ID: 1129542582

View in Genome Browser
Species Human (GRCh38)
Location 15:76363033-76363055
Sequence CTGTGGCAGGCACAGTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 950
Summary {0: 1, 1: 0, 2: 17, 3: 145, 4: 787}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129542582_1129542588 1 Left 1129542582 15:76363033-76363055 CCCCAGCACTGTGCCTGCCACAG 0: 1
1: 0
2: 17
3: 145
4: 787
Right 1129542588 15:76363057-76363079 CCAGAAGACAGAACCACATACGG 0: 1
1: 0
2: 0
3: 16
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129542582 Original CRISPR CTGTGGCAGGCACAGTGCTG GGG (reversed) Intronic
900266257 1:1758862-1758884 CGGTGGCTGGCGCAGTGCTGGGG - Intronic
900351676 1:2238024-2238046 CTGTGCCAGGCGCTGGGCTGTGG + Intronic
900421247 1:2556889-2556911 CTGTGGTGAGCCCAGTGCTGGGG - Intronic
900525535 1:3126605-3126627 CTGTGGTGGGCAGAGGGCTGGGG + Intronic
900669108 1:3838803-3838825 CTGACGTAGGCACAGAGCTGAGG + Intronic
900673992 1:3872662-3872684 CCGTGGCAGGGACAGGGCCGTGG - Intronic
900765616 1:4503183-4503205 ATGGGGCAGGGAGAGTGCTGGGG + Intergenic
900955333 1:5883219-5883241 CTGTGCCAGGGCCAGAGCTGCGG + Intronic
900974365 1:6007936-6007958 CTGAGGCAGGGGCAGTGGTGGGG + Intronic
901101941 1:6725829-6725851 CTGTGAAGGGCACAGTTCTGTGG - Intergenic
901177821 1:7317472-7317494 CTGTGGCAAGCACTGTTCTATGG - Intronic
901438040 1:9261523-9261545 CTGTGCCAGGCAATGTGCAGGGG - Intronic
901850540 1:12012149-12012171 CTGAGGCGGGCCCTGTGCTGGGG + Exonic
902541433 1:17158355-17158377 ATGTGCCAGGCTCTGTGCTGGGG + Intergenic
902837962 1:19058809-19058831 CTGTGCCAGGCACGGGGATGTGG - Intergenic
903290638 1:22311942-22311964 GTGTGCCAGGCATGGTGCTGGGG - Intergenic
903315741 1:22504381-22504403 GTGTGCCAGGCAGTGTGCTGAGG + Intronic
903547579 1:24136269-24136291 ATGTGCCAGGCACTATGCTGAGG + Intronic
903553925 1:24179750-24179772 CTGTGCCAGGCCAAGTGCTAAGG - Intronic
903834406 1:26193602-26193624 GCGTGCCAGGCACTGTGCTGGGG - Intronic
903862585 1:26373831-26373853 CTGTGTCTGGCACTGTGCTAGGG + Intronic
903931989 1:26867633-26867655 ATGAGGCAGGCCCAGTCCTGAGG + Intergenic
903972269 1:27126697-27126719 ATGTGTCAGGCTCCGTGCTGAGG - Intronic
903989548 1:27256812-27256834 ATGTGCCAGGCATTGTGCTGAGG - Intronic
904006232 1:27364731-27364753 TGGAGGCAGGCACAGGGCTGGGG - Intronic
904187420 1:28716267-28716289 CTGTGGCTGTCACAGGGATGGGG + Intronic
904259461 1:29280107-29280129 CTGAGGCCGGCACAGGGCCGCGG + Exonic
904330467 1:29755077-29755099 GTGTACCAGGCACTGTGCTGTGG - Intergenic
904416209 1:30362518-30362540 GTGTGCCAGGCACTGTGCTAAGG + Intergenic
904822455 1:33255101-33255123 CTGTGCCAGGCACTGTGCTTGGG + Intergenic
905352699 1:37358601-37358623 CTGTGCCAGGCAGAGTGCCCAGG + Intergenic
905527512 1:38650067-38650089 TTATGCCAGGCACAGTGCTGGGG + Intergenic
905886490 1:41494718-41494740 CTGTGTCAGGCCCAGGGCTGGGG + Intergenic
906114948 1:43350201-43350223 TTTTGGCAGGCACTGTGCTAAGG - Intronic
906436764 1:45803365-45803387 CTGGGCCAAGCTCAGTGCTGGGG - Intronic
906674014 1:47680113-47680135 CTGTGGCTGGGGCAGTGATGGGG - Intergenic
906742879 1:48199446-48199468 ATGTGTCTGGCACTGTGCTGGGG + Intergenic
906943653 1:50277272-50277294 CTGGGGCAGGCAAAGGGCTCTGG + Intergenic
907354398 1:53860610-53860632 CTGTGCCAGGCCCTGTGCAGGGG - Intronic
907380380 1:54082465-54082487 CTGTGCTAGGCACTATGCTGGGG + Intronic
907395211 1:54184987-54185009 CTGTGCCAGGCACCATGTTGAGG + Intronic
907576106 1:55527226-55527248 CTGTGCTAGGCACTGTGCAGAGG - Intergenic
907707317 1:56844081-56844103 CTGTGCCAGGCAGTGTGCTGGGG + Intergenic
907944940 1:59127320-59127342 CAGTGCCAGGCACTGTGCTATGG + Intergenic
908766552 1:67559653-67559675 AGGTGGCAGGCACTGGGCTGAGG - Intergenic
908776811 1:67648645-67648667 CTGTGCCACGCCCTGTGCTGGGG + Intergenic
908784375 1:67720596-67720618 CTGTGCCAGGCACTGTGTTAAGG + Intronic
909321022 1:74286217-74286239 CTGGGGTAGGCATGGTGCTGGGG - Intronic
909563291 1:77028077-77028099 GTGTGGGAGGCACAGGGCAGAGG - Intronic
909571313 1:77114927-77114949 CTGAGGCAGACAGAGTGCTAGGG + Intronic
910375884 1:86569853-86569875 ATGTGCCAGTCACCGTGCTGGGG - Intronic
910443887 1:87281315-87281337 GTGTGGCAGGCACTGCGCTCAGG - Intergenic
910511100 1:88005824-88005846 CTGTGTCAGGCACCCTTCTGAGG - Intergenic
910920493 1:92341240-92341262 CTGAGGCAGGCACATTGCTTGGG - Intronic
911546875 1:99227875-99227897 CTGTGGCTGGCACTCTGCAGAGG - Intergenic
911854978 1:102865221-102865243 CTTTGGCAGGCAGAGGGCTAGGG + Intergenic
912701672 1:111882615-111882637 GTGTGGCCGGCTCAGTGCAGGGG + Intronic
913224373 1:116686062-116686084 GTGTGGCAGGCACCATGCTAAGG + Intergenic
914332712 1:146687177-146687199 ATGTGCTAGGCACAGTGTTGGGG + Intergenic
914432349 1:147630283-147630305 GTGTGGCTAGCACAGAGCTGCGG - Intronic
914913063 1:151802110-151802132 CTAGGCCAGGCACTGTGCTGAGG + Exonic
914946673 1:152072997-152073019 TTGTGGAAAGGACAGTGCTGGGG + Intergenic
914996196 1:152545479-152545501 CTGAGACTGGCACAGAGCTGGGG + Intronic
915304266 1:154968889-154968911 CTGGGGCTGCCACAGGGCTGGGG + Intronic
915445049 1:155969790-155969812 CTGTGGCAGTCACAGTGGGGGGG + Intronic
915534249 1:156525284-156525306 CGGAGGCAGGCAGAGGGCTGGGG + Intergenic
915605897 1:156950401-156950423 CTGAGGCAGGAAGATTGCTGTGG + Intronic
915928541 1:160042678-160042700 ATGTGCCAGGCACTGTGCAGGGG + Intronic
916080514 1:161229238-161229260 CTGTGGCAGCTCCAGTTCTGAGG - Exonic
916261532 1:162847148-162847170 CTGATGCAGGCACTGTGCTTGGG - Intronic
916582329 1:166120148-166120170 CTGTGCCAGGTGCTGTGCTGGGG + Intronic
916722283 1:167493476-167493498 CTGTGCCAGGCCCTGTGCTGAGG + Intronic
916743202 1:167663862-167663884 ATGTGCCAGGCACTGTGCTGGGG + Intronic
917480017 1:175403798-175403820 CTGTGCCTAGCACAGGGCTGGGG + Intronic
917667866 1:177242751-177242773 GTGTGGCAGACATGGTGCTGGGG - Intronic
919048026 1:192478196-192478218 TTGTTGTAGGCACAGTGCTTTGG + Intergenic
919120478 1:193334157-193334179 GTGTGGTAGGCTCAGTGTTGGGG + Intergenic
919885180 1:201928469-201928491 CTTTGGGAGGCCCAGTGCTTGGG - Intronic
919885796 1:201933682-201933704 CTTGGGCAGGGACAATGCTGTGG + Intronic
920033843 1:203052986-203053008 TTGTGCCAGGCACAGTGCTAAGG + Intronic
920536222 1:206738208-206738230 CTGTGTCATGCCCAGTGCTTAGG + Intergenic
920849564 1:209619378-209619400 AAGTGCCAGGCACTGTGCTGGGG - Intronic
920987738 1:210906314-210906336 TGGTGGCAGACACAGTGCCGGGG + Intronic
921222340 1:212981951-212981973 CTGAGGCAGCCTCAGTGCAGAGG - Intronic
921244329 1:213220556-213220578 CTGAGGCGGGCAGATTGCTGAGG - Intronic
921324125 1:213973703-213973725 TTGTGCTAGGCACAGTGTTGAGG + Intergenic
921345887 1:214184874-214184896 CTGCGTCAGGCACTGTTCTGGGG - Intergenic
921567086 1:216734188-216734210 CAGTGCTAGGCACAGTGCAGAGG - Intronic
921905844 1:220494672-220494694 CTGAGGCAGGCAGATTGCTTCGG - Intergenic
922307699 1:224358254-224358276 ATGGGGCAGGCACTGTGCTAGGG - Intronic
922395390 1:225195080-225195102 CTGTGGAAAGCACAGTGATTTGG + Intronic
922520766 1:226249896-226249918 CTGTGGCTGGCTGGGTGCTGTGG + Intronic
922538377 1:226400550-226400572 CTGAGGCAGTGACAGTGCTAGGG - Intronic
922657264 1:227396599-227396621 CTGTGCCCGGCCCAGTTCTGTGG + Intergenic
922706851 1:227794747-227794769 CTGTGGCTGGCTCAGGGCTGAGG + Intergenic
922823725 1:228502686-228502708 GTCTGGCAAGCACAGGGCTGTGG + Intergenic
922826889 1:228527803-228527825 CTGTGACTGGCTCTGTGCTGGGG - Intergenic
922881408 1:228983904-228983926 CTTTAACAGGTACAGTGCTGCGG + Intergenic
923497879 1:234540743-234540765 GAGTGCCAGGCACTGTGCTGGGG - Intergenic
924185191 1:241481318-241481340 CTGTGGCAGGCACTGTGCTAGGG - Intergenic
924195796 1:241605547-241605569 ATGTGCCAGGCACTGTGCAGTGG + Intronic
924300612 1:242633833-242633855 CTCTGTCAGGCACTGTGCTGAGG + Intergenic
924456008 1:244219502-244219524 CAGTGCCAGGCCCAGTGCTGGGG + Intergenic
924588878 1:245384331-245384353 ATATGCCAGGCACTGTGCTGAGG + Intronic
924624498 1:245687823-245687845 CTGCCGCTGGCACTGTGCTGAGG - Exonic
924797971 1:247306428-247306450 CTGAGGCAGGCAGATCGCTGAGG - Intronic
1063350662 10:5351846-5351868 CTGTGGGAGGCACAGGCATGAGG + Intergenic
1063369148 10:5509529-5509551 ATGTGCCAGGCGCTGTGCTGAGG + Intergenic
1064034020 10:11900967-11900989 CTGTGGCAGGCGTGGCGCTGGGG + Intergenic
1064293247 10:14054330-14054352 CTGGGAAAGTCACAGTGCTGGGG - Intronic
1064943661 10:20763100-20763122 CTGTTCCAGCCACAGTGCTTTGG - Intergenic
1065228424 10:23571297-23571319 CTTTGGCAGGCCCAGTACTGGGG - Intergenic
1066357407 10:34698341-34698363 CTGTGAAAGGGAAAGTGCTGGGG - Intronic
1066527560 10:36297728-36297750 CTGCAGCAGGCACAGTGCTGGGG + Intergenic
1067237473 10:44463097-44463119 GTGAGGCAGTCACAGAGCTGAGG - Intergenic
1067536464 10:47114193-47114215 ATGTGGCAGGGGCAGAGCTGGGG + Intergenic
1067782737 10:49220871-49220893 CTGAAGCAGGCACAGTGCCAGGG + Intergenic
1067788600 10:49271095-49271117 CTGGGGCAGGGACAGTGGTCAGG + Intergenic
1068000680 10:51330925-51330947 CTGTGGCAGGTACAGCACTGAGG + Intronic
1068000706 10:51331092-51331114 CTGTCGTAGGCATGGTGCTGGGG + Intronic
1068000767 10:51331462-51331484 CTGTGGCAGACCCAGTGTTGGGG + Intronic
1068410940 10:56653627-56653649 CTGTGGCAAGCCCAGTGTTGGGG - Intergenic
1068726083 10:60305013-60305035 CTGTGGCAGGCACAGTGGGTGGG + Intronic
1069060753 10:63892109-63892131 CAGTGCCAAGCACAGTGCTTGGG + Intergenic
1069558583 10:69413866-69413888 CTGTGCCAGGCATGGTGCTAAGG + Intronic
1069708898 10:70476748-70476770 ACGTGCCAGGCACTGTGCTGTGG + Intergenic
1069899963 10:71701602-71701624 CTGGGGCAGTCGCAGGGCTGGGG - Intronic
1070299739 10:75194551-75194573 ATGTGTCAGACACTGTGCTGGGG - Intergenic
1070781477 10:79139861-79139883 CTGTGGCTGGACCAGAGCTGAGG + Intronic
1071260044 10:83911453-83911475 CAGTGACAGGCACAGTGGAGAGG + Intergenic
1071503183 10:86217880-86217902 CTGAGGCAGGCTCTGTGGTGTGG - Intronic
1071576145 10:86728103-86728125 CTGTGTCAGGCACAGCACAGGGG + Intronic
1071685631 10:87752434-87752456 CTGTGCCAGGCACTATGCTGAGG + Exonic
1071752873 10:88501387-88501409 CTGTGGAAGGCATAGTGTTTGGG - Intronic
1072003975 10:91224397-91224419 GTGTGTCAGGCACTGTGCTGGGG + Intronic
1072020620 10:91395972-91395994 CTGAGGCAGGCCTGGTGCTGGGG - Intergenic
1072213010 10:93264115-93264137 CTGTGTCAGGCATTGTGCTATGG - Intergenic
1072421425 10:95292791-95292813 CTATGCCAAGCACTGTGCTGGGG - Intergenic
1072531605 10:96324661-96324683 CTGTGTCAGACACAGTGCTGAGG - Intronic
1072581499 10:96744013-96744035 ATGATGCAGCCACAGTGCTGTGG - Intergenic
1072668078 10:97408994-97409016 CTGTGCCAGGCACTGGGCTAAGG - Intronic
1072962806 10:99944616-99944638 ATGTGCCAGGCACTGTGCTAAGG - Intronic
1073043487 10:100622683-100622705 CTGGGGCAGGGCTAGTGCTGGGG - Intergenic
1073224163 10:101902645-101902667 CTGTTGCAGACAAAGAGCTGTGG - Intronic
1073509649 10:104035080-104035102 CCGTGGCAGGGACAGAGGTGGGG - Intronic
1073510745 10:104041007-104041029 CTGTGGCAGGACAAGGGCTGAGG + Intronic
1074003276 10:109393468-109393490 CTGTGGGTTGCACAGTTCTGTGG - Intergenic
1074204623 10:111272139-111272161 CAGAGGCAGTCACAGTGGTGGGG - Intergenic
1074445572 10:113518635-113518657 CTGAGCCAGGCCCTGTGCTGAGG + Intergenic
1074703220 10:116110271-116110293 CTGTGCCAGGCACTGGGCTATGG + Intronic
1074903391 10:117839217-117839239 CTGGGGCAGCCACGGAGCTGGGG - Intergenic
1075478165 10:122754629-122754651 ATGTGGCAGGCACAGTGACTGGG - Intergenic
1075539775 10:123302397-123302419 TTGTGCCAGGCACTGTGCTAAGG - Intergenic
1075693891 10:124419321-124419343 CTGTGGCTGGGGCAGAGCTGGGG - Intergenic
1076024529 10:127100798-127100820 CCTTGGCAGGAACAGAGCTGTGG + Intronic
1076360755 10:129887153-129887175 CTGTTGCAGGCCCAGGGCTGAGG - Intronic
1076362294 10:129897628-129897650 CTGAGGCAGGCACAGTGGGCAGG - Intronic
1076413255 10:130266444-130266466 CTGTGGCTGTGACAATGCTGGGG - Intergenic
1076811600 10:132889120-132889142 CTGTGGCCTGCAGAGTGCTGGGG - Intronic
1076845557 10:133067922-133067944 CTGTGGCCAGCACAGTGCTGGGG - Intergenic
1076848475 10:133081615-133081637 CTGGAGCAGCCACAGTGCTTGGG + Intronic
1076978660 11:193637-193659 CTGGGGCAGGTCCAGGGCTGTGG + Intronic
1077335134 11:2000079-2000101 CTCTGGCAGGCACAGAGCCCGGG - Intergenic
1077335222 11:2000485-2000507 CTCTGGCAGGCACAGAGCCCGGG - Intergenic
1077335653 11:2002725-2002747 CTCTGGCAGGCACAGAGCCTGGG - Intergenic
1077800092 11:5528343-5528365 CTGTGGGAGGCACTTTTCTGAGG + Intronic
1078006264 11:7534797-7534819 CTCTGGCAGGCATTGTGCAGTGG + Intronic
1078018022 11:7632066-7632088 CTGCTGAAGGCACAGTGTTGTGG + Intronic
1078483959 11:11704931-11704953 CTGTGGCAGGCTGTGTGCTACGG - Intergenic
1078535595 11:12170890-12170912 CTGTGCCAAGCCCTGTGCTGGGG - Intronic
1079130518 11:17744498-17744520 CTCTGGCAGGCACAGACCTGGGG + Intronic
1079131635 11:17750185-17750207 ATGTGCCAGCCACGGTGCTGGGG - Intronic
1079138691 11:17793116-17793138 CTGTGTCAGGCATGGTGCTGGGG - Intronic
1079390214 11:20015686-20015708 GTGTGCCAGGCATTGTGCTGGGG - Intronic
1079470050 11:20769537-20769559 CTGTGCCAGGCTCTGTACTGTGG - Intronic
1079621576 11:22562023-22562045 CTGTGCCAGGTACTGTGCTAAGG + Intergenic
1079755703 11:24258193-24258215 CTAAGGCAGGCACACTTCTGAGG + Intergenic
1080025484 11:27609615-27609637 CTGTGCCAGGCATTGTGCTCAGG + Intergenic
1080121486 11:28683099-28683121 CTATTGCAGGCACAGTTCTAGGG + Intergenic
1081849693 11:46266378-46266400 GTGTGCCAGGCTCAGTGCTGAGG - Intergenic
1081861134 11:46333881-46333903 CTGTGCCAGGCACAGGCTTGTGG + Intronic
1082004245 11:47410890-47410912 CTGTGCCAGGCACTGGGCTGAGG + Intronic
1083148063 11:60773287-60773309 CTGTGGGAGGCAGCGTGCTGGGG + Intronic
1083149229 11:60781454-60781476 ATGGGGCAGGCTCAGAGCTGGGG - Intergenic
1083491161 11:63015925-63015947 CACTGGCAGGGAGAGTGCTGTGG + Intergenic
1083611705 11:64007497-64007519 CTGTGGCAGGAACAGGCCGGCGG + Intronic
1083612760 11:64011967-64011989 CTGTGGTAGGGACGATGCTGGGG - Intronic
1083777813 11:64902762-64902784 CTGTGGCAGGATCAGAACTGCGG - Intronic
1084199367 11:67545166-67545188 CTGTGGCAGGCACAGCGGGCAGG - Intergenic
1084213145 11:67633104-67633126 CTGTGGAAGGGACAGAGCAGGGG + Intronic
1084445535 11:69201515-69201537 TTGTGCCAGGCACTTTGCTGGGG + Intergenic
1084938442 11:72599747-72599769 CTGGGTCAGGTTCAGTGCTGAGG + Intronic
1085319672 11:75566232-75566254 TTGTGGCAGCCAGAGAGCTGAGG + Intronic
1085411911 11:76296469-76296491 CTGTGCCCGGCCCAGTGTTGGGG + Intergenic
1085874536 11:80390075-80390097 CTGTGACAGACACTTTGCTGAGG + Intergenic
1086072039 11:82810556-82810578 CTGTGGCAGGCACTGTGTTATGG - Intergenic
1086890769 11:92255429-92255451 CTGTGGCAAGGACTGTGCTAGGG - Intergenic
1088445577 11:109923642-109923664 CTGTAGCAGGTATGGTGCTGGGG - Intergenic
1088824604 11:113483233-113483255 CTGTGTCAGGTTCTGTGCTGGGG - Intergenic
1088882774 11:113984510-113984532 CTGTGCCAGGCCCTGTGCTGGGG - Intronic
1089069227 11:115686631-115686653 CTGTGGAAGACACAATGATGTGG + Intergenic
1089455143 11:118621545-118621567 CTGTGGCTGGCCCGGGGCTGAGG - Intronic
1089582689 11:119491290-119491312 ATGTTCCAGGCACTGTGCTGAGG + Intergenic
1089672187 11:120064200-120064222 CTATGGCAGGCAGGGAGCTGGGG - Intergenic
1089787320 11:120917367-120917389 ATGTGCCAGTCACTGTGCTGGGG + Intronic
1090239409 11:125171571-125171593 CTGTGCCAGACACCGTGCTAGGG - Intronic
1090277081 11:125427849-125427871 GGGTGCCAGGCACAGGGCTGTGG + Intronic
1090410883 11:126508853-126508875 CTATGACAGGCACTGTGCTGAGG - Intronic
1090570987 11:128045233-128045255 CTAGGGCAGGCTCAGTCCTGTGG - Intergenic
1090705511 11:129332817-129332839 CTGAGGCAGGCAGATTGCTTGGG + Intergenic
1090989310 11:131801886-131801908 GTGTGGGTGGCACAGGGCTGGGG - Intronic
1090992742 11:131834428-131834450 ATGTGGTAGGCACTGTGCTGGGG + Intronic
1091284359 11:134399790-134399812 CTGTGCCAGGCTCCATGCTGTGG - Intronic
1091323971 11:134670452-134670474 CTGGGCCAGGCACAGTGCCTGGG - Intergenic
1202818117 11_KI270721v1_random:55261-55283 CTCTGGCAGGCACAGAGCCCGGG - Intergenic
1202818205 11_KI270721v1_random:55667-55689 CTCTGGCAGGCACAGAGCCCGGG - Intergenic
1202818637 11_KI270721v1_random:57907-57929 CTCTGGCAGGCACAGAGCCTGGG - Intergenic
1091690365 12:2592294-2592316 ATGTGCCAGGCACCGTTCTGAGG + Intronic
1092165872 12:6341860-6341882 GTGTGGCAGCGGCAGTGCTGGGG + Exonic
1092288608 12:7144826-7144848 CTGTGGAAGGCCCCGGGCTGTGG + Intronic
1092289751 12:7152681-7152703 ATGTGCCAGGCACTGTGCTCGGG + Intronic
1092917773 12:13203650-13203672 CTGTGCCAGGCACAGAGTGGGGG - Intronic
1094033650 12:26043081-26043103 CTGTGCCAGCCACTATGCTGAGG + Intronic
1094207430 12:27855193-27855215 CTGTTGCAGCTACAGAGCTGAGG + Intergenic
1095886378 12:47192754-47192776 GTGTAACAGGCACTGTGCTGAGG + Intronic
1095939933 12:47719607-47719629 TGGTGGCAGGCAAAGTGCGGGGG - Intronic
1096240962 12:49960195-49960217 CTGTGCCAGGCACTGTGCTAAGG + Intergenic
1096500129 12:52059745-52059767 CTGTGCCTGGCTCATTGCTGGGG + Intergenic
1096638720 12:52977392-52977414 GTGTGTCAGACACAGTGCTGGGG + Intergenic
1096639425 12:52982312-52982334 GTGTGGCAGGTACTGTGCTAAGG + Intergenic
1096995564 12:55835879-55835901 CTGAGGCAGGCACTGCCCTGTGG - Intronic
1097000925 12:55875891-55875913 ATGTAGCAGGCCCAGTTCTGAGG + Intergenic
1097636639 12:62130625-62130647 ATGTGGCAGGCACTGTGCTAGGG + Intronic
1098378385 12:69842116-69842138 ATGGGCCAGGCACAGTGCTAAGG - Intronic
1098458550 12:70704617-70704639 CTGTGGTAAGCAGAGAGCTGTGG + Intronic
1098595244 12:72266642-72266664 CAGTGCCAGGCACTGTGCTAGGG - Intronic
1100357927 12:93849451-93849473 CTGTAACAGGCAGGGTGCTGTGG + Intronic
1100493025 12:95099293-95099315 CTGTGGAAGGCAGATGGCTGTGG + Intronic
1100888043 12:99094128-99094150 ATGTGCCAGGCACTGGGCTGTGG + Intronic
1101156755 12:101935028-101935050 CTGTGCCAGGCAAACTGCTAAGG - Intronic
1101332274 12:103766659-103766681 CTGTGTCAGGCACTGGGCTAGGG - Exonic
1101519820 12:105471225-105471247 ATGTCCCAGGCACAGTTCTGGGG + Intergenic
1101836802 12:108301538-108301560 ATGTGCCAGGCACTGAGCTGGGG - Intronic
1101845228 12:108358177-108358199 ATGTGCCAGGCACTGGGCTGGGG + Intergenic
1102762582 12:115401354-115401376 CTCTGGCAGGCACTGTGCTGGGG - Intergenic
1102868182 12:116391044-116391066 CTGTGACAGAGACAATGCTGTGG + Intergenic
1102967192 12:117137227-117137249 CTGAGGCAGGCAGATTGCTTGGG + Intergenic
1103128737 12:118448095-118448117 TTGTGGCAGGAACAGTTGTGTGG + Intergenic
1103322699 12:120101194-120101216 CTAGGCCAGGCACAGAGCTGGGG + Intronic
1103444424 12:120984891-120984913 GTGAGCCAGGCACCGTGCTGAGG - Intronic
1103504528 12:121432944-121432966 ATCTGGCTGGCACACTGCTGTGG + Intronic
1103948621 12:124540390-124540412 CTGGGGCAGCCAGAGGGCTGGGG + Intronic
1103978009 12:124716320-124716342 GTGTGCCCAGCACAGTGCTGGGG + Intergenic
1104213057 12:126708839-126708861 CTGTGGCTGGGCCAGTGATGGGG - Intergenic
1104358712 12:128112140-128112162 CTGGGGCAGGCACTGCCCTGGGG - Intergenic
1104879584 12:132061271-132061293 CTGTGGCAGGGACATTGGTGAGG + Intronic
1104954703 12:132458550-132458572 CTGAGGCCAGCACAGGGCTGAGG - Intergenic
1105202774 13:18194267-18194289 CTGCGGCCGCCACAGCGCTGAGG - Intergenic
1105306411 13:19172153-19172175 CTGTGGCAGGAACCCAGCTGTGG + Intergenic
1105356307 13:19663192-19663214 CACTGCCAGGCACTGTGCTGGGG + Intronic
1105415285 13:20206593-20206615 CTGTGCCTGGCACAGCACTGGGG + Intergenic
1105719532 13:23100315-23100337 ATGTGGCAGGCACACAGCTATGG - Intergenic
1105891354 13:24684743-24684765 AAGTGGCAGCCACAATGCTGTGG + Intronic
1106136207 13:26975634-26975656 CTGCGGCAGGGACAGAGCTTTGG + Intergenic
1106137435 13:26984218-26984240 CTGTCGCAGACAAAGTGCAGTGG - Intergenic
1106593910 13:31121088-31121110 ATGTGGTTGGCACAGAGCTGGGG + Intergenic
1106920745 13:34560859-34560881 CTGTGCCAGGCACAGGGATATGG + Intergenic
1108072234 13:46640270-46640292 CTGTGGCAGGCACTGCTCTAAGG + Intronic
1108160329 13:47632318-47632340 CTGTGGTTTGCACAGTTCTGTGG - Intergenic
1108604202 13:52020969-52020991 ATGTGTCAGGCACTGTTCTGGGG + Intronic
1108945653 13:56019684-56019706 CTGGGGCCAGCCCAGTGCTGGGG + Intergenic
1110879834 13:80558202-80558224 CAGTGGCAGAGACAGAGCTGTGG - Intergenic
1111341456 13:86891548-86891570 ATGTGGTAGGCACTGTTCTGAGG - Intergenic
1111896429 13:94147957-94147979 CTGTGGCAGGGATTCTGCTGAGG + Intronic
1112110418 13:96290884-96290906 CTGTGGGAGGAACAGTGAAGAGG - Intronic
1112567828 13:100566416-100566438 TTTTGCCAGGCAGAGTGCTGAGG - Intronic
1113415588 13:110126054-110126076 CCGTCTCAGGCACTGTGCTGGGG + Intergenic
1113606646 13:111612626-111612648 GGGTGCCAGGCACATTGCTGTGG + Intronic
1113682010 13:112251131-112251153 GTGTGCCAGGCACATGGCTGGGG - Intergenic
1117717748 14:58598204-58598226 CTGTTCCAAGCACTGTGCTGAGG - Intergenic
1119347783 14:73940691-73940713 CTGTGCCAGGCACAGTGTTAAGG - Intronic
1119348012 14:73942330-73942352 CTGTGGGAGGGTCAGGGCTGCGG - Intronic
1119380401 14:74224639-74224661 CTGTGGTAGGCGCAGAGGTGAGG - Intergenic
1119552384 14:75524326-75524348 ATGTGCCAGGCATTGTGCTGGGG + Intronic
1119616041 14:76099700-76099722 ATGTGCCAGGCGCTGTGCTGAGG + Intergenic
1119877544 14:78073736-78073758 ATGTGCCAGGCCAAGTGCTGGGG + Intergenic
1120848656 14:89148858-89148880 AAGTGGCAGGCACCGTACTGGGG + Intronic
1120900310 14:89569762-89569784 CTTTGGCAGGCACGGATCTGAGG - Intronic
1121047155 14:90796451-90796473 CTGTGCCAGCCACAGGGCTCAGG - Intronic
1121438988 14:93937019-93937041 CTGTGCCAGGCACAGTGAAGTGG - Intronic
1121488735 14:94342725-94342747 GTGTGCCAGGCACAGTTCTAGGG - Intergenic
1121521908 14:94591881-94591903 CTGCCCCAGGCACTGTGCTGGGG - Intronic
1121693911 14:95897124-95897146 TTGTGCCAGGCACTGTTCTGGGG + Intergenic
1122105894 14:99454627-99454649 GTGTGCTAGGCACAGTGCTAAGG + Intronic
1122295671 14:100704412-100704434 TTGCGCCAGGCACTGTGCTGTGG - Intergenic
1202915376 14_GL000194v1_random:165736-165758 CAGTGGCAGGCAGAGTTCTGGGG - Intergenic
1124207532 15:27734490-27734512 CTATGACAGGCCCAGTGCTGGGG - Intergenic
1124352095 15:28963376-28963398 CTGTGCCCAGCACATTGCTGAGG + Intronic
1124396470 15:29306189-29306211 CTGTGGGAGGCGCAGGGCTCAGG + Intronic
1124504877 15:30264083-30264105 CAGTGCCAGGCCCTGTGCTGAGG + Intergenic
1124619048 15:31263871-31263893 ATGTGGCTGGCACACAGCTGAGG - Intergenic
1124738675 15:32274552-32274574 CAGTGCCAGGCCCTGTGCTGAGG - Intergenic
1124848988 15:33317596-33317618 CTGTAGCAGGATCAGGGCTGAGG - Intronic
1125252540 15:37721947-37721969 ATTTGCCAGGCACAGTGCTGAGG - Intergenic
1125328583 15:38561923-38561945 CTATGGCAGGTACCGTGCTGGGG + Intronic
1125980544 15:43996316-43996338 CTGGGACAGGCCCAGTGTTGAGG + Intronic
1126070334 15:44860370-44860392 ATGTGCCAGGCACTGGGCTGAGG - Intergenic
1126087701 15:45024747-45024769 ATGTGCCAGGCACTGGGCTGAGG + Intronic
1126135197 15:45383076-45383098 CTGTGTCAGGCACTGTGCTAGGG - Intronic
1126376878 15:48005876-48005898 GTGTGCCAGGCACTGTGCTAGGG - Intergenic
1128080718 15:64855365-64855387 CTGGGGGAGGCCCAGGGCTGAGG + Intronic
1128183681 15:65626122-65626144 CTCTGCCAGGCACTGTGCTGGGG + Intronic
1128272982 15:66327826-66327848 CTGAGGCAGGCACATCACTGAGG + Intronic
1128825139 15:70708262-70708284 CTGTGGCAGGAGCAGAGGTGGGG + Intronic
1129542582 15:76363033-76363055 CTGTGGCAGGCACAGTGCTGGGG - Intronic
1129683092 15:77669321-77669343 CTGTGGGAGGCAAAGGGATGGGG - Intronic
1129691926 15:77718750-77718772 CTGGGGCAGGCACAGAGCCCAGG - Intronic
1129937667 15:79464114-79464136 CTGTGGGAGGTACAGTGTGGTGG + Intronic
1130275178 15:82472664-82472686 GTGTGGCCGGCACTGCGCTGGGG + Intergenic
1130467537 15:84200059-84200081 GTGTGGCCGGCACTGCGCTGGGG + Intergenic
1130496728 15:84473483-84473505 GTGTGGCCGGCACTGCGCTGGGG - Intergenic
1130519149 15:84649032-84649054 CTGTGTCAGGCGCAGTGTTTAGG + Intronic
1130589829 15:85204657-85204679 GTGTGGCCGGCACTGCGCTGGGG + Intergenic
1130937517 15:88482796-88482818 GGGTGGCGTGCACAGTGCTGGGG + Intergenic
1131122586 15:89831790-89831812 ATGTGGCAGGCACAGGGCCATGG + Exonic
1131224000 15:90608701-90608723 CTGTGCCGGGCACTGTGCTAGGG - Intronic
1131399216 15:92111101-92111123 CTGTGGGAAGCACAGTGGTGGGG - Intronic
1131794501 15:96001051-96001073 CTGTGCCAGGCACTGTGCTGGGG + Intergenic
1132110484 15:99099154-99099176 CTGGGCCAGGCACAGTGGTGTGG - Intronic
1132176147 15:99716760-99716782 CTGTTGCATGCACAGTGCTGTGG + Intronic
1132299379 15:100766841-100766863 CTCAGACAGGCACAGGGCTGGGG + Intergenic
1132531250 16:450956-450978 CGATGGCAGGCAGAGCGCTGCGG - Intronic
1132532989 16:462765-462787 CTGGGGAAGGGACGGTGCTGGGG - Intronic
1132533001 16:462799-462821 CTGGGGAAGGGACGGTGCTGGGG - Intronic
1132761728 16:1511801-1511823 ATGTGCCAGGCGCTGTGCTGGGG + Intronic
1133472070 16:6085069-6085091 CTGTCTCAGGCAGAGTGCTGGGG + Intronic
1133587204 16:7207488-7207510 ATGTAGCAGGCACTGTGCTAGGG - Intronic
1134907421 16:17992486-17992508 TTGTGCCAGGCACTGTGCTCAGG - Intergenic
1135119208 16:19750966-19750988 CTGTGGCAGGTACGGTGATGAGG + Intronic
1135255546 16:20938990-20939012 CTGAGGCAGGCAGATTGCTCAGG - Intronic
1135824732 16:25716665-25716687 CTGTTCCAGGCATCGTGCTGAGG + Intronic
1136008921 16:27349693-27349715 ATGTGCCAGGCACATTGCTCAGG + Intronic
1136612788 16:31377438-31377460 GTGTGCCAGGCAGGGTGCTGTGG + Intronic
1137308412 16:47229075-47229097 ATGTGTCAGGCACTGTGCTGGGG + Intronic
1137522628 16:49208085-49208107 TTGTGCCAGGCACTGTGCTGAGG + Intergenic
1137606526 16:49790370-49790392 CTGAGCCAGGCACTGTGCTGGGG + Intronic
1138064226 16:53923886-53923908 CAGTGGCAGGCAGGCTGCTGTGG + Intronic
1138375827 16:56563375-56563397 CTGTGGCAGGCACTGGGGAGGGG - Intergenic
1138607570 16:58098746-58098768 CTGTGCCAGGCACTGTCCTGGGG + Intergenic
1138834155 16:60412925-60412947 CAGTGGCAGCAACAGTGCTTGGG + Intergenic
1138834215 16:60413516-60413538 CTGTGGCAGGCACCATTCTGAGG - Intergenic
1139349832 16:66327976-66327998 GGGTGGCAGGCACTGGGCTGGGG + Intergenic
1139460102 16:67115193-67115215 CTGTGCCAGGCACAGTGATTGGG + Intronic
1139478927 16:67217614-67217636 CTGAGGAAGGCACAGGGCTGGGG - Intronic
1139682396 16:68575163-68575185 CTGTGGCAGGCCCAGGGCCAAGG - Intronic
1140000902 16:71024064-71024086 ATGTGCTAGGCACAGTGTTGGGG - Intronic
1140133994 16:72189097-72189119 ATGTGCCAGGCACCGTGCTATGG + Intergenic
1140780756 16:78294268-78294290 CTGTGCCAAGCCCAGTGCCGGGG + Intronic
1140967502 16:79981166-79981188 CTGCGCCAGGCTCTGTGCTGGGG + Intergenic
1141159369 16:81618825-81618847 ACGTGCCAGGCACCGTGCTGAGG + Intronic
1141339769 16:83192301-83192323 GTGTGTCAGGGACTGTGCTGTGG + Intronic
1141690330 16:85593131-85593153 CTGGGTCAGTCACAGAGCTGGGG + Intergenic
1141782756 16:86175056-86175078 CTGAGCCAGGAACAGTGCTGAGG - Intergenic
1141855710 16:86680124-86680146 CTGTGGCAGGCACTATTTTGGGG - Intergenic
1142179952 16:88663517-88663539 CTGTGTGAGGCGCTGTGCTGGGG + Intergenic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1142466088 17:138128-138150 CTGGGGCAGGTCCAGGGCTGTGG + Intronic
1142767001 17:2070454-2070476 CAGATGCAGGCACAGGGCTGGGG + Intronic
1142882023 17:2889352-2889374 CAGTGCCAGGCCCTGTGCTGGGG + Intronic
1142931248 17:3285638-3285660 ATTTGTCAGGCACAGTGGTGCGG + Intergenic
1143425748 17:6835987-6836009 ATGTGCCAGGCACTGTGCTTGGG + Intergenic
1143472776 17:7186269-7186291 ATGCGTCAGGCACTGTGCTGAGG + Intergenic
1143865202 17:9918306-9918328 CTCCGCCACGCACAGTGCTGAGG + Intronic
1143974665 17:10821082-10821104 CTGTGCCAGACCCTGTGCTGGGG - Intergenic
1144112659 17:12051393-12051415 CTGTATCAGGCACAGAGCTAAGG + Intronic
1144156667 17:12510927-12510949 CTGTGCCAGGTACAATGCTGAGG + Intergenic
1144662937 17:17083035-17083057 CTGTGGCAGGCATGGTGCTGAGG + Intronic
1144749018 17:17635359-17635381 ATGTGTCAGGCACGGGGCTGGGG + Intergenic
1145011825 17:19372610-19372632 CTGTGACAGGCACCGAGATGGGG - Intronic
1145889979 17:28407478-28407500 ACGTGCCAGGCACTGTGCTGGGG + Intergenic
1146133290 17:30296668-30296690 CTGAGGCAGGCAGAATGCTCAGG + Intergenic
1146519289 17:33513997-33514019 CTGTGCCAGACACACTGCTGGGG + Intronic
1146635188 17:34498840-34498862 TTGTGCCAGGCATTGTGCTGTGG - Intergenic
1146691104 17:34876759-34876781 CTTTGGCAGGGGCATTGCTGTGG - Intergenic
1146845589 17:36179686-36179708 CAGTGGCAGGCAGAGAGATGAGG + Intronic
1146873806 17:36391527-36391549 CAGTGGCAGGCAGAGAGATGAGG + Intronic
1146881163 17:36442617-36442639 CAGTGGCAGGCAGAGAGATGAGG + Intergenic
1146892649 17:36515991-36516013 CTGTGGCAGAAACAGCCCTGTGG + Intronic
1147041201 17:37720684-37720706 ATGTGCCAGGCACAGGGCTATGG + Intronic
1147065584 17:37921344-37921366 CAGTGGCAGGCAGAGAGATGAGG - Intergenic
1147452101 17:40512156-40512178 CTGTGCCAGGAACCGAGCTGAGG + Intergenic
1147542055 17:41368600-41368622 GAGTGTTAGGCACAGTGCTGGGG - Intronic
1147988065 17:44317912-44317934 CTGTGCCAGGCACCGTGCTGGGG - Intronic
1148750102 17:49940690-49940712 GTGTGCCAGGCACTGTGCTGAGG + Intergenic
1148836531 17:50468722-50468744 CTGTGGCAGTGGCAGTTCTGGGG + Exonic
1149234996 17:54578847-54578869 TTGTGGGAGGCACAGTGCTGTGG + Intergenic
1149451129 17:56750857-56750879 CTGGGGCAGGCACAGGGCTTTGG + Intergenic
1149451340 17:56752207-56752229 CTGTGAGAGACACAGAGCTGTGG + Intergenic
1149785523 17:59431480-59431502 ATGTGGAAGGCACTGTGCTCAGG - Intergenic
1150716140 17:67574094-67574116 ATGTGCCAGTCACTGTGCTGGGG + Intronic
1151331404 17:73411367-73411389 TTGTGGCAAGCACAGTGCAGAGG + Intronic
1151417054 17:73973421-73973443 CTGTGTCAGGGACAGAGCTGGGG - Intergenic
1151477149 17:74350604-74350626 CTGTCCCAGGCACAGGGGTGGGG - Intronic
1151675954 17:75597529-75597551 CTGTGCCAGGAACTGTGCTAAGG + Intergenic
1152031840 17:77847576-77847598 CTGTGGCAGGAACAGGGGAGTGG - Intergenic
1152036979 17:77879657-77879679 CTGTGCCAGGCACAGGCCAGGGG + Intergenic
1152076168 17:78161262-78161284 CGGTGGGGGGCACAGGGCTGAGG + Intronic
1152204118 17:78964952-78964974 CACTGGCAGGCAGGGTGCTGTGG + Intergenic
1152323625 17:79623071-79623093 CTGGGGCAGTAACAGGGCTGGGG - Intergenic
1152625098 17:81384382-81384404 GTGGGGCAGGGACAGGGCTGAGG + Intergenic
1152656553 17:81522541-81522563 GTGTGCCAGGAACCGTGCTGGGG - Intronic
1152782909 17:82234301-82234323 CTGTCCCAGGCACTGTGGTGGGG + Exonic
1152783217 17:82235551-82235573 CTGGGGCGAGCTCAGTGCTGGGG + Exonic
1152998584 18:431861-431883 ATGTGCCAGGCACTGTGCTAAGG + Intronic
1153311398 18:3680344-3680366 CAGTGGCAGCCACAGGCCTGAGG + Intronic
1153675291 18:7451715-7451737 CTCTGGCAGGTGCTGTGCTGTGG + Intergenic
1154170258 18:12046333-12046355 CCATGGCAGGGGCAGTGCTGCGG - Intergenic
1154170599 18:12047818-12047840 CGGTGGCAGGCAGGGTGGTGGGG - Intergenic
1155038073 18:22042114-22042136 CTGTGCCAAGCACTGTGCTAGGG - Intergenic
1155095421 18:22550600-22550622 CTGTCCCAGGCACTGTGCTGAGG - Intergenic
1155847730 18:30730925-30730947 CTGTGGGTTGCACAGTTCTGCGG - Intergenic
1155960511 18:31991023-31991045 CTGTGACATGCACAGGGTTGAGG - Intergenic
1156046319 18:32881446-32881468 ATCTGGCAGGGACAGAGCTGGGG - Intergenic
1156763504 18:40622628-40622650 CTGTGGCAGACAAAGAGTTGTGG - Intergenic
1157699885 18:49755538-49755560 ATGTGCCAGGCATTGTGCTGGGG + Intergenic
1158397356 18:57089689-57089711 CTTTGGGAAGCACAGTGATGGGG - Intergenic
1158591318 18:58781178-58781200 CTGGGCCAGGCACAGTGCCTGGG - Intergenic
1160060622 18:75526033-75526055 ATGTGTCAGGCACTGTGCTGGGG + Intergenic
1160165278 18:76506403-76506425 CAGGGGCAGGCATAGCGCTGTGG - Intergenic
1161088345 19:2345230-2345252 CTGGGGGAGGCACAGGGCGGAGG - Intronic
1161563490 19:4986570-4986592 CTGTGCCAGGCCAGGTGCTGAGG + Intronic
1162113283 19:8413081-8413103 CTGGGGCGGGGCCAGTGCTGGGG + Intronic
1162381727 19:10335382-10335404 CTGGGGAAGGCACAGTCCTGGGG - Intronic
1162567165 19:11450877-11450899 GGGTGGCAGGGACAGGGCTGGGG - Exonic
1162732635 19:12728171-12728193 GGGTGGAAGGCACAGGGCTGTGG - Intergenic
1163166978 19:15505281-15505303 CTGTGGCAGGCTGAGGGCTCTGG + Intergenic
1164523992 19:29000254-29000276 CTGAGGCAGGCTCAGAGCTGTGG + Intergenic
1164593055 19:29516710-29516732 CTGCAGTAGGCACAGTACTGGGG - Intergenic
1164714446 19:30381266-30381288 ATGTGCCAGGCACTGTGCTGGGG + Intronic
1164761059 19:30728593-30728615 ATATGGGAGGCCCAGTGCTGGGG + Intergenic
1164811666 19:31162198-31162220 GTGGGCCAGGCACTGTGCTGGGG - Intergenic
1164816936 19:31211525-31211547 CTGGGGCAGGGGCAGTGGTGAGG + Intergenic
1165086147 19:33348890-33348912 CAGCACCAGGCACAGTGCTGCGG - Intergenic
1165259327 19:34598743-34598765 CTGTGGCTGAGACAGGGCTGGGG + Intronic
1165527782 19:36370610-36370632 CTCTGGCTGGTGCAGTGCTGGGG - Intronic
1165721678 19:38083273-38083295 CTGTGTCAGACACAGGGCTGAGG - Intronic
1165856212 19:38880577-38880599 CTGAGGAATGCAAAGTGCTGGGG + Intronic
1166183360 19:41123905-41123927 CCCTGGCAGGCACATGGCTGGGG - Intronic
1166229961 19:41420979-41421001 CTGTGCTGGGCACAGTGCTGAGG - Intronic
1166730190 19:45054848-45054870 CTGTGCCAGGCTCGGTGCTGGGG - Intronic
1166743150 19:45126244-45126266 ATGTGGCAGGCACAGAGTGGTGG + Intronic
1166752747 19:45172482-45172504 CTGTGCCAGGCCCAGGGGTGTGG + Intronic
1166756632 19:45196475-45196497 CCTTGGCAGGCTCAGTGCTGTGG - Intronic
1166950044 19:46421149-46421171 CTGTGACAGGAGGAGTGCTGTGG + Intergenic
1166981323 19:46633968-46633990 CTGAGGCACGCACAGAGCTTGGG - Intergenic
1167015713 19:46839691-46839713 CTGTGCCTGGCCCTGTGCTGGGG + Intronic
1167385637 19:49161572-49161594 CTTTGGCAGGCAGAGTGAGGTGG - Intronic
1167501802 19:49852251-49852273 GTGTGGATGGCACAGAGCTGTGG + Intronic
1167739740 19:51317260-51317282 ATGTGGCAGGCACCGGCCTGTGG - Intronic
1168485065 19:56754467-56754489 ATGTGTTAGGCACAGTGCTAGGG + Intergenic
925148635 2:1599893-1599915 GTGTGGCATGCACAGAGCTGCGG - Intergenic
925293174 2:2761917-2761939 CTGTGTCAGGCACTGTACTAGGG - Intergenic
925976111 2:9143254-9143276 GTGTGCCAGGCCCTGTGCTGGGG + Intergenic
926117097 2:10220263-10220285 CTGTGGCCGCCAACGTGCTGGGG + Intergenic
926692956 2:15749834-15749856 CAGTGGCAGGCACATTGGAGGGG - Intergenic
926710071 2:15872175-15872197 ATGTGGCAGGTTCTGTGCTGAGG + Intergenic
927154474 2:20213595-20213617 CTGGGGGAGGGACAGTGCTTTGG - Intronic
927475452 2:23411085-23411107 CTGTGCCAGGCACAGTGGCATGG + Intronic
927693586 2:25225007-25225029 CTGTGACAGGCCGAGTGCAGTGG - Intergenic
927714445 2:25342584-25342606 CTGAGGCAGGCAGAGCGCAGTGG - Exonic
928305562 2:30167636-30167658 CTCTCCCAGGCACAGAGCTGTGG + Intergenic
928389652 2:30899304-30899326 CTGGGTCAGCCACAGTGCTGGGG - Intergenic
929158120 2:38806201-38806223 CAGTGGCAGGCTGAGAGCTGAGG + Intronic
930182969 2:48383257-48383279 GTGTGGAAGGGACAGTGATGCGG + Intergenic
930203051 2:48562836-48562858 CTGTGCTGGACACAGTGCTGGGG - Intronic
931744412 2:65279682-65279704 CTGAGGCAGGCAGATTACTGAGG - Intergenic
932432590 2:71684887-71684909 CTGTGGCTGGGACTGTGCTTAGG + Intronic
932469547 2:71944936-71944958 CTGTGATAGGCACTGTGCTAGGG - Intergenic
933487507 2:82941548-82941570 TTGTGCCAGGCACAGTACTAGGG + Intergenic
934894274 2:98100410-98100432 CTGTGGCTGATACAGTGTTGGGG + Intronic
935091075 2:99895607-99895629 CTGTGGCTGGCACGGTGGTGAGG - Intronic
935280990 2:101517614-101517636 CTGTGGTAGGCTCAGTGCCTAGG - Intergenic
935863514 2:107360163-107360185 CTGAGCCAGGCACGGTGCTGTGG - Intergenic
936116860 2:109709640-109709662 TTGTGCCAGGCACAGTGCCAAGG - Intergenic
936142008 2:109948593-109948615 CTGTGCCAGGCACTGTGCCAGGG - Intergenic
936178696 2:110246541-110246563 CTGTGCCAGGCACTGTGCCAGGG - Intergenic
936202682 2:110422891-110422913 CTGTGCCAGGCACTGTGCCAGGG + Intronic
936450366 2:112629347-112629369 CTGTGCCTGGCTCAGAGCTGAGG - Intergenic
937201552 2:120207347-120207369 CTGTGTTAGGCGCAGTGCAGGGG + Intergenic
937923830 2:127152510-127152532 CTGTGGCTGGCACAGAACTGAGG + Intergenic
937957091 2:127427575-127427597 CTGTGGGAGGCACAGCCCTGAGG - Intronic
938462049 2:131503916-131503938 CTGAGGCAGGAAGATTGCTGAGG - Intergenic
938702504 2:133892276-133892298 GTGTGCCAGGAACAGTGCTAAGG - Intergenic
938772529 2:134512620-134512642 TTGTGCCAGGCACTGTTCTGGGG + Intronic
938876267 2:135533917-135533939 CTGTGTCAGGCACAATGCTAGGG - Intronic
938986695 2:136583479-136583501 CTGTGCCAGGCACTGGGCTGTGG + Intergenic
940170643 2:150826318-150826340 CTGAGGCAGGCAAACTCCTGAGG + Intergenic
940270858 2:151888524-151888546 GTGTTTCAGGCAGAGTGCTGTGG - Intronic
942567534 2:177281614-177281636 CTGTGTCAGCCACAGCTCTGCGG - Intronic
942881555 2:180868118-180868140 CTGCAGCAGGCACAGCTCTGAGG + Intergenic
942924004 2:181411081-181411103 CTGTGGGCTGCACAGTTCTGTGG - Intergenic
944678448 2:202053850-202053872 ATGTGCCAGGCTCTGTGCTGGGG - Intergenic
944973009 2:205015779-205015801 GTGTGCCAGGCAAGGTGCTGAGG - Intronic
945056347 2:205872710-205872732 CTGTGCCAGGGTCAGGGCTGTGG + Intergenic
945618239 2:212100577-212100599 CTGTGCCAAGAACAGTGCTAAGG + Intronic
946148126 2:217746178-217746200 ATGTGCCAGGCACTGTCCTGTGG - Intronic
946200307 2:218067696-218067718 CAGTGGCAGGGACAGGGATGGGG - Intronic
946339124 2:219057162-219057184 CTGTGGCAGGCTCTGGACTGTGG + Intronic
946729150 2:222691692-222691714 CTTGGGCAGGCACAGTGGAGAGG - Intronic
946921050 2:224582822-224582844 ATGTGCCAGGCACTGTTCTGGGG - Intronic
947159476 2:227197778-227197800 CTGTGCCAGGCATGGTGGTGAGG + Intronic
947375323 2:229489591-229489613 CTGGTGCAGGCAAAGTGCTGAGG + Intronic
947709186 2:232301082-232301104 ATGTGTTAGGCACAGTACTGGGG + Intronic
947952675 2:234161575-234161597 CTGTCGTAGGCACTCTGCTGGGG + Intergenic
947973422 2:234343946-234343968 CTGTGGCAGGCCCACTGGAGCGG + Intergenic
948240584 2:236429743-236429765 CTGTGGCAGGAGCAGTCATGTGG + Intronic
948650927 2:239443269-239443291 CTGTGGAAGGCAGAGAGCTGGGG - Intergenic
948784672 2:240346167-240346189 CTGAGGCAGGCACAGAGCCCCGG + Intergenic
948795810 2:240401591-240401613 CTGTGAGATGCACAGGGCTGTGG - Intergenic
948859758 2:240747080-240747102 ATGGGGCAGGCTCAGTGCTCTGG + Intronic
948884756 2:240877108-240877130 CTGAGGCAGGAGCAGTGCTGCGG + Intronic
949035463 2:241814006-241814028 CTGTGGCTTCCACGGTGCTGTGG + Intronic
1168827070 20:821265-821287 CAGTGTCAGGCCCAGAGCTGTGG + Intergenic
1168854437 20:998756-998778 CTGTGCCAGGCTCTGTGTTGGGG - Intronic
1168966853 20:1903969-1903991 GTGTGTCAGGCCCTGTGCTGAGG - Intronic
1168986869 20:2056490-2056512 CTGTGCCAGGCACTGTACTAAGG + Intergenic
1169252647 20:4072217-4072239 CTCTGGCAGGGGCAGTGGTGAGG + Intronic
1169391501 20:5194880-5194902 ATGTGCCAGGCATAGTGCTAAGG + Exonic
1169609280 20:7361176-7361198 GTGTGGCAGGTATTGTGCTGAGG + Intergenic
1170591104 20:17772667-17772689 CTGAGGCAGGCACTTTGCTGGGG - Intergenic
1170907734 20:20530860-20530882 CTCTGCCAGGCGCTGTGCTGAGG - Intronic
1171130940 20:22652506-22652528 CGGTGCCTGTCACAGTGCTGGGG + Intergenic
1171240502 20:23563619-23563641 CTGTGGTAGGTGCAGTGTTGAGG + Intergenic
1171992228 20:31705531-31705553 GTGTGTTAGGCACTGTGCTGGGG - Intronic
1172125228 20:32621616-32621638 CTGTGCCAGGCATGGTGCTAGGG + Intergenic
1172145527 20:32755200-32755222 CTGTGCCAGGCACTGTGGTAAGG - Intergenic
1172227561 20:33315243-33315265 ATGTGCCAGGCACCATGCTGAGG - Intergenic
1172287847 20:33753503-33753525 GTGTGCCAGACACTGTGCTGGGG + Intronic
1172613152 20:36266505-36266527 CTGTGTCAGGCCCAGGGCTGAGG - Intronic
1172848528 20:37944510-37944532 CTGGGGCAGGGACCATGCTGGGG + Exonic
1173025751 20:39305889-39305911 ATGTGCCAGGTACTGTGCTGGGG + Intergenic
1173351422 20:42248923-42248945 ATGTGCCAGGCACTGTGCTAAGG + Intronic
1173723900 20:45283601-45283623 CTGTGGCTGGCAGAGAGGTGCGG - Intergenic
1174039685 20:47690098-47690120 CTCTGGCAGGCAGAGTGCTGAGG + Intronic
1174060259 20:47827355-47827377 CTGTGCCAGGCACTGCGCTCAGG - Intergenic
1174071638 20:47904015-47904037 CTGTGCCAGGCACTGCGCTCAGG + Intergenic
1174152411 20:48494620-48494642 CTGTGCCAGGCACTGCGCTCAGG - Intergenic
1174224470 20:48985736-48985758 GTGTGCCAGGCACTGTGCTAAGG + Intronic
1174309110 20:49636606-49636628 CTATGCCAGGCTGAGTGCTGTGG + Intronic
1174395333 20:50243516-50243538 CTGGGGAAGGCACAGAGCAGTGG - Intergenic
1174523511 20:51153529-51153551 ATGTGCCAAGCACTGTGCTGAGG + Intergenic
1174536724 20:51257063-51257085 GTGAGGCAGGCACAGTCTTGTGG - Intergenic
1174570574 20:51498350-51498372 ATGTGACAGGCACTGTGCTTGGG + Intronic
1174929962 20:54802762-54802784 ATGTGCCAGGCATTGTGCTGGGG - Intergenic
1175072806 20:56348697-56348719 CAATGCCAGGCACAATGCTGGGG - Intergenic
1175111621 20:56652573-56652595 CTGAGGCAGGAAAATTGCTGAGG - Intergenic
1175161978 20:57015281-57015303 ATGTGCCAGGCACAGTGCCAAGG + Intergenic
1175291199 20:57876654-57876676 CTGTGCCAGATACAGTTCTGAGG - Intergenic
1175361742 20:58416891-58416913 CTATGCCAGCCACAGTGCTGGGG + Intronic
1175415361 20:58797266-58797288 GAGTGCCAGGCACAGTGCTGGGG - Intergenic
1175640720 20:60628030-60628052 ATGTGCCAGGCACTGTGCTAAGG - Intergenic
1175741793 20:61425044-61425066 CTATGCCTGGCACAGAGCTGGGG - Intronic
1175832617 20:61974521-61974543 CGGCGGGAGGCCCAGTGCTGGGG - Intronic
1175974849 20:62705655-62705677 CTGGGGCAGCCAGTGTGCTGGGG - Intergenic
1176023234 20:62973134-62973156 CTGGGCGAGGCACAGGGCTGTGG + Intergenic
1176634726 21:9180380-9180402 CAGTGGCAGGCAGAGTTCTGGGG - Intergenic
1176715180 21:10343738-10343760 CTGCGGCCGCCACAGCGCTGAGG + Intergenic
1178512286 21:33215614-33215636 CTGTGGCTGCCACAGTCCTGTGG - Intergenic
1178512287 21:33215622-33215644 CTGTGGCAGCCACAGAGCCCTGG + Intergenic
1178950646 21:36982741-36982763 CTCTGGCAGGCCAAGTGCAGTGG + Intronic
1179160065 21:38887698-38887720 CTGTGGGAGGGACATTGCGGGGG + Intergenic
1179524005 21:41963959-41963981 CTGGAGCAGGCACAGTGCCATGG - Intergenic
1179622673 21:42627658-42627680 CTGCGGAAGTCACAGTGCAGAGG + Intergenic
1179641122 21:42747715-42747737 CTCTGCCTGGCACAGTGCTGGGG - Intronic
1179836585 21:44038527-44038549 CTGTGGCGGCCACAGGGCTGAGG - Intronic
1179966605 21:44810466-44810488 CCGTGGGAGGCACAGGGTTGTGG - Intronic
1180603169 22:17036217-17036239 CTGCGGCCGCCACAGCGCTGAGG - Intergenic
1180699995 22:17776040-17776062 CAGTGGCCCCCACAGTGCTGAGG - Intergenic
1180978723 22:19868589-19868611 ATGTGGCAGGTACCATGCTGGGG + Intergenic
1181407918 22:22697894-22697916 CTGGGGCAGGGCCAGTGCTGGGG + Intergenic
1181415909 22:22758684-22758706 TGGGGGCAGGCCCAGTGCTGGGG + Intronic
1181420204 22:22792476-22792498 TGGGGGCAGGCCCAGTGCTGGGG + Intronic
1181424245 22:22822764-22822786 TGGGGGCAGGCCCAGTGCTGGGG + Intronic
1181428034 22:22856533-22856555 TGGGGGCAGGCCCAGTGCTGGGG + Intronic
1181724717 22:24803948-24803970 ATGTGGCAGGCACTGCGCTAAGG - Intergenic
1181769401 22:25114351-25114373 GTGTGCCTGGCACTGTGCTGGGG - Intronic
1182007961 22:26977227-26977249 CTGTGCCAGGCACTGTGATAAGG - Intergenic
1182114337 22:27746694-27746716 CTGTGCCTGGCACTGTGCTCAGG + Intergenic
1182345387 22:29660186-29660208 CCGTCGCAGGTTCAGTGCTGTGG + Intronic
1183099461 22:35575001-35575023 CTCAGGCAGGCGCAGAGCTGGGG + Intergenic
1183247962 22:36708606-36708628 CTGTGTCAGGCCCTGTGCTGAGG + Intergenic
1183251979 22:36736844-36736866 TGGTGCCAGGCACTGTGCTGGGG - Intergenic
1183370574 22:37429462-37429484 GAGTGGCCGGCACTGTGCTGGGG - Intergenic
1183516739 22:38271261-38271283 ATGTGCCAGGCACTATGCTGGGG - Intronic
1183971184 22:41478736-41478758 ATGTGGCAGGGACAGGGCGGGGG - Intronic
1184101847 22:42344892-42344914 CCGTGGCAGGCACAGGGCACCGG + Intergenic
1184107696 22:42377906-42377928 ATGTGTCAAGCCCAGTGCTGTGG - Intergenic
1184377492 22:44123902-44123924 CTGTGCCAGGCACTGTGCCAGGG - Intronic
1184438131 22:44492485-44492507 GTCTAGCAGACACAGTGCTGTGG + Intergenic
1184849553 22:47112489-47112511 CTCTGCCAAGCACAGAGCTGGGG - Intronic
1184858358 22:47158714-47158736 CTGTGGAAGGGACAGGGCAGCGG + Intronic
1184877146 22:47283097-47283119 CCCTGCCAGGCACAGTTCTGGGG - Intergenic
1184959742 22:47920391-47920413 GTGTGGAAGGCACAGGCCTGTGG + Intergenic
1185113966 22:48920632-48920654 CTGTGGAAGGAAGAGTGCAGGGG + Intergenic
949202790 3:1399764-1399786 ATGTGCCAGGCACTGTGCTAGGG + Intronic
949541692 3:5037482-5037504 CTGTGCCAGGCACTATGCTCAGG - Intergenic
949641948 3:6046423-6046445 CTGTGGCAGGCCCAGTTGTTGGG - Intergenic
949706512 3:6824223-6824245 CTGAGCCTGGCACAGGGCTGTGG + Intronic
949838415 3:8293821-8293843 CTGTGCCAGGCATTGTTCTGGGG - Intergenic
950097747 3:10339642-10339664 CTGGGGCAGGCACAGCACTGAGG + Intronic
950141356 3:10618322-10618344 ATGTGCCAGGCACAGTACTAAGG - Intronic
950151885 3:10693921-10693943 CTGTTGCAGGCACCATGCAGTGG + Intronic
950436568 3:12983803-12983825 TTGTGCCAGGCGCCGTGCTGAGG - Intronic
950573287 3:13815316-13815338 CAAGGGCAGGCACAGTCCTGAGG - Intergenic
950667094 3:14504061-14504083 CAGTGACAGGGACAGAGCTGGGG + Intronic
950738751 3:15032779-15032801 CTGTGCATAGCACAGTGCTGGGG - Intronic
950769948 3:15303347-15303369 GTGTGGCAGGCTCTGGGCTGGGG - Intronic
950853365 3:16083448-16083470 CTGTGGCATGCAAAGGTCTGAGG - Intergenic
950914884 3:16634295-16634317 GTGTGCCAGGCACTGTGCTAAGG - Intronic
951044582 3:18023993-18024015 CTGTGTCAGCAACAGTGCTCTGG + Intronic
951978173 3:28537667-28537689 CTCTGGGTGGCACAGTTCTGAGG - Intronic
952205877 3:31181290-31181312 ATGGGGCAGGGACAGTGGTGAGG - Intergenic
952206682 3:31187363-31187385 GTATGCCAGGCACTGTGCTGAGG + Intergenic
952333130 3:32383012-32383034 ATGTGCCAGGCACTGTGCTGAGG + Intergenic
952512293 3:34069594-34069616 ATGTGTCAGGCACTGTGTTGGGG + Intergenic
953481502 3:43256125-43256147 CTGTGCCAGGCACTGTGAGGGGG + Intergenic
954105893 3:48409802-48409824 CTCGTGCAGGCACAGTGCCGGGG - Intronic
954220643 3:49151638-49151660 CAGTGGCAGCCACAGAGGTGGGG + Intergenic
954290949 3:49649781-49649803 CTGTTTCAGGCCCAGTGCTGGGG - Intronic
954541524 3:51396023-51396045 CTGTTGCAGGCACACTGCAGTGG + Exonic
954630914 3:52047233-52047255 CTTAGCCAGGCCCAGTGCTGAGG + Intergenic
954700285 3:52447247-52447269 CTGTGTCAGGCCCTGTGTTGGGG + Intergenic
954851717 3:53606561-53606583 CAGTGGCAGGCCAAGGGCTGTGG + Intronic
954945808 3:54423463-54423485 CTGTGCCAGGCACGGTACTAGGG - Intronic
955066336 3:55536458-55536480 CTGTATCAGGCACAGTGCTAGGG - Intronic
955378070 3:58414658-58414680 CTCTGCCAGGCATTGTGCTGGGG - Intronic
955676375 3:61453190-61453212 TTGTGCCAGGGACAGTGCTAGGG - Intergenic
955954982 3:64279691-64279713 CTGAGGCAGGCAGATTGCTTGGG + Intronic
956345797 3:68277058-68277080 ATGTGCCAGGCACTGTGCTAAGG + Intronic
956372554 3:68579305-68579327 CTGTGGTAGTCTCAGTGTTGGGG + Intergenic
957178373 3:76842790-76842812 CAGGGGCAGACACAGTGCTAAGG + Intronic
957573184 3:81975342-81975364 CTGTGCCAGGCACTGCGCTTGGG + Intergenic
957761109 3:84557977-84557999 CTCTGGCCGTCACACTGCTGTGG - Intergenic
958501763 3:94919701-94919723 CTGTGACAGGAACAGGTCTGGGG + Intergenic
958999801 3:100950205-100950227 CTCTGCCAGGCACCGTGCTAGGG - Intronic
959641671 3:108644837-108644859 CTGTGCCAGGCACAGTGCAAAGG + Intronic
960236164 3:115285214-115285236 CTGCTGCAGCCAGAGTGCTGTGG - Intergenic
960488212 3:118278887-118278909 ATGTGCCAAGCACAGTACTGGGG + Intergenic
961397543 3:126606598-126606620 ATGTGGCAGAAACAGTGCAGTGG - Intronic
961519927 3:127461202-127461224 CTGTGCTAGGCCCTGTGCTGGGG + Intergenic
961621073 3:128225578-128225600 ATGTGCCAGGCACGGTGCTGGGG - Intronic
961635503 3:128330354-128330376 ATGTGGCAGGCACTGTGCTGAGG + Intronic
961642934 3:128376169-128376191 CTGGGGCATGCACAGTTCTCTGG + Intronic
962239849 3:133743231-133743253 ATGTGTCAGGCACTGTCCTGGGG - Intergenic
962278229 3:134031202-134031224 CTGGGGCTGCTACAGTGCTGTGG - Intronic
962328531 3:134456610-134456632 CTGAGGCAGGCAAATTGCTTTGG + Intergenic
962844762 3:139264386-139264408 TTGTGGCAGGCATTGTGCTGGGG + Intronic
962886212 3:139630350-139630372 CTGTGGCTGCCACAGAGTTGGGG + Intronic
962894844 3:139704852-139704874 CAGTGGCAGGCATAGAGTTGTGG + Intergenic
963460735 3:145611492-145611514 CTGTGGCTGGCCCAGTGTTGAGG + Intergenic
963661557 3:148133358-148133380 GTGTGGCAGGCTGAGTGCTGTGG + Intergenic
963774670 3:149426321-149426343 CAGGGGCAGGCACAGTGCAGGGG + Intergenic
964159862 3:153633996-153634018 CTGTGGCAGCCACATTTTTGGGG + Intergenic
964704609 3:159604496-159604518 CTGTGCCAGGCACTGTGCCAGGG + Intronic
964722716 3:159783279-159783301 CCGAGGCAGAGACAGTGCTGAGG + Intronic
965633902 3:170761351-170761373 CTGTGGCAGCCTCAGTTCTCTGG - Intronic
965754902 3:172015813-172015835 CCGTGTCAAGCACTGTGCTGGGG - Intergenic
966416863 3:179698087-179698109 GTGTGCCAGGCACAGTACAGGGG + Intronic
966424708 3:179768659-179768681 ATGGGCCAGGCACAGTGCTGGGG - Intronic
966883971 3:184364643-184364665 CTATGCTAGGCACTGTGCTGAGG - Intronic
967473381 3:189888924-189888946 CTGTGCCAGGCACTGTGCTAGGG + Intronic
967489470 3:190073546-190073568 CTGTGGCAGCCACAGTTCCCAGG - Intronic
967844947 3:194035822-194035844 CTGTGGGAGGAACAGGGATGTGG + Intergenic
967935071 3:194720720-194720742 CTGTGCCAGGCATTGTGCCGAGG - Intergenic
967935794 3:194726381-194726403 CTGTGCCAGACACTGTCCTGGGG - Intergenic
968495527 4:913365-913387 CTGTGGCAGGGGCTGTGCTGGGG - Intronic
969176002 4:5399550-5399572 CTGGGGCATGGACAGAGCTGAGG + Intronic
969219846 4:5752455-5752477 CTGTGGCCCCCACAGGGCTGTGG - Intronic
969490510 4:7496829-7496851 CTGGGGAAGGCACAGGGCTCCGG + Intronic
969527990 4:7713809-7713831 CTGTGGCAGTGACAGGGGTGGGG - Intronic
969961762 4:10951943-10951965 CAGTGGGACGCACATTGCTGTGG - Intergenic
970138161 4:12949383-12949405 CTGTGGTGGGAACAGTGCTGGGG + Intergenic
971347098 4:25821478-25821500 ATGTGGAAGGCACTGTGCAGAGG + Intronic
971479884 4:27104987-27105009 ATGTGGCAGGCACTGTACTTTGG + Intergenic
972920477 4:43934399-43934421 CTGTTGCAGGCCAGGTGCTGTGG + Intergenic
973647876 4:52968200-52968222 GTGTGCCAGGCACTGTGCTAGGG + Intronic
973878473 4:55244556-55244578 CTCTGGAAGCCACAGGGCTGGGG + Intergenic
974104479 4:57454067-57454089 TTGTGGCAGGCCCAATGTTGGGG + Intergenic
975264174 4:72342603-72342625 CTGAGGCAGGCAGATCGCTGAGG - Intronic
975766575 4:77674884-77674906 CTGTGGCAGGCCAGGTGCAGTGG + Intergenic
976521990 4:86039406-86039428 CTGTGGCAGGCCCAGTGTTGGGG - Intronic
976980762 4:91224331-91224353 CTGTGGGAGGCAAAGAGATGAGG + Intronic
977422620 4:96821963-96821985 CAGTGGGTGGCACTGTGCTGAGG - Intergenic
977565657 4:98577878-98577900 ATGTGCCGGGCACTGTGCTGAGG - Intronic
977640510 4:99353320-99353342 CTGTGTCAGGCACTAAGCTGGGG + Intergenic
978189091 4:105893028-105893050 TTGTGCCAGGCATTGTGCTGGGG + Intronic
979029537 4:115624451-115624473 CTGAGGCTGGCATATTGCTGGGG - Intergenic
980058485 4:128102858-128102880 AAGTAGCAGGCACAGTTCTGAGG - Intronic
980283764 4:130756149-130756171 CTGTGGCAGGCCCAGTGTTGAGG + Intergenic
981205257 4:142033312-142033334 GTGTGGCTGGCACAGTGGAGGGG - Intronic
981669902 4:147275095-147275117 CTGGGGCTGGCCCAGTGCTGGGG + Intergenic
982107807 4:152025923-152025945 ATGGGCCAGGCACAGTGATGGGG + Intergenic
983918395 4:173316539-173316561 CTGTGGCATGCCCATTACTGGGG + Intronic
985046607 4:185947209-185947231 CTGTGGCAGCGAGATTGCTGTGG - Intronic
985727045 5:1522101-1522123 CTGGGGCAGGAGCAGGGCTGGGG + Intronic
986195544 5:5534067-5534089 CTGTGGCAGGTGCAGTAGTGCGG - Intergenic
987041937 5:14071236-14071258 CTGTGTCAGGCACAGCACTGGGG + Intergenic
988523520 5:31966856-31966878 CTGTGGCAGGCAGGCTGGTGGGG - Intronic
988773174 5:34451864-34451886 CTGTGGCAGGCACAGATGTCAGG + Intergenic
989235078 5:39137890-39137912 CAGTAGGAGGCACACTGCTGAGG + Intronic
990323285 5:54649701-54649723 GTGTGGCAGGCAAAGTGCAGGGG + Intergenic
990811239 5:59726013-59726035 CAGTGCCAGACACAGTGGTGTGG - Intronic
990827621 5:59919719-59919741 TTGTGGCAGGCACTGACCTGAGG - Intronic
991390706 5:66140644-66140666 TTGTAGCAGGAAAAGTGCTGTGG - Intronic
991439217 5:66628902-66628924 CTATTGCAGGGACATTGCTGAGG - Intronic
992320720 5:75611371-75611393 GTGTGGCGTGCACAGTGCTAAGG - Intergenic
992557295 5:77916181-77916203 CTGTGGCAGGCACCTTTCTGGGG - Intergenic
993027924 5:82667367-82667389 CTGTGCCAGGTACAGTACTAGGG - Intergenic
993082765 5:83322400-83322422 CTGTGCCAGGCAATATGCTGTGG + Intronic
994282640 5:97924196-97924218 CTGTGACAAGCACAGTGCTTGGG + Intergenic
994505196 5:100634292-100634314 CTGTGTCAGCCACTGTGCTAAGG + Intergenic
995504497 5:112845642-112845664 TTGTGGTAGGTACAGTTCTGGGG + Exonic
996490000 5:124083626-124083648 CTGAGGCAGGAGCATTGCTGAGG - Intergenic
997418951 5:133750835-133750857 GTGTGGCAGGCAGAGGGCAGGGG - Intergenic
997443737 5:133926579-133926601 CTGTGCCAGGAACAGTGGTGGGG - Intergenic
997656631 5:135559976-135559998 TTGTGCCAGGCACAGTGCACAGG - Intergenic
997697293 5:135871741-135871763 CTGTGGCCTGCACAGGGGTGCGG - Intronic
998391471 5:141789504-141789526 CTATGGCAGGCTAAGTCCTGGGG - Intergenic
999099316 5:149009528-149009550 CTGTGCCAGGCACTGAGCTAGGG - Intronic
999110385 5:149115438-149115460 CTGTGCCAGGCACCATTCTGAGG + Intergenic
999265856 5:150266485-150266507 CTGTGCCAAGCACTGTGCAGAGG + Intronic
1001757144 5:174179270-174179292 CTGGGCCAAGCCCAGTGCTGGGG - Intronic
1001781876 5:174375807-174375829 CTGTGCCAGACACTGTGCTAAGG + Intergenic
1002021738 5:176368006-176368028 ATGTGCCAGGCATTGTGCTGAGG + Intronic
1002045700 5:176540717-176540739 CTGGGGCAGGGACAGGGCAGCGG - Intergenic
1002088252 5:176789448-176789470 GTGTGGCAGCCACGGTGCTGGGG + Intergenic
1002348666 5:178566331-178566353 CTTTGGGATGGACAGTGCTGTGG - Intronic
1002503269 5:179661172-179661194 CTGAGGCAGGCAGATTACTGAGG - Intergenic
1002939586 6:1704356-1704378 CTGAGGCTGGCAGAGTGGTGTGG + Intronic
1003050093 6:2772431-2772453 GTGTGCCAGGCACTGTGCTGGGG - Intronic
1003068225 6:2921014-2921036 CTGAGGCAGGCACAGGGGAGTGG - Intergenic
1003084284 6:3049095-3049117 CTGTGGCCTGCACAGTGGTCAGG + Intergenic
1003620461 6:7694825-7694847 GTGCAGGAGGCACAGTGCTGAGG - Intergenic
1003884671 6:10510729-10510751 CGGTGTCAGGCAAAGTGCAGTGG + Intronic
1004232749 6:13847811-13847833 CTTTGGAAGGCACAGGGCTGGGG - Intergenic
1004570945 6:16844304-16844326 CTGGAGCAGGCTCACTGCTGCGG + Intergenic
1004760024 6:18656379-18656401 CTGTGGGTTGCACAGTTCTGTGG - Intergenic
1005187571 6:23180438-23180460 CTGTGGCAGACAAGGAGCTGTGG + Intergenic
1005219418 6:23569954-23569976 ATGTGGCAGACATTGTGCTGGGG + Intergenic
1005634177 6:27737778-27737800 CTGTGTCAGTCACATTCCTGAGG + Intergenic
1005957492 6:30674420-30674442 CTGTCTCAGGCCCAGTGCGGTGG - Intergenic
1006058396 6:31402539-31402561 CTGAGGCAGGCACCGTGTTTAGG + Intronic
1006070836 6:31497082-31497104 CTGAGGCAGGCACAGTGTTTAGG + Intronic
1006190157 6:32202478-32202500 CTGAGGCAGGCACAGCGTGGTGG + Exonic
1006316225 6:33293463-33293485 CTGTGACCGGCCCAGTACTGGGG - Exonic
1006375040 6:33667367-33667389 CTGTGCCAGGCACTGTTTTGGGG + Intronic
1006439733 6:34046574-34046596 CTGTGGATGGGACAATGCTGAGG - Intronic
1006501337 6:34460965-34460987 CTGAGGAAGGCCCAGTTCTGAGG + Intergenic
1006525488 6:34601226-34601248 ATGCGCCAGGCACTGTGCTGAGG - Intronic
1006572539 6:35017643-35017665 TTGTGGCAGGCGCCCTGCTGGGG - Exonic
1007122732 6:39396735-39396757 ATGTGCCAGGCACTGTGCTGGGG - Intronic
1007472130 6:42097812-42097834 CTGTGGCTGGCTCACTGGTGGGG + Intergenic
1007481232 6:42151456-42151478 CTGTGTCAGGCTCTGTGCTCAGG + Intergenic
1007583468 6:42973746-42973768 CTGGGGCAGAGGCAGTGCTGAGG + Intronic
1007809307 6:44475040-44475062 CTGAAGCAGGCACAGAGCAGTGG + Intergenic
1008013649 6:46493177-46493199 GTGTGCCAGGCACTGTGCTTAGG - Intergenic
1008051448 6:46903854-46903876 CTGTGCTAGTCACTGTGCTGTGG + Intronic
1008275434 6:49538885-49538907 TTGTGTCAGGCTGAGTGCTGTGG + Intergenic
1008443374 6:51558688-51558710 TTGGGGCTGGCACAGTACTGAGG - Intergenic
1008837226 6:55849153-55849175 GTGTTTCAGGCACACTGCTGTGG + Intronic
1009857257 6:69280718-69280740 GTGTGCCAGGCATTGTGCTGAGG - Intronic
1010643229 6:78356157-78356179 AAGTGCCAGGTACAGTGCTGGGG + Intergenic
1011471682 6:87714314-87714336 GTGTGCCAGGCACTGTTCTGAGG + Intergenic
1011614059 6:89181914-89181936 CTCTGGCAGGCACGGCTCTGCGG + Exonic
1011623608 6:89265622-89265644 CTCTGGCAGGCACAGCTCTGCGG + Exonic
1013604457 6:111734862-111734884 ATGTGACAGGCACTGTGCTAAGG + Intronic
1013949860 6:115766886-115766908 CGCTGGCAGGGATAGTGCTGTGG - Intergenic
1015414578 6:132934061-132934083 CTGTGTCAGGCACCATGCAGGGG - Intergenic
1015895451 6:138012353-138012375 CTGAGGCAGGCAGATTGCTTGGG + Intergenic
1015941397 6:138456020-138456042 CTGTGCCAGGCACTGTGCTAAGG + Intronic
1016651244 6:146463464-146463486 ATGTGCCAGACACTGTGCTGAGG - Intergenic
1017721364 6:157245618-157245640 CTGTGGAAGCAACGGTGCTGCGG + Intergenic
1018369973 6:163158770-163158792 CTGCAGCAGGCACAGGGCTTTGG + Intronic
1018569127 6:165188261-165188283 ATGTGCCAGGCACTGGGCTGGGG + Intergenic
1018792303 6:167157786-167157808 CTGTGGCCACCACAGTGCTGGGG + Exonic
1019121240 6:169806158-169806180 CTGTGGCAAGTAGAGTTCTGTGG - Intergenic
1019295698 7:272871-272893 CTGAGGGAGGCACAGGGCAGAGG - Intergenic
1019518599 7:1450544-1450566 CTGTGGCAGGAGCACTGGTGAGG - Intronic
1020060037 7:5144765-5144787 CTCTGGCTGACACAGAGCTGGGG + Intergenic
1020086554 7:5313591-5313613 GTGTGGCAGGCATGGTGATGAGG + Exonic
1020699398 7:11460315-11460337 CGGTGGCAAGCAAAATGCTGTGG + Intronic
1021940511 7:25674286-25674308 CTTTGGCATGCACAGTGCCAGGG - Intergenic
1022038532 7:26557334-26557356 GTGAGGCAGACACTGTGCTGGGG + Intergenic
1022331869 7:29387150-29387172 CTGTGCCAGGCAGAGTCCTGAGG - Intronic
1022801437 7:33780807-33780829 GTGTGCCAGGCACAGTGGTAAGG + Intergenic
1023514859 7:40991888-40991910 TTGTGGCAAGAACAGTGGTGAGG + Intergenic
1023576639 7:41635293-41635315 CTGTTGCAGGCACTACGCTGAGG - Intergenic
1024565624 7:50677477-50677499 CTTTGGCAGGCAGAGTTCTCTGG - Intronic
1024757742 7:52556008-52556030 CCGTGGCAGGAGCAGTGCAGCGG + Intergenic
1025207759 7:57003547-57003569 GTGTGGCAGGCATGGTGATGAGG - Intergenic
1025664177 7:63573325-63573347 GTGTGGCAGGCATGGTGATGAGG + Intergenic
1025994073 7:66517256-66517278 CAGAGCCAGGCACAGAGCTGGGG - Intergenic
1026033908 7:66817400-66817422 CAGTGCCAGGCACAGAGCTGGGG + Intergenic
1026846544 7:73701982-73702004 CCTTGGCAGGCAGTGTGCTGGGG - Intronic
1026985683 7:74553956-74553978 CAGTGCCAGGCACAGAGCTGGGG - Intronic
1027429574 7:78096404-78096426 ATGTGTCAGGCACTGTGCTAAGG - Intronic
1027570620 7:79861406-79861428 GGGTGCCAGGCACAGTGCAGTGG - Intergenic
1028056582 7:86252659-86252681 ATGTGGCCAGCACAGTGCTGGGG - Intergenic
1028056591 7:86252703-86252725 TTGTGGGAGGCAGGGTGCTGGGG - Intergenic
1028086162 7:86640140-86640162 CTGTGAAGGGCACAGGGCTGTGG - Intergenic
1028388292 7:90285206-90285228 CTGCTGGAGGCCCAGTGCTGGGG - Intronic
1028436907 7:90814547-90814569 CTGAGGCAGGCAGATCGCTGAGG + Intronic
1028649789 7:93138739-93138761 CTATGGCAGGCCCAGTGCCCTGG - Intronic
1028916895 7:96269153-96269175 CTGTGCCAAGCACAGAGATGAGG + Intronic
1028995282 7:97093297-97093319 CTGAGGCAGGGACAGGCCTGGGG - Intergenic
1029380441 7:100210964-100210986 CTGTCGCAGGCCCTGGGCTGTGG + Intronic
1029435800 7:100563439-100563461 GTGTGGTGGGCCCAGTGCTGAGG + Intronic
1029655681 7:101922842-101922864 CTGTGGCCAGCCCAGTGCAGAGG - Intronic
1029709707 7:102292980-102293002 CTGTGGCTGGGATGGTGCTGGGG + Intronic
1029982379 7:104890925-104890947 CTGTTGCAGGCACGAGGCTGGGG - Intronic
1030218941 7:107077271-107077293 GTGTGTCAGGTACAGTGCTGGGG + Intronic
1030323635 7:108196154-108196176 TTGTGCCAGACACTGTGCTGGGG - Intronic
1031354028 7:120768295-120768317 ATGTGGCAGAAACAGTACTGTGG + Intergenic
1031950602 7:127887893-127887915 CTGTTGCAGAAACATTGCTGAGG + Exonic
1033947544 7:146740599-146740621 TTGTGGCAGGCATAGTTCTGGGG + Intronic
1034317018 7:150142430-150142452 GTGAGGCAGGCGCAGGGCTGGGG - Intergenic
1034442390 7:151092579-151092601 CTCTGCCAGGCTCACTGCTGGGG + Intronic
1034459396 7:151190152-151190174 CTGGGGCAGGCAGAGTGCCAGGG + Intergenic
1034662210 7:152781432-152781454 ATGTGCCAGGCACTGTGCCGGGG + Intronic
1034789847 7:153958254-153958276 GTGAGGCAGGCGCAGGGCTGGGG + Intronic
1035665867 8:1379252-1379274 CTGTGCCAGGCACAGGCCCGAGG + Intergenic
1036635810 8:10548836-10548858 GTGTGTCAGGCACTGTGCTGGGG + Intronic
1036758266 8:11486329-11486351 CTCTGGAGGGCACAGTGCTATGG - Intergenic
1036794462 8:11745272-11745294 CTGGGGTGGGCACAGTTCTGGGG + Intronic
1037797854 8:22011142-22011164 CTCTTGCAGGCAGAGCGCTGGGG + Intergenic
1038532737 8:28331638-28331660 CTGTGGCAGGCACAATGGCAGGG - Intronic
1038970979 8:32635219-32635241 CTGTGACAGGCATTGTGCTGGGG - Intronic
1039007918 8:33061358-33061380 CTGTGGCATGCATTGTTCTGAGG - Intergenic
1039432645 8:37537252-37537274 CTATGGCAGGCACTGCACTGGGG + Intergenic
1039969166 8:42306957-42306979 CTGTGTCAGGCACTGTGCTCAGG + Intronic
1041390459 8:57343122-57343144 ATGTGCCAGGCCCTGTGCTGGGG - Intergenic
1043307714 8:78817898-78817920 CTGTGGTGGGCCCAGTGTTGGGG + Intergenic
1043340824 8:79236908-79236930 CTGTGCCTGGCACTGTGCTAGGG + Intergenic
1044954416 8:97464706-97464728 CTGAAGCAGGCACAGGGCTATGG + Intergenic
1045074420 8:98547432-98547454 ATATGTGAGGCACAGTGCTGGGG - Intronic
1046841890 8:118868243-118868265 CAGTTGCAGGCACAGTCCTGGGG + Intergenic
1046913821 8:119658793-119658815 GTGTGCCAGGGACAGTGCTGGGG - Intronic
1047424155 8:124730168-124730190 CTGTCCCAGGCACATTGCTGAGG + Intergenic
1047533192 8:125695892-125695914 CTGTGGCAGGACCAGTGAGGCGG + Intergenic
1047552291 8:125887724-125887746 TTGTCTCAGGCACAGGGCTGGGG + Intergenic
1047772884 8:128044581-128044603 GTGTTGCAGGCACTGTGCTGAGG - Intergenic
1047784721 8:128142602-128142624 TTGTGCCAGGCACTGTGCTTAGG - Intergenic
1047819837 8:128506756-128506778 CTGTGCCAAGCACTATGCTGGGG - Intergenic
1048062255 8:130932433-130932455 CTGTGGCAGGCCCAGTGTTGGGG + Intronic
1048366825 8:133745601-133745623 CTGTGCCAGGCACCATGCTGAGG - Intergenic
1048643428 8:136389828-136389850 ATGTGTCATGCACAGTGCTAGGG + Intergenic
1048925215 8:139265322-139265344 CTGTGACAGGCACAGCTCAGTGG - Intergenic
1049071897 8:140362007-140362029 CTGTGCAGGGCAGAGTGCTGAGG - Intronic
1049100775 8:140577627-140577649 CTGGGGCAGGCAGAGAGCTCGGG + Intronic
1049225445 8:141448560-141448582 GTGTGCCAGCCACAGAGCTGAGG - Intergenic
1049604177 8:143521414-143521436 CAGAGGCAGACATAGTGCTGGGG - Intronic
1049660434 8:143817389-143817411 CTGGGCCAGGGTCAGTGCTGGGG + Exonic
1049706911 8:144047314-144047336 CTGCGGCAGGCACAGAGCCACGG - Intergenic
1049806348 8:144542407-144542429 CTGAGGCAGGCAGGGTGCTCAGG + Intronic
1050056384 9:1659920-1659942 CTGTGGCAGGGGCAGTGCCTGGG - Intergenic
1050318776 9:4429711-4429733 CTGTGTCTGACACAGAGCTGGGG - Intergenic
1050684768 9:8155574-8155596 ATGTGCCAGGCCCTGTGCTGGGG - Intergenic
1051437116 9:17044625-17044647 CTGCGGCAGGCACTGTTCTAAGG + Intergenic
1051552584 9:18346540-18346562 CTGTTCCAGGCACAGTGCTAGGG - Intergenic
1052192815 9:25678249-25678271 CTGCGGCGGGGACGGTGCTGCGG - Exonic
1052234025 9:26188736-26188758 ATGTGGCAGGCCCAGTGCTGGGG - Intergenic
1052762531 9:32607338-32607360 CTGTGGCCTGCGCAGTGCTCAGG + Intergenic
1052830159 9:33208655-33208677 CTGGGGCAGATACAGTGCTGTGG - Intergenic
1053114825 9:35490917-35490939 ATGTGCCAGGCACCGTGCTGGGG - Intronic
1053268057 9:36730353-36730375 CTGTGCCAGGCACAGGGTTCTGG + Intergenic
1053427392 9:38019418-38019440 CTCTGGAACGCACACTGCTGGGG + Intronic
1056991743 9:91419673-91419695 ATGTGCCAGGCACAGTGTTGAGG - Intronic
1057575186 9:96236784-96236806 CTGTGTCTTGCACAGTTCTGGGG + Intronic
1057731545 9:97613360-97613382 ATGTGGCAGGCACTGTTCTAGGG - Intronic
1057746910 9:97759814-97759836 CTGGGTCAGGAACAGTGCTGGGG - Intergenic
1057967665 9:99519816-99519838 CTGTGGGAGGAAGATTGCTGGGG - Intergenic
1058088264 9:100774646-100774668 ATGTGCCAGGTACAGTGCTTAGG + Intergenic
1058647465 9:107143897-107143919 CTGCAGCAGGCACAGAGCTCTGG - Intergenic
1058835070 9:108853464-108853486 GTGGGTCAGGCCCAGTGCTGGGG - Intergenic
1059315581 9:113423032-113423054 ATGTGTCAGGCACAGGGCTAGGG - Intronic
1059391621 9:114002763-114002785 CTCTGAGAGACACAGTGCTGGGG + Intronic
1059948670 9:119439221-119439243 ATGTGCCAGGCACAGTTCTAGGG - Intergenic
1059954456 9:119501163-119501185 CTTTGCCAGGCACTGTGCTATGG - Intronic
1060050062 9:120372104-120372126 CTGAGGCAGGGGCTGTGCTGAGG + Intergenic
1060290052 9:122293727-122293749 ATGTGCCAGGCTCTGTGCTGGGG + Intronic
1060321182 9:122562476-122562498 CTGTGGGTTGCACAGTTCTGTGG + Intergenic
1060433157 9:123568384-123568406 GTGTGCCAGGCACTGTGCTAGGG - Intronic
1060855712 9:126914179-126914201 CTGTGCCAGGCACGGTGAGGTGG - Intergenic
1061087801 9:128409403-128409425 CTGGGGCAGACAAAGGGCTGCGG - Intergenic
1061192095 9:129087970-129087992 CTGTGCCAGGCTGTGTGCTGGGG + Intronic
1061240190 9:129365672-129365694 CTGTGGCAGGCCAGGTGCGGTGG + Intergenic
1061281628 9:129601011-129601033 CTGTGGCAGGCTCTGTGTTAGGG + Intergenic
1061282126 9:129603390-129603412 CTATTTCAGGCACTGTGCTGTGG - Intergenic
1061389859 9:130311443-130311465 GTGTGCCAGGCCCTGTGCTGGGG + Intronic
1061580287 9:131531776-131531798 CTGTGCCAGGCACGGAGCGGGGG - Intergenic
1061645327 9:131996301-131996323 CTGAGAAAGGCACAGTGATGAGG + Intronic
1061664886 9:132154834-132154856 CAGTGGGAGGCAGAGGGCTGAGG + Intergenic
1061669465 9:132180496-132180518 CTGGGGCTGGCACCGTCCTGGGG + Intronic
1061707019 9:132461114-132461136 TTGTGCCAGGCACTGTGCGGAGG - Intronic
1061896885 9:133652841-133652863 CCGTGGCATGCACAGTGGCGTGG + Intronic
1062229451 9:135473445-135473467 CTGAGGCAGGCAGACTGCTTGGG - Intergenic
1062271055 9:135709099-135709121 CACTGGCAGCCACAGTGCTGGGG - Intronic
1062357926 9:136173827-136173849 CTGCGGCAGGGAAAGGGCTGAGG - Intergenic
1062619766 9:137415173-137415195 CTGTGACAGGCCCAGCGCAGTGG - Intronic
1203757507 Un_GL000218v1:147689-147711 CAGTGGCAGGCAGAGTTCTGGGG - Intergenic
1186273961 X:7919983-7920005 GTGTGGCAGGTACTGGGCTGCGG + Intronic
1186670868 X:11765789-11765811 CAGTGCCAGGCATGGTGCTGAGG + Intronic
1187064697 X:15822221-15822243 CTGAGGCGGGCACAGACCTGAGG - Intronic
1187144945 X:16628942-16628964 CTGTGCCAGGCACTGTTCTAAGG + Intronic
1187238738 X:17493523-17493545 ATATGCCAGGCACTGTGCTGGGG - Intronic
1187826345 X:23335479-23335501 CGGCGGCGGCCACAGTGCTGTGG + Intronic
1187946576 X:24431972-24431994 CTGTGCCAGGCACCTTGCTAGGG + Intergenic
1188082428 X:25860509-25860531 CTGGGGCTGGCATAGTGCTAAGG - Intergenic
1189316101 X:40057650-40057672 CTGTGCCAGGCACTGAGCTAAGG - Intronic
1189958420 X:46301281-46301303 CTTTGGCAGGCAGGGGGCTGAGG + Intergenic
1190252534 X:48737880-48737902 ATGGGGCAGGGACAGTGCTCTGG - Intergenic
1190408206 X:50108899-50108921 ATGTGGCAGGCACAGGGCTATGG - Intergenic
1191666025 X:63703596-63703618 ATGTACCAGGCACTGTGCTGGGG + Intronic
1192951873 X:76026114-76026136 CTGTGGGTTGCACAGTTCTGTGG - Intergenic
1194058270 X:89164129-89164151 CTGTGGGTTGCACAGTTCTGTGG + Intergenic
1195083234 X:101390483-101390505 ATGTGGCAGGCACTGTTCCGGGG - Intronic
1195616783 X:106918675-106918697 AGGTGCCAGGCACTGTGCTGAGG - Intronic
1195953977 X:110309172-110309194 TTGAGGCAGATACAGTGCTGTGG + Intronic
1195979427 X:110561566-110561588 CTGTGGGTTGCACAGTTCTGTGG + Intergenic
1196013814 X:110916272-110916294 CTATGCCAGGCACTGTGCTATGG + Intergenic
1196126688 X:112108947-112108969 CTGTGGCAGGCCCAGTATTGAGG + Intergenic
1196691474 X:118563343-118563365 CTGTGGCAGGAGCATTGCTTGGG + Intronic
1197114547 X:122817603-122817625 CTGGGGTTGGCACGGTGCTGGGG - Intergenic
1197388237 X:125827046-125827068 CTGCAGCAGGCACTGAGCTGGGG - Intergenic
1197544563 X:127808877-127808899 TTGTGTGAGACACAGTGCTGTGG + Intergenic
1198311672 X:135430844-135430866 CTGTGGCAAGCACAGTGCTAGGG + Intergenic
1199681729 X:150229411-150229433 CTGTGCCAAGCCCTGTGCTGAGG - Intergenic
1199823898 X:151478393-151478415 CTGTGGCAGGCTGAGTGCCATGG - Intergenic
1200053638 X:153447247-153447269 CTGTGACAGGCACACTGCTCAGG + Intronic
1200181559 X:154154004-154154026 CTCAGGCTGGCACAGTGCAGTGG + Intronic
1200187205 X:154191118-154191140 CTCAGGCTGGCACAGTGCAGTGG + Intergenic
1200192854 X:154228256-154228278 CTCAGGCTGGCACAGTGCAGTGG + Intronic
1200198609 X:154266060-154266082 CTCAGGCTGGCACAGTGCAGTGG + Intronic
1200383562 X:155865554-155865576 CACTGGCAGTCACTGTGCTGCGG - Intergenic
1201345756 Y:12982856-12982878 CTGCAGCAGGCACAGAGCTGGGG - Intergenic
1201685241 Y:16694122-16694144 CTTTGGCATGCTGAGTGCTGTGG - Intergenic
1201785604 Y:17774602-17774624 TTGTGGCATGCCCAGTTCTGTGG - Intergenic
1201815949 Y:18131386-18131408 TTGTGGCATGCCCAGTTCTGTGG + Intergenic
1201960543 Y:19676466-19676488 CTATGGAAGAAACAGTGCTGTGG - Intergenic
1202583286 Y:26403278-26403300 CTGGGGCAGGGCCAGGGCTGGGG + Intergenic