ID: 1129535937

View in Genome Browser
Species Human (GRCh38)
Location 15:76313719-76313741
Sequence CTATGGGAGTGGAAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129535928_1129535937 7 Left 1129535928 15:76313689-76313711 CCAGTCCCACACTGGACTAGAAT No data
Right 1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG No data
1129535929_1129535937 2 Left 1129535929 15:76313694-76313716 CCCACACTGGACTAGAATCTGAG No data
Right 1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG No data
1129535930_1129535937 1 Left 1129535930 15:76313695-76313717 CCACACTGGACTAGAATCTGAGA No data
Right 1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG No data
1129535925_1129535937 15 Left 1129535925 15:76313681-76313703 CCTCCTAACCAGTCCCACACTGG No data
Right 1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG No data
1129535927_1129535937 12 Left 1129535927 15:76313684-76313706 CCTAACCAGTCCCACACTGGACT No data
Right 1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129535937 Original CRISPR CTATGGGAGTGGAAGGAAGA GGG Intergenic
No off target data available for this crispr