ID: 1129534438

View in Genome Browser
Species Human (GRCh38)
Location 15:76300580-76300602
Sequence TTGGTAGGAAGCAGAATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 228}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129534438 Original CRISPR TTGGTAGGAAGCAGAATTGT AGG (reversed) Intronic
901678540 1:10900450-10900472 TTGGCAGGGGGCGGAATTGTGGG - Intergenic
901699966 1:11040002-11040024 TTGGTAGGCAGAAGAATGGGTGG + Intronic
905253689 1:36666174-36666196 TGGGTGGGAAGCACAATGGTTGG - Intergenic
905299138 1:36974147-36974169 TTGGGAGGAAGCAGGAGTGCAGG - Intronic
905318270 1:37097304-37097326 TTGGAAGGAGACAGAATGGTGGG + Intergenic
906376694 1:45302371-45302393 TTTCTTGGAAGTAGAATTGTTGG - Intronic
906944547 1:50284551-50284573 TTTGAAGGATGCAGAAGTGTTGG - Intergenic
907646463 1:56249397-56249419 TGGGTGGGGAGCAGGATTGTTGG - Intergenic
908855929 1:68428205-68428227 AGGGTAGGAAGTGGAATTGTAGG + Intergenic
909162093 1:72165298-72165320 TTAGTAAGAAGCAAAATAGTTGG + Intronic
909744362 1:79075071-79075093 AAGCTAGGAAGCAGAATTGTAGG + Intergenic
914745211 1:150496586-150496608 GAGGGAGGAAGCAGAATTGCGGG + Exonic
917477141 1:175378689-175378711 ATGGAAAGAAGCAGACTTGTGGG + Intronic
917514970 1:175699632-175699654 TTGGTAGGTGGGAGAGTTGTTGG + Intronic
918174462 1:182030332-182030354 TTACTGGGAAGCAGAATTGGTGG + Intergenic
918578531 1:186096300-186096322 TAGGGATGAAGCAGAATTTTAGG - Intronic
920103177 1:203531016-203531038 TTGGGAGGAGGCAGATTTCTGGG - Intergenic
920362161 1:205426562-205426584 TTGGCAGGAAGCAGAAGGATGGG + Intronic
921552881 1:216560195-216560217 TTGATAGGAAGAAAAATTATAGG + Intronic
921891678 1:220360072-220360094 TAGGTAGGAAGCAGTACAGTAGG - Intergenic
923503422 1:234585137-234585159 TCCGCAGGAAGCAGAATTGCTGG + Intergenic
1063284895 10:4676157-4676179 TTTGTTGGATGTAGAATTGTGGG - Intergenic
1067404048 10:46004254-46004276 ATGGAATGAAGCAGGATTGTTGG - Intergenic
1068242654 10:54324139-54324161 TCAGTAGGAAGCAGAAGTGAGGG + Intronic
1068303045 10:55170581-55170603 CTGGTAGAAAGCATAATTGATGG + Intronic
1069854685 10:71433531-71433553 TGGGCTGGAAGCAGAAGTGTGGG - Intronic
1071115190 10:82210453-82210475 TTGGGAGGAAGGAGAAGTGGAGG + Intronic
1071354650 10:84782387-84782409 TTGGTAGGATGCAAAATTATTGG + Intergenic
1071556244 10:86604135-86604157 ATGTCAGGAAGCAGAAATGTAGG - Intergenic
1072638130 10:97190404-97190426 TTTGGAGGAGGCTGAATTGTTGG + Intronic
1073515509 10:104072259-104072281 TTGGCAGGATGGGGAATTGTTGG - Intronic
1073985096 10:109199134-109199156 TGGGCAGAAAGCAGAAGTGTGGG + Intergenic
1074396833 10:113104970-113104992 TTGGCAGGAAGCAGAAAAGAAGG + Intronic
1074666890 10:115737761-115737783 TTAGAAAGAAGCAGAATTGGGGG - Intronic
1074931231 10:118128186-118128208 TTGTTTGGAAGCAGAAATGCAGG - Intergenic
1075208766 10:120472349-120472371 TTGGTTGGATGTAGAATTTTCGG + Intronic
1077076298 11:703747-703769 TTGCTAGGCAGCAGAGCTGTTGG - Intronic
1077998159 11:7471672-7471694 TTGATAGAAAGTAGAATAGTGGG - Intergenic
1078766435 11:14302806-14302828 TAGGGAGGCAGCAGAATTGAGGG + Intronic
1079908126 11:26274894-26274916 TGGTTAGGAAGGAGAAATGTAGG + Intergenic
1080155962 11:29111403-29111425 TTGGGTAGAAACAGAATTGTAGG - Intergenic
1080574254 11:33583891-33583913 TTGGTAAGTAGCAGAACTGATGG + Intronic
1085208224 11:74749626-74749648 TTGGAGGGAAACAGAATTGTTGG + Intronic
1086130246 11:83393960-83393982 TCTGTAGGAAGCATGATTGTGGG - Intergenic
1087592614 11:100210396-100210418 TTCATAGGAAACAGAATTATTGG - Intronic
1090438197 11:126704317-126704339 CTGGTAGGAAGCATGTTTGTCGG + Intronic
1091987026 12:4918636-4918658 TTTGCAGGAAGAATAATTGTGGG + Intronic
1093169751 12:15846555-15846577 TGGGTAGTCAGCTGAATTGTAGG - Intronic
1096201087 12:49683659-49683681 TGGGAAGGAACCAGAATTGGAGG - Intronic
1096262920 12:50104146-50104168 TGGGTAGGAGGCAGAATGGGTGG + Intronic
1097023578 12:56037246-56037268 TTGGCAGGGAGAAGCATTGTGGG + Exonic
1101658470 12:106745546-106745568 GTGGGAGGAAGCAGAGTTGGTGG - Intronic
1105395325 13:20028042-20028064 CTGGAATAAAGCAGAATTGTTGG - Intronic
1106744982 13:32692579-32692601 TTGGTAACAAGGAGATTTGTGGG + Intronic
1108068973 13:46607933-46607955 TTTGTATGAAGCAGAACTGAGGG + Intronic
1108613257 13:52105354-52105376 TTGGTGGGAAACAAATTTGTGGG + Intronic
1109059890 13:57601954-57601976 TTGTCAGGAAACATAATTGTAGG - Intergenic
1109255209 13:60071948-60071970 CTGATGGGAAGCAGAATTGGGGG - Intronic
1110277982 13:73661072-73661094 GTGGGAGGAAACAGAATTGTGGG + Intergenic
1110480739 13:75973129-75973151 TTGGAAGTAAGTAAAATTGTTGG - Intergenic
1111920512 13:94405302-94405324 GTGGTAGGAAGCCAAAATGTGGG - Exonic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1115038467 14:28889864-28889886 TTGGCAGGAAGGAGAATCATAGG - Intergenic
1115057517 14:29148350-29148372 TAGGTAGGCAGCAGAACTGAAGG - Intergenic
1115430018 14:33306533-33306555 TTAGCAGGAAGATGAATTGTGGG + Intronic
1115488158 14:33932826-33932848 TTGGTAGCAAACAGAATTGATGG + Intronic
1115834304 14:37380859-37380881 TTAGTAGGAGGCTGAATTTTAGG + Intronic
1116308611 14:43291805-43291827 ATGGTGGGATGCAAAATTGTAGG + Intergenic
1117018290 14:51541621-51541643 TTGTTAGGATGCAGACATGTAGG + Intronic
1117338238 14:54773142-54773164 GTGGCAGGAAGGAGAATTCTGGG - Intronic
1122089039 14:99326073-99326095 TCGGAAGGAAACAGAATGGTAGG - Intergenic
1122191627 14:100049237-100049259 TTGATAGGAAGCAGAAGGTTTGG + Intronic
1122832339 14:104405296-104405318 TTGCTAGGAAGTAGATTTGCTGG - Intergenic
1123037583 14:105477785-105477807 GTGGGAGGAGGCAGATTTGTGGG + Intronic
1123196675 14:106623756-106623778 TTGAAAGGATACAGAATTGTGGG - Intergenic
1123196685 14:106623840-106623862 TTGAAAGGATACAGAATTGTGGG - Intergenic
1123791465 15:23724651-23724673 TACGTAGGAAGCAGAATTAAAGG - Intergenic
1125047027 15:35253625-35253647 ATGGGAGAAAGCAGAAATGTGGG - Intronic
1126206603 15:46052992-46053014 TTGGCAGGAAACAAAATTCTTGG + Intergenic
1127463205 15:59218844-59218866 AGGGGAGGAAGCAGAAGTGTGGG + Intronic
1128535757 15:68489002-68489024 GGGGTAGCAAGGAGAATTGTTGG + Intergenic
1129120270 15:73392168-73392190 TTGGGAGGAAGGAGAAGTGGTGG + Intergenic
1129534438 15:76300580-76300602 TTGGTAGGAAGCAGAATTGTAGG - Intronic
1130123364 15:81071216-81071238 TTGCAAGGAAGCAGGCTTGTAGG - Intronic
1132134046 15:99315461-99315483 ATGGTGGGAAACAGAATTCTAGG + Intronic
1132211446 15:100026085-100026107 ATGGTAGGAGTCAGAATTGTTGG - Intronic
1137379439 16:47983821-47983843 TTTGTAGCAGGCAGAATTCTGGG + Intergenic
1137443317 16:48514367-48514389 TTTGTAGGATACAGAATTCTGGG - Intergenic
1137625053 16:49902428-49902450 TTGGGAGGAAGCAGCATTTGAGG + Intergenic
1137996890 16:53226153-53226175 ATTGTAGGAAGTAGAACTGTAGG + Intronic
1139564588 16:67766069-67766091 TTGGTAGGAGGCAGTAGTGGTGG - Intronic
1142774117 17:2122912-2122934 TGGGTAGGAAGCAGAGATGGAGG + Intronic
1143593937 17:7902947-7902969 ACAGGAGGAAGCAGAATTGTTGG - Exonic
1143802160 17:9392286-9392308 TTGCTAAGAAGCATAGTTGTTGG + Intronic
1143912767 17:10265568-10265590 ATGGTTAGAAGCAGAATTGGGGG - Intergenic
1151067670 17:71170137-71170159 TTGGTAGAAAGGAGTATGGTGGG + Intergenic
1151322227 17:73359061-73359083 TTGGTGGGGAGCAGGATTGGAGG - Intronic
1155032955 18:22000515-22000537 TAGGTAGGAAGGAGAAATTTAGG + Intergenic
1155322695 18:24634033-24634055 TTTATAGGAAGCAGGATTGGAGG + Intergenic
1156277440 18:35597073-35597095 GGGCTAGGAAGCAGAATTGCAGG + Intronic
1158471313 18:57739400-57739422 TAGGAAGGAAACAGAAATGTAGG - Intronic
1162029152 19:7909920-7909942 TGGGTGGGAAGCAGCATTGAGGG + Intronic
1164310981 19:24046048-24046070 CTGGTAGGAAACAGTATTTTGGG + Intronic
1164589266 19:29497373-29497395 TTGCTAGGAAGGAAAATTCTGGG + Intergenic
925314551 2:2911286-2911308 TTTCTATGAAGCAGAATGGTAGG + Intergenic
926878739 2:17517272-17517294 TTGGGAGGAAGCAGAATGTCTGG - Exonic
928817358 2:35314797-35314819 TTAGAAGGAAGCAGCATGGTTGG + Intergenic
929872131 2:45768040-45768062 CTGGTGAGAAGCAAAATTGTTGG + Intronic
931848249 2:66226811-66226833 TTGGTAGCAAGAAGACTTGATGG + Intergenic
935030848 2:99320596-99320618 TTGGTATGAAGGACAATTATTGG + Intronic
935031898 2:99330629-99330651 TAGGTAGGGAGCAGAATAGAGGG - Intronic
935819250 2:106877778-106877800 GTTGTAGGGAACAGAATTGTAGG - Intronic
936111827 2:109671135-109671157 CTGGTAGGAAGCAGCAGTGTGGG - Intergenic
936718555 2:115220250-115220272 TTGGTAGCTATCAAAATTGTAGG + Intronic
936773109 2:115938819-115938841 TTACTAGGAGGCAGAATTGCAGG - Intergenic
936834030 2:116684907-116684929 CTGTTAGGAATCAGAATTTTGGG - Intergenic
937021950 2:118665324-118665346 TTGGTTGGAAGAAGGATTGGAGG - Intergenic
938191951 2:129291456-129291478 TAGGCAAGAAGCAGAACTGTGGG + Intergenic
942409032 2:175687384-175687406 TGGTTAGGAAGCAGAATAATGGG - Intergenic
943631161 2:190253957-190253979 CTGGAAAGAAGCAGAATTGGGGG - Intronic
945097387 2:206232432-206232454 TTGCTAGGAAACAGAAGTGAGGG - Intergenic
945983585 2:216336833-216336855 TTTATTTGAAGCAGAATTGTTGG - Intronic
946734464 2:222740539-222740561 TTGGTAGGAAGCAGAAGCATCGG + Intergenic
946915210 2:224512394-224512416 TTCGTAGGAAGCTAAAGTGTTGG - Intronic
947516579 2:230810643-230810665 TTTGTATGCAGCAGAAATGTGGG - Intronic
948069673 2:235110139-235110161 TTGCCCGGAAGTAGAATTGTTGG - Intergenic
948308653 2:236968844-236968866 TTCTTTGCAAGCAGAATTGTAGG - Intergenic
948364352 2:237444922-237444944 TTGGGAGGAAGCAGAGCTGGTGG + Intergenic
949005499 2:241644568-241644590 TCAGTAGGAATCAGAAGTGTTGG + Intronic
1170588882 20:17756030-17756052 AGGGTAGGAGGCAGAATTGGGGG + Intergenic
1171158546 20:22899572-22899594 GTAGTAGGAAGCAGAAGTGCTGG + Intergenic
1172992398 20:39046294-39046316 CTGGTAGGAGGCAGAAATCTGGG + Intergenic
1173005769 20:39138624-39138646 TCAGCAGGAAGCAGAATTGGGGG - Intergenic
1173850823 20:46216633-46216655 TTGGTAGGAAGCATGGTTGGAGG + Intronic
1176940749 21:14921551-14921573 TTTATAGGAAATAGAATTGTGGG + Intergenic
1183311514 22:37112335-37112357 TGGGGAGGAGGCAGAGTTGTTGG - Intergenic
950187300 3:10953016-10953038 TGGGTGGGAAGGAGAATGGTCGG - Intergenic
950330804 3:12154643-12154665 TTTGTACGAGGCAGAGTTGTGGG + Intronic
951054552 3:18132682-18132704 TGGGTAGTAAGCAACATTGTAGG - Intronic
951145243 3:19219047-19219069 TGGGTAGGAAGAAGCATAGTAGG - Intronic
953769262 3:45766122-45766144 GCAGCAGGAAGCAGAATTGTAGG + Intronic
955260757 3:57388053-57388075 TGGCTAGGAAGCAAATTTGTAGG - Intronic
955417064 3:58702343-58702365 TTGGTAAGTAGCAGAAGTGCAGG + Intergenic
957566106 3:81886186-81886208 TAGTTAGGAAGCAGAGTTGGAGG - Intergenic
958748801 3:98170063-98170085 TTGATAGTTAGCAGAATTATTGG - Intronic
959227773 3:103607706-103607728 GTGGTAGGAAGGAGAAGTGCTGG - Intergenic
959531069 3:107434007-107434029 TTGATGAGAGGCAGAATTGTGGG - Intergenic
959609358 3:108276803-108276825 TTGGTAGGAACCATCATAGTAGG - Intergenic
959673197 3:109002684-109002706 TTAGTAGAGAGCAGAGTTGTTGG - Intronic
962009961 3:131382726-131382748 TTGGCAGGTAGCAGAATCATCGG + Exonic
963138543 3:141929475-141929497 CTGTTAGGAAGCAGAATCTTGGG - Intergenic
963211555 3:142698157-142698179 TTGGTCTGAATCAGAATTGTGGG - Intronic
964487414 3:157200102-157200124 TTTGTAGGGAGCAGATTTCTGGG + Intergenic
965703650 3:171483935-171483957 ATCCTAGGAAGCAGAAATGTGGG - Intergenic
966694987 3:182780056-182780078 TTTGTAGTCGGCAGAATTGTTGG + Intergenic
968027043 3:195451230-195451252 TTGGTAGGGAGCAGGGGTGTTGG - Intergenic
969614782 4:8246016-8246038 TTGGAAGGACGCTGAATCGTGGG + Intergenic
969926956 4:10594105-10594127 CTGGTGGGAAGCAGAAGAGTGGG - Intronic
970309965 4:14771878-14771900 TAGCTAGGATCCAGAATTGTTGG + Intergenic
970352161 4:15213206-15213228 TTGCGAGGAAGAAAAATTGTTGG + Intergenic
971299873 4:25433263-25433285 GTGGTTGGAGGCAGAAGTGTAGG + Intergenic
972215713 4:36895090-36895112 TTAATAGGAAGCAGAATAGATGG - Intergenic
975126806 4:70792060-70792082 TAAGTAGGAAGCGGAATTGCAGG - Intronic
975493386 4:75012598-75012620 TTCTTAGGAAGCAGAGATGTTGG - Exonic
976146794 4:82049949-82049971 CTGGGAGGAGGGAGAATTGTAGG - Intergenic
981017979 4:139994166-139994188 TTGGAATGAAACAGAATTTTGGG - Intronic
988660832 5:33266415-33266437 CTGGTAAGAGACAGAATTGTAGG + Intergenic
989549304 5:42714514-42714536 TTGTTAGGAAGAAGAATTATTGG + Intronic
989554390 5:42775455-42775477 TTTGCAGGATGCAGAATTATTGG - Intronic
991296876 5:65090995-65091017 TATGTAGGAAGTAGGATTGTTGG + Intergenic
991377450 5:65980562-65980584 TTTGTAGGAAGCATAATGTTGGG - Intronic
992839185 5:80670475-80670497 TTGGTGGGAACCAGACTTGGTGG + Intronic
993625189 5:90215359-90215381 TGGGAAGGAAGAAGAATTGGGGG + Intergenic
997600058 5:135132933-135132955 TTGGTAGGCAGAACATTTGTTGG - Intronic
997781687 5:136666101-136666123 TTAGGAAGAAGTAGAATTGTGGG + Intergenic
998538445 5:142956070-142956092 TTGGTATTAAGCATAATTGTGGG + Intronic
998580104 5:143364269-143364291 TTGGCAGGATACAGAATTCTTGG - Intronic
999856306 5:155598381-155598403 TAGGTAGGAATCTGAATTTTTGG - Intergenic
1000686439 5:164255333-164255355 CTGGTAGGTAGGAGCATTGTAGG + Intergenic
1001852783 5:174984123-174984145 TTGTAAAGAAGCAGCATTGTAGG - Intergenic
1004987850 6:21102856-21102878 CTGGCAGGAAGCAGAAAGGTAGG - Intronic
1005276581 6:24225971-24225993 GTGGTAGGAGACAGACTTGTAGG - Intronic
1005717949 6:28569447-28569469 TTGGCAGAAAGCACAATTTTGGG + Intergenic
1005819910 6:29589210-29589232 ATGGTAGGAATTAGAATTGGAGG - Intronic
1006868998 6:37233272-37233294 TTGGTGGGAAGGAGAGTTGATGG - Intronic
1007017375 6:38482291-38482313 TTGGTGGGAAGCACATTTCTAGG - Intronic
1008247965 6:49202561-49202583 TTGGTGAGGAGCAGAATTCTAGG + Intergenic
1010497654 6:76554736-76554758 CTGCTATGAAGCAGAAATGTGGG - Intergenic
1010982715 6:82387637-82387659 TTTCTAGGAAGAACAATTGTTGG + Intergenic
1012822038 6:104097391-104097413 TTGGTAGGAAACAGAACAGATGG - Intergenic
1013994506 6:116292597-116292619 TTTGTAGGGAGCAGCATTGTTGG + Intronic
1014456304 6:121638476-121638498 GTGCTTGGAAGCAGAAATGTTGG + Intergenic
1018456255 6:163955564-163955586 TTGGCAGGAGGCAGAATTGCAGG - Intergenic
1019655166 7:2189605-2189627 GAGGCAGGAAGCAGAATGGTGGG + Intronic
1022119175 7:27290662-27290684 ATGGTAAGAAGCAGATTTGGTGG + Intergenic
1022509161 7:30924126-30924148 TTGGGAGCAAGCAGAACTGAAGG - Exonic
1022691667 7:32662271-32662293 ATACTAGGAGGCAGAATTGTAGG - Intergenic
1024249289 7:47494254-47494276 TCAGTAGGAAGTAGACTTGTGGG - Intronic
1026649009 7:72198614-72198636 TTGGTAGAAGGTAGAATTGCTGG - Intronic
1027638365 7:80703673-80703695 TGGGTAAGAAGCAGCATGGTGGG - Intergenic
1028505964 7:91570439-91570461 TTGGTAGGAAGAATGATTGAAGG + Intergenic
1030341402 7:108384716-108384738 TTGTTAGAAAGCAAAGTTGTGGG - Intronic
1030509668 7:110469463-110469485 TGGTTAGGAAGAAGAATTTTGGG - Intergenic
1031572018 7:123370633-123370655 GTGGTTGGAAGCAGTATTTTTGG + Intergenic
1032396855 7:131596622-131596644 TTGATAGGCAGGAGCATTGTGGG + Intergenic
1032717741 7:134525237-134525259 TTCATAGGTAGCAGCATTGTAGG - Intergenic
1032722304 7:134560266-134560288 TTCATAGGTAGCAGCATTGTAGG - Intronic
1033889350 7:145990546-145990568 ATGGGAGGAAGCAGAAGTGCTGG - Intergenic
1036186879 8:6629875-6629897 TTGGTAAGAAGCAGGATCTTAGG + Intronic
1039545626 8:38408954-38408976 TTGCTAGGAAGCATAATTAAGGG + Intronic
1040577335 8:48665219-48665241 TTGGTTGGAAGCAGAAGTCCTGG + Intergenic
1041009852 8:53530971-53530993 TTGGTGGGCAGCAGAAATGTTGG - Intergenic
1043245261 8:77991397-77991419 GTGGCAGGAAGCAGAAGTGAAGG + Intergenic
1045922278 8:107545404-107545426 TTGGTAGGACACTAAATTGTTGG + Intergenic
1046110954 8:109723807-109723829 TTAGTAGGATGCAAAATTCTTGG - Intergenic
1046837590 8:118820226-118820248 TTGGCAGGTATCAGTATTGTGGG + Intergenic
1046900324 8:119516707-119516729 TTGGTAAGAAACAATATTGTTGG + Intergenic
1047115838 8:121841216-121841238 ATGGTAGGAAGGAGAAGTGCTGG - Intergenic
1048179332 8:132180792-132180814 ATGTTAGGAAGCAGAAGTGACGG + Intronic
1048395398 8:134009763-134009785 CTGTCAGGAAGCAGAATCGTTGG - Intergenic
1048477510 8:134756670-134756692 TTAGGAGGAAGCAGAACTGTAGG - Intergenic
1048692475 8:136983069-136983091 TTTGGAGGAAGCAGGATGGTAGG + Intergenic
1050228991 9:3497030-3497052 TCAGTATGAAGCAGATTTGTGGG - Intronic
1050552938 9:6763223-6763245 TTGGTAGGAAGGAGACTGGCTGG - Intronic
1052780931 9:32781942-32781964 TTGGAAGGAAGCAGATCTGAGGG - Intergenic
1052849530 9:33368486-33368508 TTTGGAGAAACCAGAATTGTGGG + Intronic
1058136822 9:101316668-101316690 TTGGCAGGAAACAGAAAAGTGGG + Intronic
1058508483 9:105690966-105690988 TGGGTAGAAAGCAGTATTGCAGG + Intergenic
1060321566 9:122566137-122566159 TTGATAGGATGCAGCATTCTAGG - Intergenic
1060736112 9:126067460-126067482 TGGGTGGGAAGGAGGATTGTGGG - Intergenic
1185613294 X:1404841-1404863 TAGGTAGGAAGATGAATAGTTGG + Intronic
1186607678 X:11109155-11109177 GTGGGAGAGAGCAGAATTGTGGG + Intergenic
1192269190 X:69562777-69562799 TTGGTAAGCAGCAGAACTTTGGG - Intergenic
1193275237 X:79578860-79578882 TGGTTAGGAAGAAGAAATGTTGG - Intergenic
1194114060 X:89873871-89873893 TTGGTAGGGAGCAGCAGAGTTGG + Intergenic
1197896264 X:131318790-131318812 TCTGTAGGAAGCAGAACTGCAGG + Intronic
1197896390 X:131319980-131320002 ATGGTAGGACTCAGAATGGTGGG - Intronic
1198894390 X:141436330-141436352 TTAGGATAAAGCAGAATTGTAGG - Intergenic
1199324575 X:146482192-146482214 GTGGTAGGAAGGATAATTGGTGG + Intergenic
1200088463 X:153623398-153623420 CTGGCAGGAAGCAGAGTGGTGGG - Intergenic
1200466800 Y:3529227-3529249 TTGGTAGGGAGCAGCAGAGTTGG + Intergenic
1201529848 Y:14979636-14979658 TTGATAGGAAGCTGAATTACTGG - Intergenic
1202240259 Y:22759808-22759830 TTGGGAGGCAGGAGAATTGCTGG + Intergenic
1202393245 Y:24393562-24393584 TTGGGAGGCAGGAGAATTGCTGG + Intergenic
1202477540 Y:25276538-25276560 TTGGGAGGCAGGAGAATTGCTGG - Intergenic