ID: 1129536296

View in Genome Browser
Species Human (GRCh38)
Location 15:76315981-76316003
Sequence CTGGAGGAATGGTGCCATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129536288_1129536296 15 Left 1129536288 15:76315943-76315965 CCATGTTGTCAACTTGCACCGTG No data
Right 1129536296 15:76315981-76316003 CTGGAGGAATGGTGCCATATTGG No data
1129536291_1129536296 -3 Left 1129536291 15:76315961-76315983 CCGTGGAGCCAGCTGGTCTTCTG No data
Right 1129536296 15:76315981-76316003 CTGGAGGAATGGTGCCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129536296 Original CRISPR CTGGAGGAATGGTGCCATAT TGG Intergenic
No off target data available for this crispr