ID: 1129542090

View in Genome Browser
Species Human (GRCh38)
Location 15:76358696-76358718
Sequence TACAACTACATTGCAGGTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 259}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129542084_1129542090 1 Left 1129542084 15:76358672-76358694 CCTCCTAAAAGCCCTGTCTCGAA 0: 1
1: 6
2: 36
3: 104
4: 354
Right 1129542090 15:76358696-76358718 TACAACTACATTGCAGGTTAGGG 0: 1
1: 0
2: 3
3: 29
4: 259
1129542081_1129542090 23 Left 1129542081 15:76358650-76358672 CCCTTACAACCTCATTTAATTAC 0: 1
1: 1
2: 3
3: 36
4: 269
Right 1129542090 15:76358696-76358718 TACAACTACATTGCAGGTTAGGG 0: 1
1: 0
2: 3
3: 29
4: 259
1129542082_1129542090 22 Left 1129542082 15:76358651-76358673 CCTTACAACCTCATTTAATTACC 0: 1
1: 0
2: 5
3: 14
4: 174
Right 1129542090 15:76358696-76358718 TACAACTACATTGCAGGTTAGGG 0: 1
1: 0
2: 3
3: 29
4: 259
1129542085_1129542090 -2 Left 1129542085 15:76358675-76358697 CCTAAAAGCCCTGTCTCGAAATA 0: 1
1: 7
2: 76
3: 240
4: 720
Right 1129542090 15:76358696-76358718 TACAACTACATTGCAGGTTAGGG 0: 1
1: 0
2: 3
3: 29
4: 259
1129542083_1129542090 14 Left 1129542083 15:76358659-76358681 CCTCATTTAATTACCTCCTAAAA 0: 2
1: 3
2: 4
3: 40
4: 334
Right 1129542090 15:76358696-76358718 TACAACTACATTGCAGGTTAGGG 0: 1
1: 0
2: 3
3: 29
4: 259
1129542086_1129542090 -10 Left 1129542086 15:76358683-76358705 CCCTGTCTCGAAATACAACTACA 0: 1
1: 0
2: 30
3: 202
4: 1693
Right 1129542090 15:76358696-76358718 TACAACTACATTGCAGGTTAGGG 0: 1
1: 0
2: 3
3: 29
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129542090 Original CRISPR TACAACTACATTGCAGGTTA GGG Intronic
900330650 1:2132939-2132961 TACAGCCACATTGGGGGTTAGGG + Intronic
900850889 1:5142148-5142170 TACAATTACTTTGAGGGTTAGGG + Intergenic
902079272 1:13810090-13810112 TACAATCACATTGGGGGTTAGGG + Intronic
905261013 1:36719297-36719319 TGCAACAACCTTACAGGTTAAGG - Intergenic
905749390 1:40449234-40449256 TCCAAATACAATGGAGGTTAGGG + Intergenic
906430646 1:45753319-45753341 TACCATTACATTGGAGGCTAGGG - Intergenic
907175540 1:52518556-52518578 TACAATTATGTTGGAGGTTAGGG + Intronic
908125351 1:61024849-61024871 TACAGCAACATTGTAGGTCAGGG + Intronic
908245424 1:62224127-62224149 TACCATCACATTGGAGGTTAGGG - Intergenic
910010089 1:82451081-82451103 TACAATCACATTGGGGGTTAGGG + Intergenic
910492640 1:87789457-87789479 TTCCACAACATGGCAGGTTATGG - Intergenic
910814861 1:91280923-91280945 TACCACTACATTGCTGCTTAGGG + Intronic
910946660 1:92600018-92600040 TACAACAACAGTTCAGGTAAGGG + Intronic
912816809 1:112835633-112835655 CACAACTACATGGGAGGCTAAGG - Intergenic
916413255 1:164568498-164568520 TACCACACCATTGCAGGTAAAGG - Intronic
918599178 1:186333506-186333528 GACAAATACATTGTAGGTAAAGG + Intronic
918867564 1:189922317-189922339 TACAATCACATTGTAGGCTAGGG - Intergenic
919575557 1:199304466-199304488 TATAACTATATTGGAGCTTAGGG + Intergenic
920040804 1:203094761-203094783 TACTATTACATTGGGGGTTAGGG + Intronic
923091677 1:230745717-230745739 TACCATTACCTTGCAGGGTATGG + Intergenic
923738415 1:236633730-236633752 TACCATCACATTGGAGGTTAAGG + Intergenic
1063286890 10:4698439-4698461 TGCTACTATATTGAAGGTTAGGG - Intergenic
1063487926 10:6437204-6437226 TACAGTTACATTGTGGGTTAGGG - Intronic
1063908827 10:10809022-10809044 TACCACCACATTGGGGGTTAGGG - Intergenic
1064270535 10:13861221-13861243 TGCAAATACATTGGGGGTTAGGG - Intronic
1064354762 10:14606540-14606562 TACAGTCACATTGGAGGTTAGGG - Intronic
1067541473 10:47157946-47157968 TACAGCAACATTGAAAGTTAGGG + Intergenic
1068639602 10:59388439-59388461 TACAGCTACATTGGAGATTAAGG + Intergenic
1068780843 10:60917690-60917712 TACAATCACATTGGGGGTTAGGG + Intronic
1071414903 10:85432310-85432332 GAAAACTACATTAGAGGTTATGG - Intergenic
1072248092 10:93560698-93560720 TCTAACCACATTGCAGGTTTCGG + Intergenic
1073567028 10:104543707-104543729 TACACCTACCTTTCAGGTTCCGG - Intergenic
1074142029 10:110681412-110681434 TACAAATACCTTACAGTTTAGGG - Intronic
1074426526 10:113356355-113356377 GCCAACTACTTTGCAGGTTGAGG + Intergenic
1076749589 10:132536106-132536128 TACAGTCACATTGGAGGTTAGGG + Intergenic
1081576727 11:44323291-44323313 AACATCTACATTACAGGTGATGG - Intergenic
1086339790 11:85837209-85837231 TACAATCACATTGTGGGTTAGGG - Intergenic
1087046521 11:93848059-93848081 TACCATCACATTGGAGGTTAGGG + Intronic
1087347863 11:96993761-96993783 TACAGTCACATTGGAGGTTAGGG + Intergenic
1087466144 11:98509150-98509172 TATAACCACATTGGAGGTTAGGG - Intergenic
1087875029 11:103344680-103344702 TACAAAAACAAAGCAGGTTAAGG - Intronic
1088350383 11:108880356-108880378 TACAGCCACATTGGGGGTTAGGG + Intronic
1088424173 11:109683584-109683606 TACAGCTAAATTGCATGTCATGG - Intergenic
1088442257 11:109884546-109884568 TACAGTCACATTGCGGGTTAGGG - Intergenic
1089246498 11:117124617-117124639 TACCATTACATTGAGGGTTAAGG + Intergenic
1089640914 11:119846671-119846693 TACCATCACATTGGAGGTTAGGG + Intergenic
1090474534 11:127007527-127007549 TACAGTCACATTGGAGGTTAGGG + Intergenic
1091802393 12:3332894-3332916 TACAGGCACATTGCTGGTTAGGG + Intergenic
1092038982 12:5366903-5366925 AACAACTACAATGGAGGTGATGG + Intergenic
1094500530 12:31017100-31017122 TACCATTACATTGGTGGTTAGGG - Intergenic
1095769066 12:45931095-45931117 TAGAACTAGATTGTAGATTAGGG - Intronic
1096177484 12:49532464-49532486 TTCAACTGCTTTGCAGGTAAAGG + Intergenic
1098162942 12:67664574-67664596 TACAAAAACATTGCAGTTTGAGG + Exonic
1098496914 12:71146846-71146868 AACAGATACATTGGAGGTTAGGG - Intronic
1098721859 12:73910329-73910351 TACCATCACATTGGAGGTTAAGG - Intergenic
1099527344 12:83731742-83731764 TACAACTACAAAGGAGGTCAAGG - Intergenic
1101408030 12:104446023-104446045 TACAGACACATTGCAGGTTAGGG + Intergenic
1101530962 12:105573373-105573395 TACCAATGCATTGGAGGTTAGGG + Intergenic
1102451902 12:113048162-113048184 TACAGTCACATTGCAGGTGAGGG + Intergenic
1103074785 12:117973305-117973327 TACAGTTACATTGAGGGTTAGGG + Intergenic
1104411776 12:128564240-128564262 TACAATTGCATTGGGGGTTAGGG + Intronic
1106337149 13:28794466-28794488 CACAACTACATTTCACGTAAGGG - Intergenic
1108176865 13:47801261-47801283 TCCAACTACATTGGAGGATATGG - Intergenic
1111763267 13:92493816-92493838 TATTCCTACATTGCAGGTGAGGG - Intronic
1114322704 14:21560342-21560364 TACAATCACATTGGAGGTTAGGG - Intergenic
1115582610 14:34776659-34776681 TACAGTCACATTGGAGGTTAGGG - Intronic
1116365716 14:44060382-44060404 TACATTTACATTGGGGGTTACGG + Intergenic
1117083145 14:52172183-52172205 GACAACCACATTGAAGGTTGTGG + Intergenic
1117754361 14:58958678-58958700 TCCAACTACCTTGTAGGTAATGG - Intergenic
1118074077 14:62279600-62279622 TACAATCACATTGAGGGTTAGGG + Intergenic
1118928057 14:70212185-70212207 TACCATCACATTGCAGATTAAGG - Intergenic
1119873657 14:78038044-78038066 TACAGTCACATTGGAGGTTAGGG - Intergenic
1120415026 14:84208249-84208271 TATAGTTACATGGCAGGTTAGGG + Intergenic
1120570793 14:86114513-86114535 TACAAATAAATTGCATGTCATGG + Intergenic
1124405359 15:29386627-29386649 TACCATTACATTGCGGGTTAGGG - Intronic
1125259597 15:37807948-37807970 CACATCTACCTTGCAGGTCAAGG + Intergenic
1126011908 15:44311126-44311148 TAAAACTACCTTGCAGGATTTGG - Intronic
1126754820 15:51915902-51915924 TACCATCACATTGGAGGTTAGGG - Intronic
1127387588 15:58479139-58479161 AAGAACTACATTGCATCTTAAGG - Intronic
1129542090 15:76358696-76358718 TACAACTACATTGCAGGTTAGGG + Intronic
1132025232 15:98399510-98399532 TACCATTACATTGGGGGTTAAGG - Intergenic
1134768496 16:16783419-16783441 TACAGTTACATTGGGGGTTAGGG - Intergenic
1135821115 16:25687105-25687127 TACAGTCACATTGGAGGTTAGGG + Intergenic
1137721334 16:50629345-50629367 TACAATCACATTGGGGGTTAGGG + Intronic
1137793491 16:51195191-51195213 TAGATCTACCTTGCAGGTAATGG + Intergenic
1139184133 16:64784528-64784550 TACAATCACATTGAAGGTTAGGG - Intergenic
1143395200 17:6589139-6589161 TACTACCACATTGGGGGTTAGGG - Intronic
1143713224 17:8748176-8748198 TACAATTATATTGGAGATTAGGG - Intergenic
1144047891 17:11469871-11469893 TACAATTACATTGAAGGTAAGGG - Intronic
1144243763 17:13341284-13341306 TACCATCACATTGGAGGTTAGGG + Intergenic
1148019716 17:44545593-44545615 TACAATCACATTGAGGGTTAGGG - Intergenic
1150966972 17:69982130-69982152 AACAACTATCTTGCAGGTAAAGG + Intergenic
1156048896 18:32908058-32908080 TAAAATTAAATTGCAGATTATGG - Intergenic
1157044464 18:44083002-44083024 AACAAATACATTAAAGGTTAAGG + Intergenic
1159580601 18:70230873-70230895 TACAGCCACATTGGGGGTTAGGG + Intergenic
1160020518 18:75177154-75177176 TACAATCACATTGCAGATTAGGG - Intergenic
1163877338 19:19883531-19883553 TGCCACTACATTGCAGGTTGGGG + Intronic
1163998676 19:21077023-21077045 AAGAATCACATTGCAGGTTAGGG - Intergenic
1164036580 19:21461022-21461044 TAGAATCACATTGGAGGTTATGG + Intronic
1165546729 19:36543840-36543862 TACAATCACATTGCAGGTTAAGG + Intronic
925715339 2:6779730-6779752 TACCACGACATTGGGGGTTAGGG + Intergenic
926130144 2:10297891-10297913 TACAATTACATTAGAGGTTAGGG + Intergenic
926608584 2:14922668-14922690 TACAGTTACATTGGGGGTTAGGG + Intergenic
927433998 2:23051697-23051719 TAGAATTAGACTGCAGGTTAGGG + Intergenic
929238794 2:39632329-39632351 TTCAACTACATGGCAGAGTAAGG - Intergenic
930869732 2:56158328-56158350 TACAACCACGTTGGGGGTTAGGG + Intergenic
933871696 2:86572700-86572722 TACAGTTACATTGGGGGTTAAGG + Intronic
934872483 2:97879932-97879954 TTTAACAACATGGCAGGTTAGGG - Intronic
935448695 2:103185597-103185619 TACAGCTGCATTGGGGGTTAGGG - Intergenic
936813799 2:116434507-116434529 TCTAAATACATTGAAGGTTAAGG + Intergenic
937030983 2:118740303-118740325 TACCACAACATTGTGGGTTAGGG - Intergenic
937495105 2:122411135-122411157 TACAATCACATTGAAGTTTAGGG - Intergenic
943898474 2:193400591-193400613 TAGAATCACATTGAAGGTTAGGG - Intergenic
943940361 2:193986535-193986557 TACAACCACACTGGAGGTTGAGG - Intergenic
946929665 2:224659359-224659381 TACCATTACATTGGAGATTAGGG - Intergenic
947999721 2:234557721-234557743 TATCATTACATTGGAGGTTAGGG + Intergenic
948396121 2:237646566-237646588 TACAGCTACACTGGGGGTTAGGG - Intronic
948984892 2:241514981-241515003 TCCAAATACATTGACGGTTAGGG + Intergenic
1168906195 20:1405628-1405650 TACCAGTACCTTGGAGGTTAGGG + Intergenic
1171314503 20:24177232-24177254 CACCATTACATTGGAGGTTAGGG + Intergenic
1172919223 20:38467538-38467560 TACCATCACATTGGAGGTTAGGG - Intergenic
1176981656 21:15387836-15387858 TCCAACTACATGGAAGGCTAAGG + Intergenic
1177412480 21:20748246-20748268 TAAAAGTACATTGTAGGTCAGGG - Intergenic
1177748677 21:25253212-25253234 TACCACCATATTGCAGGTTAGGG - Intergenic
1180714001 22:17859185-17859207 GACAACCACAGTCCAGGTTAGGG - Intronic
1181883914 22:26003739-26003761 TACATCTTCTTTGAAGGTTAGGG - Intronic
1185005106 22:48271207-48271229 TACCATTACATTGGACGTTAGGG + Intergenic
951475287 3:23098886-23098908 TACAACTTCATGGCAGTTTGGGG - Intergenic
951745234 3:25970905-25970927 TACAGCCACATTGAGGGTTACGG - Intergenic
952076676 3:29705159-29705181 TACGGCCACATTGCAGGGTAAGG + Intronic
955292193 3:57702465-57702487 TACCATCACATTGCGGGTTAGGG - Intergenic
955698838 3:61663441-61663463 TACAATAACATTGCAAGTTAGGG - Intronic
955957594 3:64306342-64306364 TACAATTACATTAGGGGTTAGGG - Intronic
957839153 3:85643913-85643935 TACAGCTACATTGGGGGTTAGGG + Intronic
958525753 3:95257249-95257271 GACAATCACATTGCAGCTTAAGG + Intergenic
958681940 3:97342586-97342608 TACTATCACATTGAAGGTTAGGG - Intronic
959496027 3:107052857-107052879 TAAATCATCATTGCAGGTTATGG + Intergenic
960066026 3:113373910-113373932 TACAGCTAGTTTGCAGTTTAAGG + Intronic
960910597 3:122645301-122645323 TACAGTTACATTGAAGGTTAGGG + Intergenic
963886200 3:150585734-150585756 TACCACCACGTTGGAGGTTAGGG - Intronic
964623604 3:158738691-158738713 TACCATCACATTGGAGGTTAGGG + Intronic
964691897 3:159459709-159459731 TACAATTACATTGTAGGTACTGG - Intronic
964918384 3:161864390-161864412 CACAACTTCCTTCCAGGTTATGG + Intergenic
966702151 3:182866045-182866067 TACAACCACATTGCAAGTAGAGG - Intronic
968430875 4:557907-557929 GACAACTACATTGCAGGATAAGG + Intergenic
970836939 4:20420723-20420745 TACCACTGCATTGGAGGTTAGGG - Intronic
971043846 4:22782927-22782949 TATAATTACATTGGGGGTTAAGG + Intergenic
971305932 4:25481574-25481596 TACAACTACACTGGGAGTTAGGG + Intergenic
971447578 4:26767451-26767473 TACCATCACATTGGAGGTTAGGG - Intergenic
971451125 4:26803063-26803085 TACCATCACATTGGAGGTTAGGG + Intergenic
972124816 4:35750445-35750467 TACATGAACATTGCAGGTTATGG + Intergenic
973755294 4:54067947-54067969 TACCATTACATTGAGGGTTAGGG - Intronic
973860032 4:55054400-55054422 TACAGCCACACTGGAGGTTAAGG - Intergenic
974095760 4:57362099-57362121 TGCAGCCACATTGGAGGTTAGGG + Intergenic
976040302 4:80876193-80876215 TACAACAACCTTATAGGTTAGGG + Intronic
976182496 4:82411843-82411865 TACAACCACATTGGAGGTTAGGG + Intergenic
977975342 4:103257876-103257898 TACCACTACATAGCAGTATATGG - Intergenic
978784337 4:112592825-112592847 TATAATCACATTGGAGGTTAAGG - Intronic
979108735 4:116722536-116722558 TCCACCTACTTTGCAGTTTAGGG + Intergenic
979987141 4:127329260-127329282 TATATTTACATTGGAGGTTAGGG - Intergenic
981248498 4:142569607-142569629 TACAACTACATTGCAGAGAAAGG - Intronic
981402824 4:144334561-144334583 TACCATCACATTGGAGGTTATGG + Intergenic
981508256 4:145526935-145526957 TACATCTACTTTTCAGGTTGAGG + Intronic
982445589 4:155487025-155487047 TACCATTACATTGGGGGTTAGGG - Intergenic
982460557 4:155664636-155664658 TCCAACAAGATTGTAGGTTATGG + Intergenic
982837597 4:160141267-160141289 TGCAACTACATTGCACATTTAGG + Intergenic
983302680 4:165947321-165947343 TACAGCCACATTGGATGTTAGGG + Intronic
983588974 4:169386624-169386646 TACAGCTACACTGGGGGTTAGGG - Intergenic
983885954 4:172980757-172980779 TACACTTACATTGACGGTTAGGG + Intronic
984243094 4:177241460-177241482 TACCACCACATAGAAGGTTAGGG + Intergenic
985562515 5:596695-596717 TACAGTTACATTGGGGGTTAGGG + Intergenic
986619889 5:9661033-9661055 AACATCTTCATTTCAGGTTAGGG + Intronic
987007752 5:13727864-13727886 TACAACTACATTTCAAAGTAGGG + Intronic
987617851 5:20299891-20299913 ATCAAATATATTGCAGGTTAAGG + Intronic
988895926 5:35674754-35674776 TACCATCACATTGGAGGTTAGGG + Intronic
989526539 5:42459977-42459999 TTCAGCCACATTGGAGGTTAGGG - Intronic
990167256 5:53008403-53008425 TACAATCACATTGAGGGTTAGGG + Intronic
991088154 5:62667297-62667319 TACAGTCACATTGGAGGTTAGGG + Intergenic
991194083 5:63911467-63911489 TACAGGTACATTGGAGGTTAGGG + Intergenic
992164720 5:74038352-74038374 TACCACTACACTGGGGGTTAAGG - Intergenic
992186111 5:74246225-74246247 AACAATTACATTGAAGGTAAAGG + Intergenic
993724850 5:91355529-91355551 TACAATCACATTGTGGGTTAAGG + Intergenic
993937833 5:94025482-94025504 TACAATAGCATTGGAGGTTAAGG + Intronic
993943676 5:94093560-94093582 TACAGTTACACTGTAGGTTATGG + Intronic
994818766 5:104621175-104621197 TAAAGATACATTGCAGGTCAAGG + Intergenic
995139629 5:108720871-108720893 CACAACTTCACTGCAGGTTTAGG + Intergenic
995815716 5:116165845-116165867 TGCAACTACACTGCTGTTTAGGG + Intronic
997291806 5:132742414-132742436 TACCATCACATTGCAGGTTAGGG + Intergenic
997972465 5:138414839-138414861 TCCAGCTACTTTGCAGGCTAGGG + Intronic
999961145 5:156756886-156756908 GACAGCTGCATTGAAGGTTAAGG + Intronic
1001252977 5:170162662-170162684 TACCATCACATTGGAGGTTAGGG - Intergenic
1003819085 6:9876007-9876029 TACGACTGCATTGGAGGTTAGGG - Intronic
1005104281 6:22206631-22206653 TACAATCACATTGGGGGTTAGGG - Intergenic
1006733369 6:36253314-36253336 TAAAGCTACATTGCAGAGTAAGG - Intronic
1006837926 6:37010425-37010447 TACACTTACATTGGGGGTTAGGG + Intronic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1008211564 6:48730305-48730327 CTCAACTACATTGCAGTTAAAGG + Intergenic
1008368892 6:50711916-50711938 TACACCTTCATTGAAGGTGACGG - Intergenic
1008596243 6:53044676-53044698 TACAATCTCATTGGAGGTTAGGG - Intronic
1009039872 6:58163105-58163127 TACAGTCACATTGAAGGTTAGGG + Intergenic
1009215762 6:60917953-60917975 TACAGTCACATTGAAGGTTAGGG + Intergenic
1009641134 6:66337967-66337989 TAAAATCACATTGCGGGTTAGGG + Intergenic
1009895808 6:69747095-69747117 TACCATTACATTGGGGGTTAGGG - Intronic
1011388009 6:86818408-86818430 TACAGTTACATTGGGGGTTAAGG + Intergenic
1011979006 6:93347788-93347810 TACAGTTACATTGGGGGTTAGGG + Intronic
1013607649 6:111765248-111765270 TACAGTTACATTGGGGGTTAGGG - Intronic
1014356281 6:120414262-120414284 TACAGTCACATTGCGGGTTAGGG + Intergenic
1015022278 6:128490999-128491021 TACAATCACATTGGGGGTTAGGG + Intronic
1015313736 6:131793656-131793678 TCCAACTACTTGGCAGGCTAGGG + Intergenic
1016917207 6:149255102-149255124 TACCATTACATTGGGGGTTAGGG - Intronic
1018512867 6:164544893-164544915 TACAACTACATTGTTATTTATGG - Intergenic
1019205883 6:170361385-170361407 TATAACATTATTGCAGGTTAAGG - Intronic
1020545267 7:9520390-9520412 TACAGATAAATTGCATGTTACGG - Intergenic
1021893899 7:25215155-25215177 TACAATCACATTGGAGGTTAGGG - Intergenic
1022992578 7:35722971-35722993 TACAGCTACATTGGGGGTTAGGG + Intergenic
1023192373 7:37596464-37596486 TACCATCACATTGCAGATTAGGG + Intergenic
1026197976 7:68189401-68189423 TACAATCTCATTGCAGGTTAAGG - Intergenic
1027694102 7:81387218-81387240 TACAGTCACATTGGAGGTTAGGG + Intergenic
1029570750 7:101367263-101367285 TACCACCACATTGGAGGATAGGG - Intronic
1030976321 7:116127809-116127831 TACAAATTCATAGCATGTTATGG + Intronic
1031006794 7:116482590-116482612 TACCATTACATTGGGGGTTAAGG + Intronic
1031147073 7:118008250-118008272 TACAATCACATTGGGGGTTAGGG + Intergenic
1031714863 7:125096410-125096432 TACCAATACATTGGGGGTTAGGG + Intergenic
1032762380 7:134955724-134955746 TACAATCACATTGGGGGTTAGGG + Intronic
1034526396 7:151666221-151666243 TACAGTCACATTGGAGGTTAGGG - Intronic
1036081040 8:5555627-5555649 TACAGCCACATTGCGGGTGAGGG + Intergenic
1036119016 8:5994557-5994579 TGGAATTACATTGCAGGTTTCGG - Intergenic
1036285350 8:7440367-7440389 AACAAATAGATTGCAGGGTAGGG - Intergenic
1036336126 8:7871162-7871184 AACAAATAGATTGCAGGGTAGGG + Intergenic
1037330751 8:17741283-17741305 CACAATCACATTGCAGGTTGGGG + Intronic
1037489456 8:19384269-19384291 TGCCAGGACATTGCAGGTTAAGG + Intronic
1038115976 8:24555661-24555683 TACCATCACATTGCAGGTTAGGG - Intergenic
1041158421 8:55011712-55011734 TACAGCTACACTGAGGGTTAGGG - Intergenic
1041263942 8:56045780-56045802 TCCAACTACTTGGCAGGCTAAGG - Intergenic
1041599006 8:59693606-59693628 TACAGTCACATTGGAGGTTAGGG - Intergenic
1041600423 8:59711273-59711295 TACAACCACATTGGGGGTTAGGG - Intergenic
1042000071 8:64112217-64112239 TACAATTACATTGGGGATTAGGG - Intergenic
1042309635 8:67367336-67367358 TACCATCACATTGCAGGGTAGGG + Intergenic
1043262139 8:78215207-78215229 TACAACTATATTGGGGGTTCAGG + Intergenic
1043532074 8:81161803-81161825 TACCAGCACATTGCAGGTTAGGG + Intergenic
1044586850 8:93876267-93876289 TACAGTCACATTGGAGGTTAGGG + Intronic
1045043134 8:98246242-98246264 TACAGATACATTTCAGTTTAGGG + Intronic
1045496941 8:102717056-102717078 TTCAACAACATTGCAGGTGCTGG - Intergenic
1047142575 8:122158001-122158023 GACAACTTCATGGCATGTTACGG + Intergenic
1048290530 8:133178005-133178027 TACATGTACATTGCAGGATGAGG + Intergenic
1048763681 8:137824516-137824538 TACCATCACATTGGAGGTTAGGG - Intergenic
1048777435 8:137962694-137962716 TACAATCACATGGCAGTTTAGGG + Intergenic
1049000537 8:139823117-139823139 TACAACCACACTGGGGGTTACGG + Intronic
1051205738 9:14686855-14686877 CACAACTACTTAGGAGGTTAAGG + Intronic
1051833484 9:21308281-21308303 TACAAATACATTCAAGCTTATGG - Intergenic
1052094515 9:24368683-24368705 TAAATCTACATTGCAGTTAACGG - Intergenic
1052388267 9:27847956-27847978 TACGACTGCCTTGCTGGTTATGG + Intergenic
1054764388 9:69031344-69031366 AACAATTACATTGCAGGCTGTGG + Intergenic
1054969771 9:71071779-71071801 TCCACTTACATTGCAGGTTCAGG - Intronic
1056217471 9:84418725-84418747 TACTATCACATTGGAGGTTAGGG - Intergenic
1056782171 9:89558887-89558909 TACAATCACATTTCAGGTTAGGG + Intergenic
1056819790 9:89831210-89831232 TACAGTCACATTGGAGGTTAGGG - Intergenic
1059059481 9:111020145-111020167 TACAGCTACACTGGGGGTTAGGG + Intronic
1059163459 9:112056993-112057015 TACCATCACATTGTAGGTTAGGG - Intronic
1060047943 9:120355471-120355493 TACAATTACATTGTACATTACGG + Intergenic
1060877054 9:127091168-127091190 AAGAACTACATTGCAGAGTAGGG - Intronic
1061790289 9:133055543-133055565 TAGAACTACATGGCTGGGTACGG + Intronic
1186164478 X:6811897-6811919 TACATCTGAATTGCATGTTATGG - Intergenic
1186172563 X:6892667-6892689 TACAGCCACACTGAAGGTTAGGG - Intergenic
1186685560 X:11921442-11921464 TACAATCACATTGGGGGTTAGGG + Intergenic
1187687421 X:21829511-21829533 TACTACTACATTTTAGGTGAGGG - Intergenic
1188948388 X:36337184-36337206 TAGGTCTACATTTCAGGTTATGG - Intronic
1189156546 X:38762978-38763000 TACAAATACATTATAGGTTTTGG + Intergenic
1189671482 X:43414929-43414951 TACCATGACATTGGAGGTTAGGG - Intergenic
1189740166 X:44109573-44109595 TACCATTACCTTGGAGGTTAGGG + Intergenic
1189876644 X:45443069-45443091 TACAGGTAAATTGCACGTTACGG + Intergenic
1189987523 X:46567377-46567399 TACAACAACCCTGCAGGATAGGG + Intergenic
1190156380 X:47996665-47996687 TACAGTCACATTGCAGGTTGGGG - Intronic
1190408296 X:50109769-50109791 TACAGCCACACTGGAGGTTAGGG - Intergenic
1191925155 X:66301099-66301121 TACCATCAAATTGCAGGTTAGGG + Intergenic
1194234485 X:91365124-91365146 TACAGGTAAATTGCATGTTACGG - Intergenic
1194593812 X:95834658-95834680 TCAAACTACACTGCAGTTTAAGG - Intergenic
1195096558 X:101506653-101506675 TACAGCCACATTGAAAGTTAGGG + Intronic
1195663395 X:107404878-107404900 TACAATCACATTGTGGGTTAGGG + Intergenic
1195918074 X:109955507-109955529 TACACTTACATTGCAGATTTCGG - Intergenic
1195957626 X:110349455-110349477 TACTACCACATTGGAGATTAGGG + Intronic
1196074747 X:111563427-111563449 TACCATCACATTGGAGGTTAAGG - Intergenic
1196358850 X:114828882-114828904 TACAAATACATGGCACATTATGG - Intronic
1196969798 X:121096425-121096447 TACAGTCACATTGCAGATTAGGG - Intergenic
1197111939 X:122786030-122786052 TACAAGTAGATTGAAGGTAAAGG - Intergenic
1197456672 X:126684507-126684529 TACAGTAACATTGGAGGTTAGGG - Intergenic
1197686899 X:129450082-129450104 TACAGTCACATTGAAGGTTAGGG - Intronic
1197731915 X:129818024-129818046 TGCAGCTACATTGGGGGTTAGGG - Intronic
1198472809 X:136964737-136964759 TATAATCACATTGGAGGTTAGGG + Intergenic
1198656306 X:138917225-138917247 TATCATCACATTGCAGGTTAGGG - Intronic
1200386638 X:155898325-155898347 GAAAACTATATTGCAGGTCAGGG - Intronic
1201558582 Y:15290862-15290884 TACATCTGAATTGCACGTTATGG - Intergenic