ID: 1129542156

View in Genome Browser
Species Human (GRCh38)
Location 15:76359216-76359238
Sequence CCTTATGGAGAGATGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 266}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129542156_1129542165 3 Left 1129542156 15:76359216-76359238 CCCAGCCCCATCTCTCCATAAGG 0: 1
1: 0
2: 1
3: 24
4: 266
Right 1129542165 15:76359242-76359264 ACTCTTCAGAGCACAGGGTCTGG 0: 1
1: 0
2: 1
3: 16
4: 210
1129542156_1129542166 9 Left 1129542156 15:76359216-76359238 CCCAGCCCCATCTCTCCATAAGG 0: 1
1: 0
2: 1
3: 24
4: 266
Right 1129542166 15:76359248-76359270 CAGAGCACAGGGTCTGGCAGAGG 0: 1
1: 0
2: 4
3: 42
4: 471
1129542156_1129542168 30 Left 1129542156 15:76359216-76359238 CCCAGCCCCATCTCTCCATAAGG 0: 1
1: 0
2: 1
3: 24
4: 266
Right 1129542168 15:76359269-76359291 GGCAGGCCCCACTGTCTTGCTGG 0: 1
1: 0
2: 0
3: 18
4: 186
1129542156_1129542164 -2 Left 1129542156 15:76359216-76359238 CCCAGCCCCATCTCTCCATAAGG 0: 1
1: 0
2: 1
3: 24
4: 266
Right 1129542164 15:76359237-76359259 GGACTACTCTTCAGAGCACAGGG 0: 1
1: 1
2: 0
3: 10
4: 99
1129542156_1129542163 -3 Left 1129542156 15:76359216-76359238 CCCAGCCCCATCTCTCCATAAGG 0: 1
1: 0
2: 1
3: 24
4: 266
Right 1129542163 15:76359236-76359258 AGGACTACTCTTCAGAGCACAGG 0: 1
1: 0
2: 0
3: 15
4: 124
1129542156_1129542167 13 Left 1129542156 15:76359216-76359238 CCCAGCCCCATCTCTCCATAAGG 0: 1
1: 0
2: 1
3: 24
4: 266
Right 1129542167 15:76359252-76359274 GCACAGGGTCTGGCAGAGGCAGG 0: 1
1: 0
2: 3
3: 61
4: 591

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129542156 Original CRISPR CCTTATGGAGAGATGGGGCT GGG (reversed) Intronic
900178211 1:1299945-1299967 CCTTTGGGAGGGGTGGGGCTGGG - Intronic
903625207 1:24725422-24725444 CCTCCTGCAGGGATGGGGCTTGG - Intergenic
904557582 1:31375144-31375166 AATGATGGAGAGCTGGGGCTGGG + Intronic
904801058 1:33093210-33093232 CTTGATTGAGAGATGTGGCTGGG + Intronic
907626824 1:56038764-56038786 CCACATGGAGAGAAGGGGCTAGG - Intergenic
910532381 1:88252509-88252531 CATTATTCAGAGATGAGGCTGGG + Intergenic
911842488 1:102701831-102701853 GCTTAAGGAGATTTGGGGCTGGG + Intergenic
912775937 1:112506588-112506610 CCCTGTGTAGGGATGGGGCTGGG + Intronic
913169744 1:116221542-116221564 CCTTATGGGGACTTTGGGCTAGG + Intergenic
913203958 1:116518517-116518539 CATTAGAGAAAGATGGGGCTGGG - Intronic
913234366 1:116767269-116767291 CTTTATGGAGATGTGTGGCTGGG - Intronic
914256345 1:145963113-145963135 CGTTTTTGAGAGATGGGGCGGGG - Intronic
915237006 1:154491323-154491345 GATTATGGGGAGATGGGGCAGGG - Intronic
915351290 1:155227928-155227950 CCTCAGGAAGAGATGGGGCAAGG - Intergenic
915515113 1:156408195-156408217 CCTGACTGAGAAATGGGGCTGGG - Intronic
919467459 1:197939597-197939619 CCTTTTGGAGAGTTGAGGATGGG - Intergenic
920136107 1:203770644-203770666 CTTTATGGAGAGAGGGGACTTGG - Intronic
920548176 1:206836104-206836126 CCTTCTGGAGAGATGGGAAAGGG - Intronic
921033846 1:211357521-211357543 GCTTATGGAGAGCAGGGCCTGGG + Intronic
922505795 1:226124815-226124837 CTTTAGGGAGGGATGGGGGTGGG - Intergenic
924016846 1:239735993-239736015 TCTTATGGAGGGTTGGGGATAGG - Intronic
924409731 1:243791710-243791732 CCTTATTGAGAGAAGGGGACTGG - Intronic
1063023656 10:2156070-2156092 GCCTAAGGAGGGATGGGGCTTGG + Intergenic
1064735012 10:18373109-18373131 CTTTAGGGAAATATGGGGCTGGG - Intronic
1069691824 10:70358715-70358737 CTTTCTGGGGAGGTGGGGCTAGG - Intronic
1070144026 10:73760655-73760677 CCTTAAGAAGAGATAGGGATGGG + Intronic
1071156238 10:82692612-82692634 CCTTATGCAGGGAAGGAGCTCGG - Intronic
1072198834 10:93140620-93140642 CAGAATGGAGAGTTGGGGCTGGG - Intergenic
1074435682 10:113432302-113432324 TCTTATGCAGAGATGGAGCCAGG - Intergenic
1074904929 10:117853130-117853152 CCCCATGGAGAGATGGGGACAGG + Intergenic
1075050280 10:119178491-119178513 CCTTAAGTGGAGATGGGCCTGGG + Intronic
1076571317 10:131434887-131434909 CCTCATGCAGAGTGGGGGCTGGG + Intergenic
1076883235 10:133249579-133249601 CCTGGTGGGGACATGGGGCTGGG + Intergenic
1077225343 11:1436988-1437010 CCCTATGGGGAGGTGGGGGTGGG + Intronic
1078337008 11:10472706-10472728 AGTTAGGGAGAGATTGGGCTGGG + Intronic
1078619441 11:12893664-12893686 CCCTCTGTAGAGATGGTGCTGGG + Intronic
1079184840 11:18227503-18227525 CCTTACCCAGAGAGGGGGCTTGG + Intronic
1081360966 11:42177556-42177578 CCTTATAGAAAGATGGGATTAGG - Intergenic
1082007136 11:47425754-47425776 CCTGGGGGAGACATGGGGCTCGG - Intronic
1082824089 11:57565540-57565562 CTTTTTGTAGAGATGGGGTTTGG + Intronic
1082954884 11:58859202-58859224 CCTTATTGATGGATGGGGGTAGG - Intronic
1082958230 11:58894590-58894612 TTTTATGGAGAGATGAGGATAGG - Intronic
1083164958 11:60878408-60878430 CCTTTTGGGGAGGTGGGGATGGG + Intergenic
1083621838 11:64053152-64053174 CCAGACGGAGAGCTGGGGCTGGG + Intronic
1084096371 11:66914169-66914191 CCTTATGGAGAGAGAGGGGCAGG - Intronic
1085052974 11:73389175-73389197 CCTTATGGTGAGCTGGGGATGGG + Exonic
1085776673 11:79372728-79372750 GCTCATGAAGATATGGGGCTTGG + Intronic
1085845322 11:80058540-80058562 CCTTATGGAGGGATGTGGGAAGG + Intergenic
1086925798 11:92639514-92639536 CCTCAGAGAGAGATGGGGCATGG - Intronic
1087448919 11:98292523-98292545 CATTATGGGGAGATGGAGTTTGG - Intergenic
1088431123 11:109759943-109759965 CCTGTTGGAGAGTTGGGTCTAGG + Intergenic
1089050824 11:115544301-115544323 GTTAATGAAGAGATGGGGCTGGG - Intergenic
1089330558 11:117686166-117686188 CTATGTGGAGAGATGGAGCTGGG + Intronic
1089541677 11:119193111-119193133 ACTCTTGGAGAGAAGGGGCTTGG + Intronic
1091678788 12:2511255-2511277 CTTTATGGTGAGATGGAGTTGGG - Intronic
1094724554 12:33100507-33100529 TCATATGGAGAGGTGGGGCTGGG + Intergenic
1096791232 12:54046511-54046533 CCTCAAGGAGAGAAGGGGATTGG - Intronic
1097224792 12:57470964-57470986 CCTTATGGAGCGAGGGGTCCAGG + Exonic
1100443550 12:94640359-94640381 TCTTTTGTAGAGATGGGGTTTGG + Intronic
1100857882 12:98774226-98774248 CCTTATGCAGAGCAGGTGCTGGG + Intronic
1101575903 12:105996017-105996039 GATTAAGGAGAGCTGGGGCTTGG - Intergenic
1102461331 12:113101676-113101698 CCTTATGCAGAACTGGGTCTTGG - Intronic
1102539057 12:113605327-113605349 CTTTTTGCAGAGATGGGGCGGGG + Intergenic
1102837528 12:116079392-116079414 CCTTTTGCAGAGATGGGGGAGGG + Intronic
1103204425 12:119117357-119117379 CAACATGGAGAGATGGGGCAGGG - Intronic
1103373681 12:120438493-120438515 CCTGATGCGGAGATGGGGGTAGG - Exonic
1105777031 13:23672253-23672275 CCTTCTGGAGAGATGTGTATAGG - Intronic
1107220541 13:37974048-37974070 ACATATGGAGAGAAGGGGTTGGG + Intergenic
1107563247 13:41576599-41576621 CCTGGGGGAGAGATGTGGCTAGG + Intronic
1109042897 13:57363589-57363611 ATATATGGAGATATGGGGCTAGG - Intergenic
1114641191 14:24222791-24222813 TCACATGTAGAGATGGGGCTGGG + Intronic
1118792560 14:69108453-69108475 CCTTATGGAGAGACGGAAATGGG + Intronic
1118971563 14:70642126-70642148 CCGAATGGAGAGAAAGGGCTCGG + Exonic
1122094783 14:99362968-99362990 CCTTATGCACACTTGGGGCTGGG - Intergenic
1126067067 15:44834104-44834126 CCTTATTCATAGATGGGACTAGG + Intergenic
1126092763 15:45066474-45066496 CCTTATTCATAGATGGGACTAGG - Intronic
1127240535 15:57108625-57108647 CCTTAGAGAGAGATCTGGCTTGG + Intronic
1128330215 15:66750788-66750810 CCTTATGGGGTGAGGGAGCTGGG + Intronic
1128482870 15:68054690-68054712 CCCCATGGGGAGCTGGGGCTGGG + Intronic
1129072303 15:72961514-72961536 CCCTCTGGAGAGCTGGGGCAAGG + Intergenic
1129377482 15:75143234-75143256 CCTTATGGGCAGTTGGGGCCTGG + Intergenic
1129542156 15:76359216-76359238 CCTTATGGAGAGATGGGGCTGGG - Intronic
1130257415 15:82332232-82332254 ACTTATGCAAGGATGGGGCTTGG - Intergenic
1130597530 15:85257733-85257755 ACTTATGCAAGGATGGGGCTTGG + Intergenic
1130995479 15:88901519-88901541 CCTTCTTGGGATATGGGGCTGGG - Intronic
1131146449 15:90016778-90016800 CCCTTTGCAGAGATGGGTCTAGG - Intronic
1132946489 16:2534350-2534372 CCTTTTAGAGAGAAGGGCCTAGG + Intergenic
1133509617 16:6444824-6444846 CCTTCTGAAGGGCTGGGGCTTGG + Intronic
1134825736 16:17282631-17282653 CTTTAAGGAGAGAAGGAGCTGGG + Intronic
1136009199 16:27351808-27351830 TTTTAAAGAGAGATGGGGCTGGG - Intronic
1139955617 16:70691657-70691679 CCTTCTGGGGAAATGGGGCAGGG + Intronic
1140894035 16:79309376-79309398 CCTTCTGGAGAGATGAAGGTGGG - Intergenic
1144464055 17:15482337-15482359 GCTTATGGGGTGATGGGGCTGGG - Intronic
1144638692 17:16926198-16926220 CCTCATGGGGAGACTGGGCTAGG - Intergenic
1146456814 17:33015134-33015156 CCATATAGGGAGAAGGGGCTGGG + Intronic
1146845529 17:36179400-36179422 CCTGCTGCAGAGATGGGCCTGGG + Intronic
1146873745 17:36391241-36391263 CCTGCTGCAGAGATGGGCCTGGG + Intronic
1146881103 17:36442331-36442353 CCTGCTGCAGAGATGGGCCTGGG + Intergenic
1146913770 17:36665126-36665148 CCCAAGGGAGAGATGGGGGTGGG + Intergenic
1147065644 17:37921630-37921652 CCTGCTGCAGAGATGGGCCTGGG - Intergenic
1147135026 17:38429303-38429325 CCTGATGGGGGGATGGGGCTGGG - Intronic
1148492806 17:48034051-48034073 AGTAATGGAGAGATGGGGCAGGG - Intronic
1149494783 17:57110227-57110249 CCTCAGGGAGGGAGGGGGCTGGG + Intronic
1149657644 17:58318781-58318803 CCTTGTGCAGAGTGGGGGCTTGG - Intronic
1150001283 17:61442163-61442185 CCTTGTGGAAAGATAAGGCTTGG - Intergenic
1153472605 18:5463722-5463744 CCTCATGGAGACACTGGGCTAGG - Intronic
1153929626 18:9866754-9866776 CCTTTTGGAGAGCTGGGGCTGGG + Intergenic
1154933770 18:21029461-21029483 TCTTATGGAGATATTGGGGTGGG - Intronic
1156138603 18:34077008-34077030 CCTTAGAAAGAAATGGGGCTAGG + Intronic
1156753248 18:40486832-40486854 CCTTATGGGGACATGGGGGCAGG + Intergenic
1156901055 18:42300461-42300483 CCTTTTGCATAAATGGGGCTGGG + Intergenic
1159009027 18:63040803-63040825 CCCTATGGAGGAAGGGGGCTGGG + Intergenic
1159561342 18:69998526-69998548 CCTCAGGGAGAAATGAGGCTGGG - Intergenic
1160961828 19:1725592-1725614 TATTACGGAGAGATGGGGCGGGG + Intergenic
1161257224 19:3316121-3316143 CCGTATGGAGAAATGGGGCCTGG - Intergenic
1162321617 19:9974004-9974026 CCTTTTGGGGAGAGGGGCCTGGG - Intronic
1162434538 19:10649455-10649477 TTTAATGTAGAGATGGGGCTGGG + Intergenic
1162913021 19:13860030-13860052 TTTTTTGGAGAGATGGGGGTGGG - Intergenic
1163691699 19:18742028-18742050 CCGTGAGGAGAGGTGGGGCTGGG - Intronic
1165132374 19:33641007-33641029 CCAAATGGAGACAAGGGGCTGGG - Intronic
1165360628 19:35334631-35334653 CCTTGGGGAGAGCTGAGGCTGGG + Intronic
1166375615 19:42325459-42325481 CTTTATGGAGGGTTGGGGTTGGG + Intergenic
1167358422 19:49017610-49017632 CCTAAGGGAGAGGTGGGGCTCGG - Intergenic
1167359918 19:49024503-49024525 CCTAAGGGAGAGGTGGGGCTCGG - Intronic
1167361163 19:49031268-49031290 CCTAAGGGAGAGGTGGGGCTCGG + Intronic
1167362487 19:49037529-49037551 CCTAAGGGAGAGGTGGGGCTCGG - Intergenic
1167363641 19:49043655-49043677 CCTAAGGGAGAGGTGGGGCTCGG + Intergenic
1167364856 19:49049271-49049293 CCTAAGGGAGAGGTGGGGCTCGG - Intergenic
1167366136 19:49055908-49055930 CCTAAGGGAGAGGTGGGGCTCGG - Exonic
1167693286 19:51000368-51000390 GCTTAAGGAAAGAGGGGGCTGGG - Intronic
1168105390 19:54162973-54162995 CCTGAAGGAAAGATGGAGCTGGG - Intronic
1168492165 19:56820375-56820397 AATTATGCAGACATGGGGCTCGG + Intronic
925150847 2:1613763-1613785 CCCTATTGAGAGATGAGGATGGG - Intergenic
926180839 2:10641831-10641853 CGTTATGGAGAGGTGGGGAGGGG - Intronic
927055084 2:19359630-19359652 CATTAGGGAGGGATTGGGCTGGG - Intergenic
927385225 2:22524687-22524709 CCCTATGGGGGGATGGGGGTTGG + Intergenic
929121762 2:38489480-38489502 CCTTCTGGGGACCTGGGGCTGGG + Intergenic
931653592 2:64490132-64490154 CCTTCTGGAGAGGAGGGTCTGGG + Intergenic
933216630 2:79637349-79637371 CCTTATTAGAAGATGGGGCTTGG - Intronic
936011934 2:108930481-108930503 CTTGATGGTGGGATGGGGCTTGG - Intronic
937111045 2:119367333-119367355 CTTGATGGAGAGATGGGGGAAGG + Intronic
937322937 2:120971717-120971739 GGTGATGGAGAGATGGGGGTTGG + Intronic
938189988 2:129269744-129269766 CCTTCTGGAAACTTGGGGCTTGG - Intergenic
938374407 2:130796326-130796348 CACAATGGAGAGATGGGCCTGGG - Intergenic
940537357 2:154962048-154962070 CCTTATGTCTAGATGGGACTGGG + Intergenic
941262573 2:163316204-163316226 CCTTATGGAGAGGAGGAGCCTGG - Intergenic
941300507 2:163795359-163795381 GCTTAAGGAGAGATGGTGATGGG - Intergenic
945178102 2:207064027-207064049 CCTTAGAGAGAGATGGGGGACGG + Intergenic
946479879 2:220044779-220044801 CCTTATGCAGATTTGGGGCCTGG + Intergenic
947256721 2:228174013-228174035 CCTTAAGGAGAAATGTGGCTTGG + Intronic
947529421 2:230899285-230899307 CCTTATGGGGAGATGGGAGAGGG - Intergenic
948719387 2:239889154-239889176 CCTTTGGGTGAGATGGAGCTGGG - Intergenic
1168753904 20:302520-302542 GTTAATCGAGAGATGGGGCTGGG + Intergenic
1171144022 20:22766297-22766319 CCTTAGGAAGAGAAGAGGCTGGG - Intergenic
1172523838 20:35585537-35585559 CTTTTTGTAGAGATGGGGTTTGG + Intergenic
1174110743 20:48196150-48196172 CCATATGGAGAGAGGGGGGGTGG + Intergenic
1174201081 20:48806864-48806886 CAGTATGGAGGGCTGGGGCTGGG + Intronic
1174443416 20:50574347-50574369 CCTCATGGGGAGATGGGGGTGGG - Intronic
1174730524 20:52912228-52912250 CCTTATGGAGACATGAGGAGGGG - Intergenic
1175966547 20:62662735-62662757 GCATATGGGGGGATGGGGCTGGG - Intronic
1176905543 21:14496103-14496125 GTTTGTGGAGAGAAGGGGCTGGG - Intronic
1178039722 21:28626664-28626686 GTTTATGTAGAGATGGGGCCTGG - Intergenic
1178705353 21:34868445-34868467 CCTTACAGAGAGATAGGGCGGGG - Intronic
1178826744 21:36023815-36023837 ACTTCAGGAGAGATGGGGGTAGG - Intergenic
1179509147 21:41860824-41860846 TCTTATTGTGGGATGGGGCTGGG + Intronic
1179804526 21:43828790-43828812 TTTTATGGAGAGATGGGGCATGG + Intergenic
1181018898 22:20087984-20088006 CCTGGTGGAGATGTGGGGCTCGG + Intronic
1181500944 22:23315281-23315303 CCTTACAGTGAGATGGGGGTGGG - Intronic
1182119347 22:27776674-27776696 CTTCAAGGCGAGATGGGGCTAGG - Intronic
1182709274 22:32310493-32310515 CCTTATGGCAACATGGGCCTGGG + Intergenic
1183658947 22:39207152-39207174 CCTCCTGGGGAGATGGGGCTTGG + Intergenic
1184152563 22:42647216-42647238 ACCCTTGGAGAGATGGGGCTGGG + Intronic
1184670888 22:46011865-46011887 CCCCAGGGAGGGATGGGGCTGGG + Intergenic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
950566099 3:13770553-13770575 CCCTATGGTGGGAGGGGGCTGGG - Intergenic
950733198 3:14980566-14980588 CCACATGGAAAAATGGGGCTTGG + Intronic
952321393 3:32281067-32281089 CCCCATGCAGAGATGGGGCTTGG - Intronic
952847908 3:37703897-37703919 CCTTAGTGAGTGGTGGGGCTGGG + Intronic
952857519 3:37784434-37784456 CCTGATGGAGAGATGGGGAAGGG - Intronic
953803747 3:46050105-46050127 CCTCTTGGAGAGTTGGGGGTAGG + Intergenic
954239259 3:49280749-49280771 CATTATGGAGCCATGGGGGTTGG - Exonic
954646561 3:52135248-52135270 GCTTATGGAGATCTGTGGCTAGG - Intronic
960057436 3:113285334-113285356 CCAGATGGGGAGGTGGGGCTGGG - Intronic
961888751 3:130112600-130112622 GCTGATGGAGAGAGGAGGCTAGG - Intronic
961985033 3:131122837-131122859 CCTGATGGGGAGATGGAGATGGG + Intronic
965136454 3:164777504-164777526 CCTAAGGGAGATATAGGGCTAGG + Intergenic
966607823 3:181839180-181839202 CCAAATGGGGAGATGGGGGTGGG + Intergenic
967537663 3:190625420-190625442 CATTCTGGAGCGAGGGGGCTAGG + Intronic
968259045 3:197304297-197304319 TCTTTTAGAGAGAAGGGGCTGGG + Intergenic
968642021 4:1719793-1719815 CCTCATGGAGAGGGTGGGCTGGG - Intronic
969531364 4:7732899-7732921 CCCTCTGGAGCCATGGGGCTGGG - Intronic
970709408 4:18844146-18844168 GCTTATAGAGAGGTAGGGCTGGG + Intergenic
971251048 4:24973841-24973863 CCTCATGGAGGGATTGGGTTTGG + Intronic
975181420 4:71350116-71350138 CTTGATGGAGACATGTGGCTAGG - Intronic
975590687 4:75996688-75996710 GATTAGGGAGAGATGGGCCTAGG - Intergenic
976818737 4:89180512-89180534 TTTTCTGTAGAGATGGGGCTTGG + Intergenic
977475222 4:97498955-97498977 GCTTCTTGAGAGATGGGGCAAGG - Intronic
978939721 4:114421737-114421759 CCTTAAGGGGAGCTGAGGCTGGG - Intergenic
979777674 4:124611646-124611668 TGTTGTGGAGAGATTGGGCTTGG - Intergenic
980913438 4:139013763-139013785 GCTTTGGGAGAGATGGTGCTGGG - Intergenic
980936122 4:139227416-139227438 ACTTATGGAGGGACAGGGCTAGG + Intergenic
982731153 4:158956818-158956840 AATTATGGAGAGCTGGGGCCAGG - Intronic
983098107 4:163589784-163589806 CCTGATGGGAAGTTGGGGCTTGG + Intronic
985979273 5:3448925-3448947 TGTTGTGGAGAGATGGTGCTTGG - Intergenic
987456687 5:18155955-18155977 CTTTAAGGAAAGAGGGGGCTTGG - Intergenic
994709992 5:103255455-103255477 CCTTCGGGAGAGATGTGGCAGGG + Intergenic
994860334 5:105184765-105184787 CCCTATGTAAAGATGGTGCTGGG - Intergenic
999690329 5:154140838-154140860 CCATACAGAGTGATGGGGCTGGG - Intronic
1001051038 5:168414579-168414601 GCTGACGGAGAGGTGGGGCTGGG + Exonic
1001186761 5:169581598-169581620 ACGTAAGGAGAGATGGGACTTGG - Intergenic
1002056587 5:176601341-176601363 CCTGTTGCAGAGAAGGGGCTAGG - Intronic
1002471934 5:179440577-179440599 CTTTATGGAATGGTGGGGCTGGG - Intergenic
1004049634 6:12063597-12063619 TCTTGGGGAGAGAAGGGGCTTGG + Intronic
1004067861 6:12266688-12266710 CCTGATTGAGAGTGGGGGCTAGG + Intergenic
1004068341 6:12273204-12273226 CCTGATAGAGAGTGGGGGCTAGG + Intergenic
1006506610 6:34493049-34493071 CCATATGGAGCGCTGGGGCTGGG + Intronic
1006599807 6:35217831-35217853 CCTTCTGGAAAAATGGGGGTGGG - Intronic
1006843241 6:37045077-37045099 CCTGATGCGGAGATGGGGGTAGG - Exonic
1006902351 6:37511393-37511415 CCTGATTCAGGGATGGGGCTTGG + Intergenic
1007180464 6:39925911-39925933 CCTGATGGAGAGTTGGGGAGTGG - Intronic
1007811827 6:44491752-44491774 CCTTCTCCAGAGATGGGGGTGGG - Intergenic
1008925605 6:56889020-56889042 CCTTAAGCAGACATGGGTCTAGG - Intronic
1010956287 6:82094275-82094297 ACTTAAAGAGAGATGGGGCTTGG + Intergenic
1013113569 6:107083440-107083462 TCTTTTGTAGAGATGGGGTTTGG - Intronic
1013625270 6:111930878-111930900 GCTTAAGGAGATTTGGGGCTGGG + Intergenic
1013725593 6:113091660-113091682 GCCTATGGAAAGATGGGGATGGG + Intergenic
1013935206 6:115586192-115586214 CCTCAAAGAGAGATGGGGCATGG - Intergenic
1014094001 6:117439925-117439947 CCTCAGTGAGAGATGGGACTGGG + Intronic
1016823256 6:148365652-148365674 ACTGAAGGAGAGATGGAGCTAGG + Intronic
1016875099 6:148856585-148856607 CCTCTTGAAGAGATGGGACTAGG + Intronic
1017607498 6:156149392-156149414 CCTTTAGTAGAGATGGGGGTGGG - Intergenic
1017699917 6:157058779-157058801 GCAGTTGGAGAGATGGGGCTGGG + Intronic
1020870393 7:13622115-13622137 TGTTATGGTGGGATGGGGCTGGG - Intergenic
1021636368 7:22698112-22698134 CCTGAGGGAGAGATGGGGTGGGG - Intergenic
1022476902 7:30716928-30716950 CCTTAGGTAGAGCTGGGGGTGGG - Intronic
1023317264 7:38952298-38952320 TCTTTTGGAGGAATGGGGCTGGG + Intergenic
1023590264 7:41774016-41774038 CCTATTGGAGAGTTGGGGGTGGG + Intergenic
1026360147 7:69596614-69596636 TCAGATGGAGAGATGGGGTTGGG - Intergenic
1030289357 7:107856945-107856967 CCTCATGGAGAGAAGAGGCCAGG + Intergenic
1031305649 7:120123247-120123269 TCTTATGCAGAAAAGGGGCTGGG - Intergenic
1031887287 7:127254891-127254913 ATTTATGCGGAGATGGGGCTGGG + Intergenic
1032495316 7:132357054-132357076 CCAAATGGAGAGATGGGTGTTGG + Intronic
1033366909 7:140678788-140678810 CCTAATGGAAAGAGAGGGCTGGG + Intronic
1033808550 7:144982544-144982566 CAATATGGAAAGATGGGGCAGGG - Intergenic
1034450514 7:151134831-151134853 CCAGATGCAGAGATGGGCCTAGG - Intronic
1034559468 7:151870840-151870862 ACGTTTGCAGAGATGGGGCTGGG - Intronic
1035476846 7:159149856-159149878 CCTTTTTGAGAGATGAGGCCCGG + Intergenic
1035814471 8:2524549-2524571 ACTTCTGGAGAGGTGGGGCCAGG + Intergenic
1037638194 8:20719436-20719458 CCTGAAGGTGAGCTGGGGCTGGG + Intergenic
1038239686 8:25797180-25797202 CCATATGGATAGTTTGGGCTGGG - Intergenic
1039584611 8:38695654-38695676 CTTTTTGGTTAGATGGGGCTTGG - Intergenic
1039945849 8:42128485-42128507 CCTTCTGGGGAGATGGGCCAAGG - Intergenic
1043198783 8:77335985-77336007 CCTTATTTGGAGATGGAGCTAGG - Intergenic
1045980821 8:108185299-108185321 ACTTCTGGAGAGATTTGGCTGGG + Intergenic
1048110729 8:131465377-131465399 CATTTTGTAGAGATGGGGTTTGG - Intergenic
1048865563 8:138758861-138758883 CCTTATTTAGAGATTGGGTTTGG - Intronic
1051181697 9:14418429-14418451 ACTCCTGGAGAGATGGGGGTGGG - Intergenic
1051355811 9:16239006-16239028 GCTTATGGAGAGATGGAGAAAGG + Intronic
1053549436 9:39060392-39060414 CCTTATGGTGAGAGGGAGCGGGG + Intergenic
1053645122 9:40115687-40115709 CCTTATGTAGACATGAGGCCTGG + Intergenic
1053760596 9:41347841-41347863 CCTTATGTAGACATGAGGCCTGG - Intergenic
1053813551 9:41880466-41880488 CCTTATGGTGAGAGGGAGCGGGG + Intergenic
1054539451 9:66260284-66260306 CCTTATGTAGACATGAGGCCTGG - Intergenic
1054617045 9:67306973-67306995 CCTTATGGTGAGAGGGAGCGGGG - Intergenic
1054743048 9:68827946-68827968 TGTTTTGGAGAGGTGGGGCTGGG - Intronic
1055280240 9:74665962-74665984 CTTTTTGTAGAGATGGGGTTTGG - Intronic
1055327100 9:75142201-75142223 CCTCATGGATAGATGGAGATGGG + Intronic
1055420269 9:76133053-76133075 CCTTGAGGTGTGATGGGGCTTGG - Intronic
1055591986 9:77826285-77826307 CGTTATGGGGAGTTGGGCCTGGG - Intronic
1055607014 9:77981169-77981191 CTTTATGGAGAGATAGGGAAAGG - Intronic
1055735630 9:79326643-79326665 CCTTATGGAGAAATGAGGGAAGG + Intergenic
1057607612 9:96511612-96511634 CCTTCTGGGGAGAAGGGGATGGG + Intronic
1058148704 9:101440805-101440827 ACATATGGAGAAATGGGGGTTGG - Intergenic
1059994658 9:119897058-119897080 CCTTATGGACAGAAGGGACTGGG - Intergenic
1060462426 9:123870034-123870056 TCTTATGGAGTGTTAGGGCTGGG - Intronic
1061655651 9:132087896-132087918 TCTTATGGAGAGTTGGGGGAGGG - Intergenic
1062031094 9:134362332-134362354 CCCCAGGGAGAGATGGGACTTGG - Intronic
1062032029 9:134366043-134366065 CCTTTTTGGGAGGTGGGGCTTGG + Intronic
1062548923 9:137077236-137077258 CAGGCTGGAGAGATGGGGCTGGG + Intergenic
1186964935 X:14776599-14776621 GCTCTTGGAGAGGTGGGGCTGGG - Intergenic
1188028489 X:25236670-25236692 CCTAAAGGAGAGATGGAACTTGG + Intergenic
1190559624 X:51673981-51674003 CCTTATGGACAGCTCGGGGTTGG + Intergenic
1190564667 X:51719340-51719362 CCTTATGGACAGCTCGGGGTTGG - Intergenic
1193330678 X:80232533-80232555 CCTGGTGAAGAGATGGGGTTGGG + Intergenic
1199501670 X:148513828-148513850 CCTTATGGGGTGCTGGGCCTCGG + Intronic
1199615509 X:149652215-149652237 GCTGATGGAGGGAAGGGGCTTGG - Intergenic
1199730703 X:150629368-150629390 ACTTCTTGACAGATGGGGCTTGG - Intronic
1200212733 X:154354090-154354112 CCTCACAGAGAGATGGGGCTGGG - Intronic
1200240345 X:154490107-154490129 CCTACTGGAGGGATGGGGCATGG - Intronic
1202268282 Y:23044044-23044066 CCTTACGGAGAGAAGGGCCCTGG - Intergenic
1202421274 Y:24677788-24677810 CCTTACGGAGAGAAGGGCCCTGG - Intergenic
1202449512 Y:24992294-24992316 CCTTACGGAGAGAAGGGCCCTGG + Intergenic