ID: 1129538007

View in Genome Browser
Species Human (GRCh38)
Location 15:76329948-76329970
Sequence CCTAGGAAGAGGGAACGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129538007_1129538017 28 Left 1129538007 15:76329948-76329970 CCAGACCGTTCCCTCTTCCTAGG No data
Right 1129538017 15:76329999-76330021 AGAATCCAGCTTATCCTCCAAGG No data
1129538007_1129538014 4 Left 1129538007 15:76329948-76329970 CCAGACCGTTCCCTCTTCCTAGG No data
Right 1129538014 15:76329975-76329997 CTTCCTGCTCCTTTTGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129538007 Original CRISPR CCTAGGAAGAGGGAACGGTC TGG (reversed) Intergenic
No off target data available for this crispr