073061300 10:100735410-100735432 GCTGCTTGCCTGCGGCTGGCTGG + Intergenic
1076066899 10:127455955-127455977 ACTGCTTCACTGCAGCTGGCTGG + Intergenic
1077910320 11:6567253-6567275 GGTGCTGCCCAGCAGCTGGCGGG - Exonic
1077941300 11:6846369-6846391 TATGCTTCCCTTTAGCTGATGGG - Exonic
1077998756 11:7476104-7476126 GCTTCTTCCCTGCAGGTGAAGGG - Intergenic
1078361748 11:10674687-10674709 GTGGCTTCTCTGCTGCTGACAGG + Intronic
1079806019 11:24932061-24932083 GACACTTCCCAGCAGCAGACAGG - Intronic
1083254880 11:61489876-61489898 GTGGCCTCCATGCAGCTGACCGG - Exonic
1084447252 11:69210786-69210808 CTTGCCTCCCTGCAGCTGGCTGG + Intergenic
1084738368 11:71120866-71120888 GAAGCTTCTCTGCAGGTGTCAGG - Intronic
1085496396 11:76973528-76973550 CATGCTTCCCTGGAGCTGGGTGG - Intronic
1086193058 11:84103331-84103353 GATCTGTCCCTGCAGCTGGCAGG - Intronic
1088830248 11:113530598-113530620 GATTCTACCCTGCAGCAGAAGGG - Intergenic
1089141589 11:116289066-116289088 GAAACTTTCCTGCAGCTGTCAGG - Intergenic
1091306557 11:134540024-134540046 GAAGCTTCCCTCCAGCAGAAGGG - Intergenic
1091788118 12:3255348-3255370 GAATCTCCCCAGCAGCTGACTGG + Intronic
1092069180 12:5618860-5618882 GATGATACTCTGCTGCTGACAGG - Intronic
1094499874 12:31011933-31011955 GAATCTCCCCAGCAGCTGACTGG - Intergenic
1095703791 12:45216652-45216674 GAGGCGTCCCCGCAGCTGCCAGG - Intronic
1096613809 12:52820329-52820351 GATGCATCCCAGCAACTGCCAGG + Intergenic
1097989718 12:65822920-65822942 GATGGAGCCCAGCAGCTGACTGG - Intergenic
1099519450 12:83642366-83642388 GCTGCTTCCCTGCTGCTGGGTGG + Intergenic
1100325943 12:93540033-93540055 GATGCTCCCCTTCTGATGACCGG - Intergenic
1102185027 12:110941181-110941203 GATGCTATCCTGCAGGTGCCAGG - Intergenic
1102222037 12:111201290-111201312 CACGGTTCCCTGCAGCTGCCTGG + Intronic
1102251097 12:111388096-111388118 CACGCTTCGCTGCAGCTGCCTGG + Intergenic
1102374011 12:112406704-112406726 GGCGCTTCACTGCAGCTGCCTGG - Intronic
1103961230 12:124610334-124610356 GGTGTTTTCCTGCAGCTGCCTGG - Intergenic
1105210500 13:18254276-18254298 GCTGCTTCCCTGCGGCTGATGGG + Intergenic
1107088518 13:36450771-36450793 GACGCTTTCCTGAAGCTGCCAGG - Intergenic
1107958859 13:45541979-45542001 GGTGCTTTCCTGCGGCTGCCGGG + Intronic
1113480785 13:110619057-110619079 GGTGCTCCCCTCCACCTGACAGG + Intronic
1113773531 13:112928785-112928807 GACGCTTCCCTGCAGGGGAGAGG + Intronic
1114453646 14:22842129-22842151 GATGCTTCCCAGGAACTGAGGGG - Intronic
1118716611 14:68564440-68564462 GATGCCTCCCAGCAGGGGACGGG + Intronic
1119410894 14:74429543-74429565 GATGCTTCCCTTAAGAGGACAGG + Intergenic
1119771878 14:77225228-77225250 GATGCTTCCCTGGAAATGAGTGG - Intronic
1120975899 14:90248055-90248077 CATGCTTCCCTTCTGCTGCCAGG - Intergenic
1121242314 14:92439721-92439743 AATGCTCCACTGCAGCTGGCAGG - Intronic
1121271502 14:92641100-92641122 GAAGCTTCCCTGGAGCTGAGGGG - Intronic
1121931712 14:97978216-97978238 GCTGCTTCCCTGCAACTCTCTGG - Intergenic
1124689237 15:31807945-31807967 GAAGCTTCCCTGCTGCTGATAGG + Intronic
1125688644 15:41578866-41578888 CATGCTTCCCTGCAGCTGACCGG + Exonic
1126786960 15:52185241-52185263 GCTGCCTCCCTGCAGCGGCCTGG - Intronic
1126947396 15:53837295-53837317 GATGTGTCCCAGCAGCAGACAGG - Intergenic
1128875381 15:71197312-71197334 CAGGCTTCCCTGCATCTGGCAGG - Intronic
1129054800 15:72811378-72811400 AATGCCTCCCTGCAGCCAACAGG - Intergenic
1129530040 15:76258376-76258398 GATGCTTCCCTGCAGCTGACCGG - Intronic
1129856875 15:78831010-78831032 CGTGCTTCCCTTCAGCTGGCCGG + Intronic
1130192222 15:81748406-81748428 CACCCTTCCCTGCTGCTGACAGG + Intergenic
1132012168 15:98285806-98285828 GATGCTACCCTGCAGTTGAGTGG - Intergenic
1137474788 16:48798337-48798359 GCTGTGTCCCTGCAGCTGAGGGG + Intergenic
1137578923 16:49621664-49621686 GTGGCTGCCCTGCCGCTGACGGG - Intronic
1137604939 16:49781017-49781039 GATACTTGCCTGGAGCTGCCTGG - Intronic
1138228910 16:55323936-55323958 GGAGCTTCTCTGCAGCTGCCTGG - Exonic
1138495353 16:57405568-57405590 TCTGCTTCCCAGCAGCTCACAGG + Intronic
1139374277 16:66487071-66487093 GCTGGCTCCCTGCAGCTGGCTGG - Intronic
1140935692 16:79667677-79667699 GATGCTTTCCTGCCGCTCTCCGG + Intergenic
1141876936 16:86831612-86831634 AATGCTTCCCCTCATCTGACAGG - Intergenic
1142374104 16:89697943-89697965 GAGGCTCCCCTGCTGCTTACAGG - Exonic
1144011799 17:11155956-11155978 GATGACTCCTTGCAGCTGAATGG - Intergenic
1144179549 17:12739259-12739281 CCTGCTTCCCCGCATCTGACTGG - Exonic
1148129642 17:45255120-45255142 CTTGCTTCCCTGCAGCAGAGGGG + Exonic
1148856775 17:50583243-50583265 GATGATCCTTTGCAGCTGACTGG + Intronic
1151298038 17:73200036-73200058 AGAGCTTCCCTGCAGCTGGCAGG + Intronic
1152118032 17:78400786-78400808 GATGTGTCCCTGCAGCTGCAGGG + Exonic
1152147305 17:78576104-78576126 GATGCTTTTCAGCAGCTGCCAGG - Intronic
1152552425 17:81036205-81036227 AATGCTCCCCGGCAGCTGCCGGG - Intronic
1153284874 18:3448468-3448490 GACGCTGCCCTGCAACTGCCGGG - Intronic
1153991708 18:10406262-10406284 GATGGTTCTCTGAAGCTGCCTGG - Intergenic
1156192873 18:34740017-34740039 GATGCTCCCTTCCAGCTGAGAGG - Intronic
1156338568 18:36190146-36190168 GATGCTCCCCAGCAGCTTCCAGG + Intronic
1157721798 18:49931156-49931178 GATGGTGCCCTGGAGCTGCCTGG + Intronic
1160316089 18:77849161-77849183 GAAGCTGTCCTGCAGCTGAGTGG + Intergenic
1161770294 19:6227239-6227261 GGTGCTTCCCTGCTGGGGACTGG + Intronic
1162536286 19:11264466-11264488 GATGCTATCCTGCGTCTGACTGG - Intergenic
1163275197 19:16279217-16279239 GATGCTGCTCTGCAGCCTACTGG + Intergenic
1163432054 19:17274092-17274114 TCTGCTTCCCTGCAGCTGTCTGG + Exonic
1165022924 19:32938377-32938399 TGTGCTTCCCTGCAGTTGATGGG - Intronic
1165229977 19:34380873-34380895 GTTGCCTGCCTGCAACTGACTGG + Intronic
1167263645 19:48472669-48472691 GATGCTTCCCCACAACTGCCAGG - Intronic
1168342862 19:55635685-55635707 AATGATTCGCTGCAGCTGTCTGG + Exonic
924997964 2:381404-381426 GAGGCTGCCCTGCTGCTGCCTGG + Intergenic
925311010 2:2881603-2881625 CCTGCTTCCCTGTGGCTGACAGG - Intergenic
926781260 2:16474223-16474245 CATGCTCCTCTGCAGCTCACTGG + Intergenic
929106901 2:38374462-38374484 GCTGCTTCCCTGCACCTATCTGG + Intronic
932744801 2:74324944-74324966 AATGCTTCCCTCCATGTGACAGG - Intronic
932796863 2:74703513-74703535 GCTGCTTCCCAGCAGCTAACGGG - Intergenic
933767111 2:85717486-85717508 GAAGCTTCCCTTCAGCTCATGGG + Intergenic
934723732 2:96601642-96601664 GGTGCTGCCCTCCAGCTCACAGG - Exonic
934926780 2:98387751-98387773 GTTGCTTCCCTTCTGCTCACTGG + Intronic
935344557 2:102093868-102093890 GATGCCCCACTGCAGCTGCCGGG - Intronic
936095514 2:109528068-109528090 GAGGCATCCCAGCAGCTGAAGGG + Intergenic
942366501 2:175233857-175233879 GATGCTTACCTGCATCTTATGGG + Intergenic
943146364 2:184050617-184050639 GATGCTTCCCTTCCTCTGCCTGG - Intergenic
944350065 2:198715896-198715918 GATTCTTCCCTCCTGATGACGGG + Intergenic
944666668 2:201964677-201964699 GATGCCTCCCTGTAGATGAGTGG - Intergenic
948020920 2:234732649-234732671 GATGCTTCCCAGCTGCAGGCAGG - Intergenic
948826752 2:240576765-240576787 GGTGAGTCCCTGCAGCTGATGGG + Exonic
1174116531 20:48230247-48230269 GAAGCTTCCCTAGAGCTGAGCGG + Intergenic
1174192198 20:48748589-48748611 GAAGCTTCCTTGCAGATGCCAGG + Intronic
1175015799 20:55788675-55788697 GAGTCTTCCCTTCAGCTGAAAGG - Intergenic
1175366636 20:58460708-58460730 GTTCCTTCCCTACAGCTGCCAGG + Exonic
1180765756 22:18345127-18345149 GCTGCTTCCCTGCGGCCGATGGG - Intergenic
1180780554 22:18517251-18517273 GCTGCTTCCCTGCGGCCGATGGG + Exonic
1180813273 22:18774572-18774594 GCTGCTTCCCTGCGGCCGATGGG + Intergenic
1181199448 22:21208888-21208910 GCTGCTTCCCTGCGGCCGATGGG + Exonic
1181702286 22:24628067-24628089 GCTGCTTCCCTGCGGCCGATGGG - Exonic
1182027180 22:27129309-27129331 GATGCTGACCTGCTGCTTACGGG + Intergenic
1182452371 22:30429135-30429157 AGTGCTTCCCTGCAGGTGCCTGG + Intergenic
1183656797 22:39190452-39190474 CATGCTGCCCTGCAGATGTCAGG - Intergenic
1184229059 22:43148590-43148612 GAATCTTGCCTGCACCTGACTGG + Intergenic
1203227378 22_KI270731v1_random:86018-86040 GCTGCTTCCCTGCGGCCGATGGG - Intergenic
1203263375 22_KI270734v1_random:254-276 GCTGCTTCCCTGCGGCCGATGGG + Intergenic
950456038 3:13093321-13093343 CATGCATCCCTGCAGCAGGCAGG - Intergenic
952218145 3:31297831-31297853 GATACTTGCCTGCAGCAAACAGG - Intergenic
953907106 3:46873916-46873938 GATGCCTCCCTGAAGCTGGAGGG - Intronic
954297531 3:49682487-49682509 GATGCCTCCATTCAGCTGAGCGG + Intronic
954909625 3:54092844-54092866 GATTCTTCCCTGGAGCTTTCAGG + Intergenic
955460744 3:59180445-59180467 GATGCATCCCTGTAGCAGAGTGG - Intergenic
959688819 3:109176744-109176766 GATGTTTACCTGCAGGTCACAGG + Intergenic
959911697 3:111770919-111770941 GCTGCTTTGCTACAGCTGACTGG - Intronic
961660601 3:128466893-128466915 GATGCTCACCTGCAGCTCCCAGG - Exonic
961770075 3:129242756-129242778 GATACTTCTCTGAAACTGACTGG - Intergenic
964065095 3:152568301-152568323 GCTGCTTCACTGCAGGTGACAGG + Intergenic
964479498 3:157127659-157127681 GATGCTACCCTGCTGCTGGCGGG - Intergenic
968430286 4:554411-554433 GCTGTTTCCCTGCTGTTGACGGG - Intergenic
970610853 4:17723907-17723929 GAAGCTTCCATCCAGCAGACAGG - Intronic
970628347 4:17914577-17914599 AATGCTTCTCAGCTGCTGACTGG + Intronic
974594385 4:63997454-63997476 CATGCCTCCCTTCTGCTGACAGG + Intergenic
978912489 4:114080875-114080897 GATGTTATCCTGCAGCTTACTGG + Intergenic
979378173 4:119974008-119974030 GGTGGTTACCAGCAGCTGACAGG + Intergenic
985995463 5:3595038-3595060 GATGTTTCCCTCCGGCTGCCAGG + Intergenic
986192138 5:5507464-5507486 GATGCTTATCTGCTGCTGGCAGG + Intergenic
986202528 5:5591059-5591081 GATGCTTCTCCTCAGCTGAGAGG - Intergenic
994407988 5:99369908-99369930 GCTGCTTTACTGCAGCTGAAAGG + Intergenic
996088348 5:119326528-119326550 AATGCTTCCCTGCTGCTCAGGGG - Intronic
997203140 5:132024838-132024860 GCTGTTTCCCTGCAGCTGAGTGG - Intergenic
997381478 5:133441218-133441240 GATGCCTTCCTGCACCTGAGGGG + Intronic
1001231402 5:169991635-169991657 GCTGCCTGCCTACAGCTGACTGG - Intronic
1001883933 5:175271245-175271267 GATGCCTCCCTGCAGCCCTCTGG - Intergenic
1002488800 5:179559446-179559468 GATGCTTCCCTGCAGGCACCCGG + Intronic
1002533423 5:179863050-179863072 GATGCTTTCCTGCAGCTATGTGG - Exonic
1003256687 6:4481360-4481382 GATATTTCCCTGCAGATGAGAGG + Intergenic
1008004056 6:46391358-46391380 GCTGCTTAACTGCAGCTGATAGG + Intronic
1008047284 6:46864189-46864211 TATCCTTCCCTGCTGCTGAGGGG + Intronic
1008592133 6:53005085-53005107 GATACTTTCCCTCAGCTGACTGG - Exonic
1014246645 6:119077809-119077831 GTTGCTTCCATGCATCTGCCAGG - Intronic
1023865816 7:44237890-44237912 GCTGCCACCCTGCAGCTGGCCGG + Intronic
1029176762 7:98670111-98670133 GATGCTGCCCTGTATCTGCCTGG + Intergenic
1029708632 7:102287781-102287803 GATGCGTCCCTGCCTCTGCCCGG - Intronic
1029906746 7:104100539-104100561 GAGGCTTCACTGCAGCTGGTTGG - Intergenic
1032635968 7:133709342-133709364 GATGCTTCACTGTAGCTGACTGG - Intronic
1035079408 7:156203742-156203764 GAAGCTTCCCTTCCGCTGTCTGG + Intergenic
1037538663 8:19851337-19851359 TATGCATCCCTACTGCTGACTGG - Intronic
1039111144 8:34041602-34041624 CATGCTTGCCTGCAGCAGGCAGG + Intergenic
1040106693 8:43545847-43545869 AATGCTTCCCCGCAGGTGATGGG - Intergenic
1040892674 8:52333984-52334006 AGTGCTGCCCTGTAGCTGACAGG - Intronic
1042408605 8:68435450-68435472 CATGCTTCCCTGCTGCAGGCTGG - Intronic
1046742422 8:117843646-117843668 GATGATCCCTTGCAGGTGACTGG + Intronic
1047818509 8:128492259-128492281 GATTCTCCCCTGCAGCTTCCAGG + Intergenic
1049003563 8:139841087-139841109 GATGTTTCCCTGGAGCTTCCAGG - Intronic
1049782703 8:144436085-144436107 GCTGCTTCCCTGTTGCTGGCGGG + Exonic
1052376038 9:27718565-27718587 GATGCAGACCTGCAGATGACTGG + Intergenic
1052406950 9:28073165-28073187 AAGGCTTACCAGCAGCTGACGGG + Intronic
1058935282 9:109764225-109764247 GATGTTCCCCTGCAGGTGACAGG - Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1185671196 X:1811447-1811469 AAAGCTTCCATGCAACTGACAGG + Intergenic
1185714093 X:2327442-2327464 GATGCTCACCTGCAGCACACAGG - Intronic
1189155629 X:38753971-38753993 GTTGCTCAGCTGCAGCTGACAGG - Intergenic
1189333071 X:40154774-40154796 GCTGCGTCCCTGCTGCTGCCAGG - Intronic
1189489202 X:41456571-41456593 CATGATTCCCTGGAGCTGCCAGG - Intronic
1190909570 X:54758683-54758705 GATGCGGCCCTACAGCTGAAGGG - Exonic
1192213496 X:69142448-69142470 GATGCTTCCCTGGAGCGAACAGG + Intergenic
1195222549 X:102760335-102760357 CTTGCTTCTCTGCTGCTGACAGG + Intergenic
1196825768 X:119739138-119739160 GATTCTTCCCTGCACCTTAAGGG + Intergenic
1198795445 X:140389518-140389540 CATGCCTCACTGCAGCTGGCAGG + Intergenic
1201143109 Y:11044776-11044798 GAAGCTTCTCTGCAGGTGCCAGG - Intergenic
1201711318 Y:16996029-16996051 GATGATATCCTGCAGGTGACAGG + Intergenic