ID: 1129540554

View in Genome Browser
Species Human (GRCh38)
Location 15:76343892-76343914
Sequence CCCCACTTGCAGATGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129540547_1129540554 -6 Left 1129540547 15:76343875-76343897 CCTTCACACTGCCCCCACCCCAC 0: 1
1: 6
2: 97
3: 2064
4: 11656
Right 1129540554 15:76343892-76343914 CCCCACTTGCAGATGATGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129540554 Original CRISPR CCCCACTTGCAGATGATGGA AGG Intergenic
900975919 1:6016261-6016283 CCTCACTCGGAGATGTTGGAGGG - Intronic
902584378 1:17429352-17429374 TGCCACTTGCCGATGAGGGAGGG - Intronic
903949446 1:26987076-26987098 CCCCACTCTCAGCTAATGGAGGG + Intergenic
904306784 1:29594967-29594989 CCCCACCTACAGATGAGGAAAGG - Intergenic
904577442 1:31514167-31514189 CCCCACTTTCAGGTCAGGGAAGG - Intergenic
906130294 1:43451689-43451711 TTCCACTGGCAGATCATGGATGG - Exonic
913364014 1:118015516-118015538 GCCCACTTGCAGTTGGTGAAAGG - Intronic
913745560 1:121899884-121899906 CTCCACTTGCAGATGTACGAAGG + Intergenic
916714894 1:167440272-167440294 CCCCAGTTACAGATGAGGAAAGG + Intronic
917359781 1:174162529-174162551 CCCCACTTGAAGACAATGGTAGG - Intronic
917616774 1:176753935-176753957 TTCCCCTGGCAGATGATGGATGG + Intronic
922635195 1:227161834-227161856 CCCCTATTGTAGATGATAGATGG + Intronic
1064052376 10:12069371-12069393 CCTCAGTTACAGAGGATGGACGG - Intronic
1065046792 10:21752810-21752832 CCCCACGGGCAGGAGATGGAAGG + Intergenic
1068625492 10:59242107-59242129 CCACCCTAGCAGAGGATGGAAGG - Intronic
1070992980 10:80748991-80749013 CCCTACCTACAGCTGATGGAAGG - Intergenic
1076112009 10:127867273-127867295 ACACACTTCCAGATGATGCAGGG + Intergenic
1076175905 10:128367563-128367585 CCCCAGATACGGATGATGGAAGG + Intergenic
1082808214 11:57463182-57463204 CCCAATTTGCAGATGAAGGAAGG - Intronic
1088626088 11:111731686-111731708 CCACACTGGCAGAGGCTGGAAGG + Intronic
1089797191 11:120990494-120990516 CCCTAGATACAGATGATGGAGGG - Intergenic
1090398107 11:126432374-126432396 CCCCACTTGCAGCTGTAGAAGGG - Intronic
1090908510 11:131097772-131097794 CCCCAGTTACAGATGAGGAAGGG + Intergenic
1091797112 12:3303783-3303805 ACCCCCTTGCAGATGTTGGAGGG + Intergenic
1091893404 12:4081323-4081345 CCCTATTTGCAGATGAGGGTGGG + Intergenic
1092874439 12:12835843-12835865 CGGCACTGGCAGATGATTGAAGG - Intergenic
1096535990 12:52275038-52275060 CCCCTCTTGCACGTGGTGGATGG + Intronic
1101417642 12:104522324-104522346 CCACCCTTGCAGATGTTGTAAGG + Intronic
1106080410 13:26495951-26495973 TCCCACCTGCAGATGCTGGCAGG + Intergenic
1106131218 13:26941070-26941092 CCCCACTTCCAGTTGCTGGAAGG + Intergenic
1106209894 13:27632176-27632198 TCCCACTTGAAGTTGATTGATGG + Intronic
1110718855 13:78738895-78738917 CCACACTTGCATATCATGAAGGG - Intergenic
1113363763 13:109656563-109656585 TCCCACTTGCAGATTATCCATGG - Intergenic
1114867025 14:26608336-26608358 CACCACTTCCAGCTGATTGATGG - Intergenic
1115502594 14:34062700-34062722 ACCCACTTGTAGAGCATGGATGG - Intronic
1120723229 14:87909949-87909971 CACCACTTGGACATGATGGCAGG + Intronic
1122932117 14:104938558-104938580 CACCACTGGCAGATGAAGGCAGG - Exonic
1125241553 15:37582441-37582463 CCCCACCTTCAGACGAGGGAAGG + Intergenic
1128716854 15:69914825-69914847 ACCCAGTTGCGGATTATGGAAGG + Intergenic
1129467204 15:75730878-75730900 CACCACGAGCAGATGTTGGAGGG + Intergenic
1129540554 15:76343892-76343914 CCCCACTTGCAGATGATGGAAGG + Intergenic
1129706412 15:77797053-77797075 CCCTACTCACAGAGGATGGAGGG - Intronic
1131999989 15:98168803-98168825 CCCCATTTGCAGAGTATTGAGGG - Intergenic
1137013713 16:35350931-35350953 GCCCACTTACAGATGAATGAAGG + Intergenic
1142491827 17:284574-284596 CCCCACTGGGAGAGCATGGAGGG - Intronic
1142867082 17:2797640-2797662 CCCCCCTGCCAGAGGATGGATGG - Intronic
1144908881 17:18661840-18661862 CCTCACATGCATATTATGGATGG + Exonic
1146343340 17:32040890-32040912 CACCACCTGCAGAAGCTGGAGGG + Intronic
1148391318 17:47275243-47275265 GCCCACTTGGTGAGGATGGAAGG + Intronic
1150782605 17:68135120-68135142 CACCACCTGCAGAAGCTGGAGGG - Intergenic
1159754869 18:72351715-72351737 CCCCAGTTGCTGATGATGTAGGG + Intergenic
1162764778 19:12912258-12912280 CCCCAATTGCTGCAGATGGAGGG - Intronic
1163252080 19:16131922-16131944 ACGGACTGGCAGATGATGGATGG + Intronic
1168287547 19:55342138-55342160 CCCCACTTGGAGCTGAGGGGAGG - Intronic
925063941 2:914782-914804 ACCCACATGCAGAAGATGGAAGG + Intergenic
925063962 2:914868-914890 ACCCACAGGCAGAAGATGGAAGG + Intergenic
925064000 2:915040-915062 ACCCACAGGCAGAAGATGGAAGG + Intergenic
925064020 2:915126-915148 ACCCACAGGCAGAAGATGGAAGG + Intergenic
925064039 2:915212-915234 ACCCACATGCAGAAGATGGAAGG + Intergenic
925064060 2:915298-915320 ACCCACATGCAGAAGATGGAAGG + Intergenic
928361451 2:30665174-30665196 CCCCTCCAGCAGATGGTGGAGGG + Intergenic
928404280 2:31002728-31002750 TCCCACCTGCAGAGAATGGATGG + Intronic
933538095 2:83602791-83602813 CCCCACTTTCAGAGGCTGGGTGG + Intergenic
934647090 2:96065331-96065353 CCAGACTTGAAGATGATGGCTGG - Intergenic
938131995 2:128724701-128724723 CCGAACATGCAGATGATGGATGG - Intergenic
938997202 2:136692715-136692737 CCACACTGGCAGCTGATTGAGGG + Intergenic
939113380 2:138033549-138033571 CCACCCTTGCAGATGCTGGCAGG + Intergenic
940766356 2:157793861-157793883 CCCCACTACCCAATGATGGAAGG - Intronic
943846031 2:192649380-192649402 CCCCATTTATAAATGATGGAAGG - Intergenic
947605468 2:231483022-231483044 CCCCACTCGCAGATGCAGCAGGG + Intronic
1171317236 20:24205956-24205978 CCCCACAAGCAGGTGGTGGAAGG + Intergenic
1171361072 20:24586659-24586681 CCCCACATGGAGATGACGCAGGG - Intronic
1172626555 20:36350768-36350790 TCCCTTTTGCAGATGCTGGAGGG + Intronic
1172902040 20:38342458-38342480 CCCCAAATGCAGATGAGGGCTGG - Intergenic
1174242654 20:49150262-49150284 TCCCATTTCCAGATGATGAAAGG - Intronic
1174903383 20:54524117-54524139 TCCCACTGTGAGATGATGGAAGG + Intronic
1175521124 20:59603636-59603658 CCCCCTTTGCAGGTGCTGGAAGG - Intronic
1175914764 20:62420723-62420745 TCCCACACGCAGATGCTGGAAGG + Intronic
1177722672 21:24928147-24928169 CCTCAATTTCAGATGATGTATGG + Intergenic
1177760642 21:25399301-25399323 CTCCACTTGCTGCTGCTGGAGGG - Intergenic
1178967170 21:37131655-37131677 CCCCACTTGCAGCTGAAGTGAGG + Intronic
1179255885 21:39714933-39714955 CCCCAATTACACATGGTGGATGG + Intergenic
1181821923 22:25483109-25483131 CCCAACCTGCAGATCTTGGATGG + Intergenic
1183065272 22:35358340-35358362 CCTCACTTGCAGAGGAGGAAGGG + Intergenic
1183242102 22:36665330-36665352 CCGCACTTGGAGATGAGGAAAGG - Intronic
1184173856 22:42774949-42774971 CCCCACTTTCAGACCAGGGAGGG + Intergenic
1184826777 22:46957891-46957913 ATCCATTTGCAGATGATGGAGGG + Intronic
949815683 3:8055362-8055384 CTCCAGTAGCAGATGCTGGAGGG - Intergenic
950187215 3:10952571-10952593 ACCCAATTCCAGGTGATGGAGGG - Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954873572 3:53785877-53785899 CACAACTTGCAGAGGCTGGAAGG - Intronic
955405735 3:58624636-58624658 CCACACTGGCAGGGGATGGAAGG - Intronic
955551968 3:60094754-60094776 CACCATTTGCAGGTGAGGGAGGG + Intronic
959379200 3:105621228-105621250 CTCAACTTGGAGATGATGGTGGG + Intergenic
967985939 3:195095405-195095427 CCCCAGTCCCAGATGGTGGAAGG - Intronic
968572510 4:1349471-1349493 CCCCACACGCAGAGGATGGGCGG - Intronic
968582367 4:1401051-1401073 CCCCACAGGGAGATGATAGAAGG - Intergenic
969715089 4:8864480-8864502 CACCACTGGCAGAAGATGAATGG - Intronic
976100634 4:81559185-81559207 CACCACATGTAGATGATGGCAGG + Intronic
977177143 4:93831247-93831269 CCCCCCTTGCAGATGTTGTTGGG - Intergenic
983957600 4:173715975-173715997 CCCCACTTGGTGAGGAAGGATGG - Intergenic
984963781 4:185123638-185123660 CCCCAGTTGCTGATGATATATGG - Intergenic
985528571 5:420633-420655 CCCCATGTGGAGAGGATGGAAGG + Intronic
991342620 5:65628103-65628125 CCTAACTTGCAGATATTGGAAGG + Intronic
994567314 5:101466629-101466651 AGCCACATGCAGAAGATGGAAGG + Intergenic
997685677 5:135786146-135786168 CCCCACTTGGATATGATCCATGG - Intergenic
998415968 5:141946174-141946196 CTCCACTAGCTGAGGATGGAGGG + Intronic
998937268 5:147242376-147242398 CCCCATGTTCTGATGATGGAAGG + Intronic
1001015595 5:168138197-168138219 CCCAACTTGCAAGTGATGGAAGG - Intronic
1001437838 5:171714453-171714475 CCCCTCATGCAGATGCTTGATGG + Intergenic
1004569871 6:16834821-16834843 CTCATTTTGCAGATGATGGAAGG + Intergenic
1006520614 6:34568945-34568967 CCCCACTTGCAGATGAGCAGGGG + Intergenic
1007257959 6:40541741-40541763 TCTCACTTGCAGAAGATGCAGGG + Intronic
1020027101 7:4906920-4906942 CCCAGCTTGAAGATGAGGGATGG - Exonic
1021254192 7:18369810-18369832 TCCCATTTGGAGATGATGGCAGG - Intronic
1022808067 7:33842994-33843016 GCCCATTTACAGATGAGGGAAGG + Intergenic
1023851959 7:44155432-44155454 CCCATCTTGCAGATGAAGAAAGG + Intronic
1026572605 7:71544550-71544572 CTGCACTTGCAGAGGATGAAAGG - Intronic
1032409318 7:131682928-131682950 CCCCATTTGGCGATTATGGAGGG - Intergenic
1032698963 7:134362081-134362103 CTCAACTTTTAGATGATGGAGGG - Intergenic
1035662125 8:1356106-1356128 CCCCACTGGGAGTTGACGGACGG + Intergenic
1041195541 8:55398116-55398138 GCGCACTTTCAGAGGATGGAAGG + Intronic
1043355772 8:79410715-79410737 ACCCACTTGCAAATGATGTGTGG + Intergenic
1045352878 8:101358671-101358693 CCCTACCTGCAAATGATGGGAGG - Intergenic
1045586420 8:103542665-103542687 CCCCACTTGATCATGGTGGATGG - Intronic
1054892304 9:70264335-70264357 CCCCACTTGAATATGATCGTTGG + Exonic
1057219224 9:93247085-93247107 CCCGAGTTGCAGATGGAGGAAGG - Intronic
1057563193 9:96144928-96144950 CCCCACTGGGAGACGATGGGTGG - Intergenic
1060267415 9:122120415-122120437 CCCCATTTGCAGTGGATGCAGGG + Intergenic
1060861245 9:126956561-126956583 CCCCACCTACAGATGAAGCATGG - Intronic
1061949757 9:133929697-133929719 CACCTGCTGCAGATGATGGACGG - Intronic
1062181170 9:135192020-135192042 CCCCACACACAGAGGATGGAGGG + Intergenic
1193598388 X:83477218-83477240 AGCCATTTGCAGAAGATGGAAGG + Intergenic
1194600568 X:95915798-95915820 CCTCAGTTGCAGAGAATGGATGG + Intergenic
1195279926 X:103322169-103322191 TCCCACTTGGACATGATGAATGG + Intergenic
1198456350 X:136821572-136821594 CCCCAATTGAAGATCATGAAAGG + Intergenic