ID: 1129536296 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:76315981-76316003 |
Sequence | CTGGAGGAATGGTGCCATAT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1129536288_1129536296 | 15 | Left | 1129536288 | 15:76315943-76315965 | CCATGTTGTCAACTTGCACCGTG | No data | ||
Right | 1129536296 | 15:76315981-76316003 | CTGGAGGAATGGTGCCATATTGG | No data | ||||
1129536291_1129536296 | -3 | Left | 1129536291 | 15:76315961-76315983 | CCGTGGAGCCAGCTGGTCTTCTG | No data | ||
Right | 1129536296 | 15:76315981-76316003 | CTGGAGGAATGGTGCCATATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1129536296 | Original CRISPR | CTGGAGGAATGGTGCCATAT TGG | Intergenic | ||
No off target data available for this crispr |