ID: 1129534361

View in Genome Browser
Species Human (GRCh38)
Location 15:76299885-76299907
Sequence ATGTTGATGAGAAGGAACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 5, 3: 17, 4: 307}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129534361_1129534364 -7 Left 1129534361 15:76299885-76299907 CCCTGGTTCCTTCTCATCAACAT 0: 1
1: 0
2: 5
3: 17
4: 307
Right 1129534364 15:76299901-76299923 TCAACATTTAAACATGATTGAGG 0: 1
1: 0
2: 2
3: 28
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129534361 Original CRISPR ATGTTGATGAGAAGGAACCA GGG (reversed) Intronic
901667993 1:10837329-10837351 ATGTTACCGAGAGGGAACCAAGG + Intergenic
902953534 1:19907532-19907554 ATGGTGGTGAGTAGGAAGCACGG - Intronic
904400556 1:30253934-30253956 ATGGTGATGAGGAGCCACCAGGG + Intergenic
906587514 1:46992429-46992451 AAGTTGATTAGAAATAACCAGGG - Intergenic
907426124 1:54380289-54380311 ATGGGGGTGAGGAGGAACCATGG - Intronic
907672860 1:56492216-56492238 ATGATGTGGAGAAGGAAACAAGG - Intergenic
909100256 1:71340767-71340789 ATTGTGATGAGATGGGACCAGGG - Intergenic
909149291 1:71980620-71980642 TTGTAGATGAGAAGAAGCCATGG - Intronic
914453881 1:147817340-147817362 ATGTTTATGAGAGGACACCAAGG - Intergenic
914938180 1:151998820-151998842 ATGTGGGTGAGAAAGAACCTTGG + Intergenic
915068021 1:153243207-153243229 GTGATGATGAGAATGAATCAAGG + Intergenic
915276000 1:154788574-154788596 ATCTTCATGAAAATGAACCATGG - Intronic
915732427 1:158063456-158063478 ATGCTGATGAGATGAAATCAGGG - Intronic
916012524 1:160718938-160718960 ATTGTGATGAGACGGGACCAAGG + Intergenic
916217044 1:162405280-162405302 ATGTTGATGAGAAATTACAAAGG + Intronic
917648017 1:177047913-177047935 GGGTTGAAGAGAAGGAACAAAGG - Intronic
918729488 1:187973084-187973106 ACTTTGATGAGAAGAAAACACGG - Intergenic
919601691 1:199631084-199631106 CTTTTGATGAGAAGGAACTATGG + Intergenic
920913788 1:210241666-210241688 AATTTGATGAAAAGGATCCATGG + Exonic
922097038 1:222451342-222451364 ATGCTGATGAGTATGAGCCAGGG + Intergenic
924271757 1:242341014-242341036 GTCTTCATGAAAAGGAACCAGGG + Intronic
1063021437 10:2132909-2132931 CTGCTGATGAGAAGGAAAAATGG + Intergenic
1063041807 10:2348274-2348296 ATGTTGAGGAGATGGAGCAATGG + Intergenic
1063516077 10:6696968-6696990 ATGTTGATGAGAAAAAGCAAAGG + Intergenic
1063541933 10:6942776-6942798 ATGCAGATGAGAAGGAATCCAGG - Intergenic
1065676856 10:28185536-28185558 AATTTGATGTGAAGGAATCATGG + Intronic
1066449249 10:35512900-35512922 ATGATGAGGAGGAGGAAGCAGGG - Intronic
1066712917 10:38255114-38255136 GTCTTCATGAAAAGGAACCAGGG - Intergenic
1067559213 10:47293110-47293132 ATATTGATACGAAGGACCCAAGG - Intergenic
1069218054 10:65846965-65846987 ATGTTGCTCAGAAGGAAAAAAGG + Intergenic
1069850405 10:71400402-71400424 AAGGTGATGAGGAGGAACTATGG + Intronic
1070706601 10:78643618-78643640 ATGTTGTAGAGGAAGAACCAAGG + Intergenic
1072828290 10:98630525-98630547 ATGTGGATGAGAAGTGAGCAGGG - Intronic
1072964175 10:99956739-99956761 ATGAGGATGAGGAGGAGCCAGGG - Exonic
1073267131 10:102234537-102234559 ATGTCCCTGAGAAGGAACTATGG + Intronic
1074326629 10:112456795-112456817 AATTTGATCAGAATGAACCAAGG + Intronic
1075373382 10:121956762-121956784 ATGCTGGTAAGATGGAACCAGGG + Intergenic
1075406006 10:122196090-122196112 CTGTACCTGAGAAGGAACCAAGG + Intronic
1078470197 11:11580343-11580365 AATTTGATGAGGAGGACCCAGGG - Intronic
1078542203 11:12221707-12221729 ATGGTGAAGAGCTGGAACCAGGG + Exonic
1080397256 11:31901718-31901740 AAGGTGAGGAGAAGGGACCAAGG - Intronic
1081728720 11:45353324-45353346 ATATTGATGAGAAGGAGCCAGGG - Intergenic
1083058284 11:59844090-59844112 ATGTTTTTGAGAAGGAATGAGGG - Intronic
1084554059 11:69865348-69865370 GTATTGAAGAGAAGAAACCAGGG + Intergenic
1085536797 11:77226199-77226221 ATGGAGATGAGGAGGAAACATGG - Intronic
1086160940 11:83721015-83721037 ATTTTGATGAGAAAGAATCTGGG + Intronic
1087582820 11:100080559-100080581 CTGTTGCTGAGAAGAAAGCAAGG + Intronic
1088031872 11:105261407-105261429 ATGTTAATCAGAAAGAACTAAGG + Intergenic
1088367970 11:109058727-109058749 ATTTTCATGAGAAAGAAGCAGGG - Intergenic
1089914626 11:122141427-122141449 ATATTTGTGAAAAGGAACCAAGG - Intergenic
1090092978 11:123715742-123715764 AAGCTGAGGAGAAGGAACAAGGG - Intergenic
1090579934 11:128148649-128148671 ATGTTGATGGGAAGGAAGGAGGG - Intergenic
1091670677 12:2449990-2450012 AGGTGGATGAGAAGGAAACAGGG + Intronic
1092600804 12:10061952-10061974 ATTTTAATCAGAAGGAACTATGG - Intronic
1092691010 12:11109701-11109723 ATGATGATGAGGAAAAACCAGGG + Intronic
1093153783 12:15655738-15655760 ACGTTCTTGAGAGGGAACCATGG - Intronic
1093487256 12:19665483-19665505 ATGTTCAGGAGAGGAAACCAAGG + Intronic
1093546173 12:20351786-20351808 TTATTGATGAGAAGAAATCAAGG - Intergenic
1093957286 12:25235725-25235747 ATGTTGAGGACACAGAACCAAGG + Intronic
1094578986 12:31716113-31716135 ATGTTGAGCAAAAGAAACCATGG - Intronic
1095491802 12:42742876-42742898 AGGCTGATGGGAAGGAACCCTGG - Intergenic
1096253585 12:50049737-50049759 ATGTTGATGATGGGGGACCAGGG - Intergenic
1096654526 12:53080134-53080156 ATGGTGATGGGAAGGGAGCAAGG - Intergenic
1096810846 12:54168881-54168903 ATGCTGAACAGAAGGAACCAGGG + Intronic
1097133922 12:56835782-56835804 ATTGTGATGAGACGGGACCAAGG - Intergenic
1097182138 12:57177667-57177689 AGGGTGATGAGAAGGACCAAGGG + Intronic
1098188819 12:67926373-67926395 ATGTTGATGTGAGGGAAAGAGGG + Intergenic
1099437034 12:82657687-82657709 ATTGTGATGAGATGGGACCAAGG - Intergenic
1100624340 12:96315787-96315809 ATGTTGATGAGAAGGTCCCTGGG + Intronic
1101175975 12:102151868-102151890 AAGCTGAGAAGAAGGAACCAGGG + Intronic
1102767601 12:115447266-115447288 ATTTTGCTGATAAGAAACCAAGG + Intergenic
1104245556 12:127037616-127037638 ATGTTGATGAGAAAAAACACCGG - Intergenic
1104267178 12:127244502-127244524 AGGGTGATGGGAAGAAACCAAGG - Intergenic
1104659693 12:130601912-130601934 ATGTCAATGAGAAGGAATAAAGG + Intronic
1106366834 13:29090034-29090056 ATAGAGATGAGAAAGAACCAGGG - Intronic
1108074316 13:46663588-46663610 ACTTTGATGAGAAGCAAACAGGG + Intronic
1108250586 13:48563613-48563635 ATGATGATAATAAGGGACCATGG - Intergenic
1108352339 13:49598826-49598848 CTGTTGAGGAGAAGGACCTAGGG - Intergenic
1108439730 13:50438705-50438727 ATGCTGATGAGAATAATCCAGGG + Intronic
1108489707 13:50969255-50969277 ATGTGGATGAGAAGGAAGCAAGG - Intronic
1108501321 13:51072300-51072322 ATCTTGAGGAGAAGGAAGGAAGG - Intergenic
1108782102 13:53848928-53848950 ATGTTGATGAAAAGGGAAGATGG + Intergenic
1109489590 13:63078618-63078640 ATGTTGATGAGAATGTATAATGG - Intergenic
1109786438 13:67181863-67181885 ATGTTGCTGAGGAGGCACGAGGG - Intronic
1110278457 13:73664381-73664403 ATGTTGTGGAGAAGGACACATGG - Intergenic
1111199932 13:84922022-84922044 ATGATGATGATAAGGACACATGG - Intergenic
1111664810 13:91253813-91253835 CTGTTGGTGGGAAGGAACCTTGG + Intergenic
1111684363 13:91483803-91483825 ATGTTGATGAGAAAAAACATTGG - Intronic
1112988512 13:105481733-105481755 ATACTGATGAGAAGGATACAAGG - Intronic
1113316758 13:109188791-109188813 ATGTTCAAGAGAAGGAAGCAGGG + Intronic
1113889467 13:113728336-113728358 ATGGTGATGAGGAGTACCCATGG + Intronic
1113889483 13:113728409-113728431 ATGGTGATGAGGAGTACCCATGG + Intronic
1113889495 13:113728463-113728485 ATGGTGATGAGGAGTACCCATGG + Intronic
1114814786 14:25944286-25944308 ATTTTGATGACAAGAAAGCAGGG - Intergenic
1116251912 14:42496623-42496645 AAGTAGATGAGAAGGAACCTGGG - Intergenic
1118542361 14:66842253-66842275 AAGTGGATGAGAAAGAATCAGGG - Intronic
1120145887 14:80978065-80978087 ATGTTGTTGAGGAGGAGGCAAGG - Intronic
1121743416 14:96269426-96269448 AGGATGCTGAGAAGGAATCAAGG - Intergenic
1121854697 14:97256492-97256514 ATGGTGAAGAGAAATAACCAGGG - Intergenic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1123060948 14:105594155-105594177 ATTTTGAGGTGAAGGAACCCTGG - Intergenic
1123787608 15:23688411-23688433 CTGCTGATGAGAAGAAACCCGGG - Intergenic
1124650666 15:31471478-31471500 AGGTTGGTGACAAGGAAGCATGG + Intergenic
1124722923 15:32126647-32126669 ATGATGATGAGAAAAACCCATGG - Intronic
1126096015 15:45091223-45091245 ATGAGGATGAGAATGAAACAGGG - Intergenic
1127634118 15:60852903-60852925 ATGAATATGAGAAGGAAACATGG + Intronic
1129534361 15:76299885-76299907 ATGTTGATGAGAAGGAACCAGGG - Intronic
1129645505 15:77427216-77427238 ATCTTAATGAGAAGGAACCAAGG + Intronic
1130049716 15:80473746-80473768 ATGCTGATGAGCAGAACCCAGGG - Intronic
1130848157 15:87766883-87766905 CTCATGATGAGAAGGAACTAAGG - Intergenic
1131845347 15:96485116-96485138 ATTTTGATGAACAGGCACCAGGG + Intergenic
1134358543 16:13507551-13507573 ATGTTATTAAGAAGGAACCCAGG + Intergenic
1135482778 16:22835904-22835926 ATGTTAAAGATAAGGAAACAAGG + Intronic
1135777375 16:25268693-25268715 AAGTTGAAGAGGAGGAACAATGG + Intergenic
1136681188 16:31963725-31963747 ATTTTGATGAGAATGATCCCAGG - Intergenic
1136781501 16:32905237-32905259 ATTTTGATGAGAACGATCCCAGG - Intergenic
1136888295 16:33948603-33948625 ATTTTGATGAGAACGATCCCAGG + Intergenic
1137763993 16:50963633-50963655 AGGTGGCTGAGAAGGATCCAAGG + Intergenic
1138495312 16:57405321-57405343 GTGGAGATGAGAAGGAAGCAAGG + Intronic
1139002673 16:62532223-62532245 ATCTTGATGAGAAAGAATAAAGG - Intergenic
1140900881 16:79366408-79366430 ATGGTTATGAGAATGACCCAAGG - Intergenic
1141778375 16:86139788-86139810 ATGTTGATCAAAGGGAACAAAGG - Intergenic
1203084153 16_KI270728v1_random:1169219-1169241 ATTTTGATGAGAACGATCCCAGG - Intergenic
1146635434 17:34500782-34500804 ATGTTGAGGTGAAAGAGCCAAGG + Intergenic
1146821519 17:35986603-35986625 ATGGTGATGAGGAGGAAGAAGGG + Exonic
1146911380 17:36650608-36650630 TTTTTAATGAGAAGGACCCAAGG + Intergenic
1148245873 17:46030551-46030573 ATCTGGATGTGAAGGAAACATGG + Exonic
1153682075 18:7510382-7510404 ATGAGGATGTGAAGGAAGCAGGG + Intergenic
1155796547 18:30044698-30044720 ATGTTTATGAGTAAGAAGCAAGG - Intergenic
1156159585 18:34343368-34343390 ATGCTGAAGAGAAGGAAATAAGG - Intergenic
1156197372 18:34790433-34790455 ATGTAGATGAGAAGTACACAGGG + Intronic
1157301485 18:46482918-46482940 AAGGTGCTGAGAAGGAGCCAGGG - Intronic
1157453593 18:47806518-47806540 ATCTTGAGAAAAAGGAACCACGG - Intergenic
1160831713 19:1107499-1107521 ATGTGGATGAGAGGGGACGAGGG - Intergenic
1161873310 19:6887330-6887352 ATGTTGATGGGAAAGAAAAAGGG + Intergenic
1165948703 19:39460415-39460437 ATGATGCTGAGAGGCAACCAAGG - Intronic
1167190858 19:47988573-47988595 AAGAGGATGAGGAGGAACCATGG - Intronic
1167479329 19:49719875-49719897 CGCTTGATGAGAAGGACCCACGG - Intergenic
1167529192 19:50004378-50004400 ATCATGATGAGAAGGAATGAGGG - Intronic
1167598310 19:50439018-50439040 ATGTTGATGAGAAGTGGCCAAGG - Intronic
1167962026 19:53113669-53113691 TTGTTGATGAGAATGAACAATGG + Intronic
1168112529 19:54201574-54201596 CGCTTGATGAGAAGGACCCACGG + Exonic
1168232440 19:55041773-55041795 AGGTGGCTGTGAAGGAACCAGGG - Intronic
925997844 2:9306581-9306603 AGGTTGATGAGAAGGAAAATGGG + Intronic
926011218 2:9409638-9409660 ATGTTGATGAGAAAAAAAAATGG - Intronic
926669163 2:15560286-15560308 GTGATGAAGAGTAGGAACCATGG - Intronic
927239948 2:20912606-20912628 CTGTTGATCAGAAGGGACCCAGG - Intergenic
927267876 2:21173230-21173252 ATGTTTGGGAGAAGAAACCAAGG + Intergenic
927427670 2:22998910-22998932 AAGTTGAGGTGAAGGAACCAAGG - Intergenic
930009411 2:46924296-46924318 ATGTTGATGAGCTGATACCAAGG - Intronic
930395886 2:50824400-50824422 ATGTGAGTGAGAAGGAGCCAAGG - Intronic
930454947 2:51595850-51595872 ATGCTAGTGAGAAGGAAACAGGG - Intergenic
930857074 2:56030294-56030316 ATTTTGAAGAGCAGGAATCAGGG + Intergenic
931155073 2:59618885-59618907 AAGTAGATGAGAAGGACTCAGGG - Intergenic
932179737 2:69635336-69635358 CTGTTGATGGGAATGAAACATGG + Intronic
932403089 2:71495725-71495747 ATGTGGGTGTGCAGGAACCAGGG - Intronic
932514626 2:72333368-72333390 CTATTCATGAGAAGGAAGCATGG - Intronic
932869977 2:75389045-75389067 ATTGTGATGAGATGGGACCAAGG - Intergenic
933446022 2:82380746-82380768 ATGTTAATGAGAAGGAAGATTGG - Intergenic
934138556 2:89021415-89021437 AAATTGACAAGAAGGAACCAAGG - Intergenic
934646844 2:96063866-96063888 GTGTTGCTGAGAACGAATCAGGG - Intergenic
934757976 2:96838185-96838207 AGGTAGACGAAAAGGAACCATGG + Exonic
934840242 2:97619948-97619970 GTGTTGCTGAGAATGAATCAGGG - Intergenic
935224573 2:101042173-101042195 ATGTTGATGAGGAGGAAAGAAGG + Intronic
935257879 2:101328475-101328497 CAGCTGAAGAGAAGGAACCAGGG + Intergenic
935304119 2:101720074-101720096 ATGCTGTTGAGAAAGAAACAAGG + Intronic
936637160 2:114271988-114272010 ATTTTGATGAAAAGGAAAAAGGG - Intergenic
936863144 2:117046100-117046122 ATGTTGTTGAGGGGGAACAATGG + Intergenic
937649397 2:124303128-124303150 ATGTTCATGAGAAGGAGTGAGGG - Intronic
939263659 2:139843231-139843253 ATGTGGAGAAAAAGGAACCATGG + Intergenic
939289343 2:140173282-140173304 GTGGTGATGAGTAGGAAGCAGGG + Intergenic
941300582 2:163796061-163796083 ATTTTGAAGAGATGGAGCCAGGG - Intergenic
943275354 2:185860206-185860228 AAGTTGATGAGAGGTTACCAGGG + Intergenic
945364690 2:208937531-208937553 ATGTTGAAGAATAGGAAACATGG - Intergenic
945751918 2:213797955-213797977 ATGTTGATGAGAATGAGAGAAGG - Intronic
946467150 2:219922007-219922029 AAGTTGATGAGAAGGAAACAGGG - Intergenic
947004937 2:225500112-225500134 ATGTAGAGGAGAAAGACCCAGGG + Intronic
1169203298 20:3726086-3726108 AAGTTGATGTCAAGGATCCAGGG - Intergenic
1170123435 20:12935973-12935995 AGATGGGTGAGAAGGAACCAAGG - Intergenic
1172339095 20:34142310-34142332 CTTCAGATGAGAAGGAACCAGGG - Intergenic
1172441247 20:34968124-34968146 ATTTTGCAGAGAAGGAACCCAGG + Intergenic
1172836599 20:37877317-37877339 ATCTGGACGAGAAGGAACCTGGG - Intergenic
1174677473 20:52372462-52372484 AGGTTCAGGAGAAGGATCCAGGG - Intergenic
1177518173 21:22181707-22181729 CTGTTGGTGAGAAGGCAACATGG - Intergenic
1178840215 21:36132634-36132656 CGCTTGATGAGAAGGACCCACGG + Intergenic
1178927447 21:36787574-36787596 TTGATGATGAAAAGAAACCAGGG - Intronic
1179378126 21:40870405-40870427 AAGTTTATCAGAAAGAACCATGG + Intergenic
1179903967 21:44411616-44411638 ATGTTGAACAGAAGGGACAATGG + Intronic
1180692461 22:17728491-17728513 ATGTTGCTGGCAAGTAACCATGG - Exonic
1180787916 22:18557274-18557296 AGGTGGATGAGAAGGATCCTAGG - Intergenic
1181233822 22:21438044-21438066 AGGTGGATGAGAAGGATCCTAGG + Intronic
1181244828 22:21496799-21496821 AGGTGGATGAGAAGGATCCTAGG - Intergenic
1182419607 22:30242500-30242522 ATTTTGTTGAGTAGGGACCAGGG + Exonic
1184540569 22:45121279-45121301 CTGTTGATGAGAAGAATCCATGG - Intergenic
950011097 3:9724409-9724431 ATGTGGGGGAGAAGGAAGCAAGG + Intronic
953683960 3:45061495-45061517 ATGGTGATGAGAGGGAACTTTGG + Intergenic
953780734 3:45867939-45867961 CTGGTGATGAGAAGGATTCAAGG + Intronic
953780741 3:45868055-45868077 CTGGTGATGAGAAGGATTCAAGG - Intronic
957803164 3:85112205-85112227 ATGCTGATGAGAAGGATATATGG - Intronic
958422937 3:93949159-93949181 ATGTTGATGAGAATGATTCTTGG - Intronic
958555756 3:95673824-95673846 ATGTTTAGGAGAGGAAACCAAGG - Intergenic
960320275 3:116226398-116226420 AATGAGATGAGAAGGAACCAAGG - Intronic
961102505 3:124212609-124212631 ATGTCTATGTGAAGGAACTAAGG - Intronic
961180786 3:124875519-124875541 ATGTGGATAAAAGGGAACCAGGG + Intronic
962728773 3:138260248-138260270 ATGTTGTTTAGAAGGAACTTGGG - Intronic
962897404 3:139728694-139728716 ACATTTATGAGAAGGAACAAAGG + Intergenic
963265680 3:143238149-143238171 ATGTTTATGGGATGGAAACATGG - Intergenic
963795517 3:149627409-149627431 ATTTTGATGGGAAGAAACTATGG + Intronic
965871467 3:173270173-173270195 ATGCTGATAAGAAGGGACAAGGG + Intergenic
967818544 3:193819001-193819023 ATGTGGATAAGAATGCACCATGG + Intergenic
968200321 3:196748260-196748282 ATGTTGATGAGCAGGAGGCTTGG - Intronic
969650909 4:8467391-8467413 ACAATGATGAGAGGGAACCATGG + Intronic
969945867 4:10782626-10782648 AGGTTGATGGGAAGGATCCAGGG - Intergenic
970043907 4:11828146-11828168 ATGTTGTTGGGAAGGAAGGAAGG - Intergenic
970645648 4:18117688-18117710 ATGTAAATAAGAAGGAAACATGG - Intergenic
971336510 4:25728404-25728426 CTGTTGATGAGAATGGCCCATGG - Intergenic
972674323 4:41244660-41244682 ATGTTAAAAAGAAGGAAACAAGG - Intergenic
976041308 4:80888042-80888064 ATGTAGACAAGAAGGAAGCAAGG + Intronic
976222766 4:82771290-82771312 ATGGAGATGAGAAAGAACCCAGG - Intronic
979436338 4:120696752-120696774 ATGTTAATGAGAGGGAGGCAAGG + Intronic
979735167 4:124073611-124073633 ATGAAGATGAGAAAGAATCAAGG + Intergenic
980262094 4:130462875-130462897 ATGTTTATAAGTAGGAACAAGGG - Intergenic
980419506 4:132541916-132541938 ATTGTGATGAGATGGGACCAAGG + Intergenic
981090015 4:140722551-140722573 ATGTTGATCTTAAGGAACCTTGG + Intronic
981526156 4:145708567-145708589 ATTGTGATGAGATGGGACCAAGG - Intronic
981928002 4:150160431-150160453 ATGTTGATCAGGAGGTCCCAAGG + Intronic
982676868 4:158386429-158386451 ATGATGATGAGTAGCAATCATGG - Intronic
982869421 4:160558466-160558488 TTGTTTATGAGAAGTAACAAGGG + Intergenic
983262731 4:165474576-165474598 ATTGTGATGAGATGGAACCAAGG - Intronic
983510563 4:168605569-168605591 ATGTTGGTCAGCAGGATCCAGGG + Intronic
983975387 4:173927417-173927439 ATGTTTATTTCAAGGAACCAAGG - Intergenic
985200579 4:187480953-187480975 ATATTGTCGAGAAGGAAGCAGGG + Intergenic
985621386 5:957928-957950 CTGCTGATGGGAAGGACCCACGG + Intergenic
987017403 5:13834860-13834882 CTTTGCATGAGAAGGAACCATGG + Intronic
988363413 5:30265310-30265332 ATGTGGCTGAGAAGGATTCAAGG + Intergenic
991548993 5:67816141-67816163 ATGATGACGAGAAGGCACAAAGG + Intergenic
992036363 5:72782474-72782496 ATGTTCAGGAGAGGAAACCAAGG + Intergenic
992895593 5:81242474-81242496 AGGTTGATGACAAGAAACTAGGG - Intronic
993677006 5:90828139-90828161 AGACTGTTGAGAAGGAACCAAGG + Intronic
993938517 5:94031599-94031621 ATGTTCAGGAGAGGAAACCAAGG + Intronic
996045051 5:118862443-118862465 ATGTAAATGAGAAGGTATCAAGG + Intronic
997222375 5:132180217-132180239 AGGCTGATGAAAAGGAGCCAGGG + Intergenic
999099948 5:149015313-149015335 GTGGTGATAGGAAGGAACCAAGG - Intronic
1003938628 6:11001816-11001838 GTGTTGAAGAAAAGGAAGCAAGG + Intronic
1004034460 6:11909566-11909588 ATGCTGATGCCAAGGAACCTTGG - Intergenic
1004060846 6:12196627-12196649 ATGATGATGGGAAGGAAGGAAGG - Intergenic
1004855260 6:19743389-19743411 ATAATGATGAGTAGGAAACAAGG - Intergenic
1007210426 6:40189449-40189471 ATGTAGCACAGAAGGAACCAAGG + Intergenic
1009736252 6:67679831-67679853 ATGATTAAGAGCAGGAACCAAGG + Intergenic
1009791558 6:68407928-68407950 ATGAAGATGGGAAGGAAACAAGG - Intergenic
1009857607 6:69284554-69284576 ATGTTGAAAAGTAGTAACCAGGG - Intronic
1012199417 6:96386802-96386824 ATGTTGAGGGGAAAGAACAATGG - Intergenic
1012657940 6:101849283-101849305 ATGTTAAGGAGATGGAACAAAGG - Intronic
1012834756 6:104251580-104251602 ATGTTTAGGAGAACAAACCAAGG + Intergenic
1013306899 6:108856484-108856506 AGGTTGATGACAAGAAACTAGGG - Intronic
1013448022 6:110250824-110250846 ATGTGGCTGAGAAGGAACCAAGG - Intronic
1013639377 6:112058390-112058412 ATGTTTATTTGATGGAACCAGGG - Intronic
1014316909 6:119879004-119879026 GTGTTTAAGAGAAGGAATCATGG - Intergenic
1014590998 6:123269895-123269917 ATATTGATGAGTACAAACCATGG + Intronic
1015709112 6:136120426-136120448 ATCTAGTTGAGAAAGAACCATGG + Intronic
1015977991 6:138810888-138810910 ATATTGATGAGATGGAACTTTGG + Intronic
1016997387 6:149970075-149970097 AAGATGATGAGAAGGCTCCAGGG - Exonic
1018051959 6:160016914-160016936 CTCTAGATGAGAAGGAAGCAGGG + Intronic
1018064627 6:160116575-160116597 ATGTGGATGGGAAGCAGCCAGGG - Intergenic
1018410932 6:163547705-163547727 ATATAGATGGGAAGGAGCCAGGG - Intronic
1018774955 6:167006055-167006077 ATGTTGCAGATAAGGAACCTGGG - Intronic
1019862604 7:3674305-3674327 ATGGTAATGAGAAGGAAGGAGGG + Intronic
1020434462 7:8147833-8147855 ATGTTGATGAGAAAAAAAAATGG + Intronic
1021590653 7:22257610-22257632 GTGTGGATGTGAAGGAACAATGG - Intronic
1023118999 7:36890602-36890624 ATTTTGAAGAGAAGGGACAAAGG - Intronic
1023826986 7:44016277-44016299 ATTTTGATAAAAAGGTACCAAGG + Intergenic
1024034958 7:45500009-45500031 ATTTTTATGAGAAGAAACTAAGG + Intergenic
1025012172 7:55406329-55406351 TTGTTCCTGAGAAGGCACCAGGG - Intronic
1026628912 7:72020868-72020890 ATCTGGATGAGAAGGAGCTATGG - Intronic
1026659404 7:72286420-72286442 GTGTTGGTGAGAAGGATCCCAGG + Intronic
1028348093 7:89808411-89808433 ATGTTGATGTAAAGGAGCCTGGG + Intergenic
1028367706 7:90053707-90053729 ATGTTGATGAGAAAACACAATGG + Intergenic
1028625131 7:92869128-92869150 ATCTTGAAAAGAAGGATCCAGGG - Intergenic
1028832721 7:95344497-95344519 ATCATGATGAGATGGGACCAAGG + Intergenic
1028840841 7:95428747-95428769 ATGATGCTGAGAAGGAATGAAGG + Intronic
1029751726 7:102546563-102546585 ATATGGATGAGAAGAAACCTGGG + Intronic
1029769679 7:102645654-102645676 ATATGGATGAGAAGAAACCTGGG + Intronic
1029943022 7:104500277-104500299 CAGTTGATTAGAAGGAATCACGG - Intronic
1030699211 7:112620305-112620327 ATATTGATGAGAATGGCCCATGG - Intergenic
1031408228 7:121411125-121411147 AACTTGCTCAGAAGGAACCAAGG - Intergenic
1031661400 7:124429550-124429572 ATGTTGATGAGAAAAACTCATGG + Intergenic
1032690090 7:134277029-134277051 ATAAGGATGAAAAGGAACCAAGG + Intergenic
1034926926 7:155130013-155130035 ACGTGGATGTGAAGGCACCAAGG + Intergenic
1036595550 8:10208725-10208747 ACGTGGAGGTGAAGGAACCAAGG - Intronic
1036680420 8:10868564-10868586 ATGTTGTAGAGAAGAAATCAGGG - Intergenic
1037282645 8:17260341-17260363 ATGTTGGGGAGAAGGAATTAAGG - Intronic
1039408471 8:37332397-37332419 ATGATGTTGAGAAAGAACCATGG + Intergenic
1040660294 8:49565974-49565996 CTGATGATGAGAAGGAACTAAGG - Intergenic
1041385440 8:57297503-57297525 ATTGTGATGAGATGGGACCAAGG - Intergenic
1041393459 8:57368343-57368365 ATCATGATGAGATGGTACCAAGG + Intergenic
1041645086 8:60243380-60243402 ATGGTGTTGAGAAGGAGCTAAGG - Intronic
1041728195 8:61037966-61037988 CTGAGGATGAGAAGAAACCAGGG + Intergenic
1041835836 8:62214139-62214161 ATTTTGAATAGAAGGATCCAGGG - Intergenic
1043344865 8:79287237-79287259 ATTGTGATGAGATGGGACCAAGG - Intergenic
1044659254 8:94579187-94579209 ATTGTGATGAGATGGGACCAAGG - Intergenic
1045057092 8:98378671-98378693 ATGATGATGATAAGGAAGCGGGG - Intergenic
1046632026 8:116630834-116630856 ATGTTTATGAAAAGGAAACATGG - Intergenic
1047495215 8:125404253-125404275 TTGTTGATAAGAAGGAAGGAAGG - Intergenic
1048897089 8:139001770-139001792 ATGGTGAGGAGGAAGAACCATGG - Intergenic
1049241516 8:141539724-141539746 ATGTGGGTGAGGGGGAACCAGGG - Intergenic
1050273888 9:3976190-3976212 ATGTTGATGTGAAGGCAACTGGG - Intronic
1050872204 9:10586803-10586825 ATATTGATGACAAAGAAGCATGG - Intronic
1051318179 9:15866446-15866468 ATGATGATGAGAAAGAGGCAGGG + Intronic
1054737820 9:68773357-68773379 ATGTCAAAGAGAAGGCACCAAGG + Intronic
1056210798 9:84363340-84363362 ATGTCTATGGGAAGGAATCAAGG + Intergenic
1059436932 9:114282598-114282620 ATGTGGAATAGAGGGAACCAAGG + Intronic
1059678874 9:116567038-116567060 ATGTACATATGAAGGAACCAAGG + Intronic
1059714114 9:116897197-116897219 ATGTAGATGGGAAGGACACATGG + Intronic
1185689290 X:2139870-2139892 ATGTTGAATAGAAGGAAGGATGG - Intergenic
1186529366 X:10279685-10279707 ATGTTTATGAAAAGGAAGGAGGG - Intergenic
1188283060 X:28294444-28294466 ATGTGGATAATAAGGAATCATGG - Intergenic
1188589597 X:31817727-31817749 ATGTTGGGGAGAAGGAAGTAGGG + Intronic
1189157899 X:38778296-38778318 ATGTTGAAGAAAAGACACCATGG + Intergenic
1190623566 X:52313644-52313666 CTGTTGATCAGCAGGAAACATGG - Intergenic
1190734859 X:53249530-53249552 ATTTTGTAGATAAGGAACCAAGG - Intronic
1193471856 X:81914772-81914794 ATTTTGATAAAAAGGATCCAAGG + Intergenic
1193486310 X:82088704-82088726 ATTGTGATGAGATGGGACCAAGG + Intergenic
1193639815 X:83999393-83999415 ATGTTGTTGGGAAGGCTCCAGGG + Intergenic
1194849928 X:98857670-98857692 ATTGTGATGAGATGGGACCAAGG + Intergenic
1195220116 X:102738564-102738586 ATCGTGATGAGATGGGACCATGG - Intronic
1195570850 X:106397117-106397139 ATATTGATGTGAAGGCATCAAGG - Intergenic
1197457034 X:126689732-126689754 ATGTTGCTGAGAAGGCAATATGG - Intergenic
1199735576 X:150683141-150683163 ATGTTGATAATAAGGAAACTGGG + Intergenic
1201779494 Y:17703372-17703394 AAGTTGGTGAGAAGAATCCATGG + Intergenic
1201822062 Y:18202620-18202642 AAGTTGGTGAGAAGAATCCATGG - Intergenic