ID: 1129550443

View in Genome Browser
Species Human (GRCh38)
Location 15:76443031-76443053
Sequence GTAAAAAACACCACCACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129550443 Original CRISPR GTAAAAAACACCACCACTGA GGG Intronic
900978437 1:6032192-6032214 TGAGAAAACACCTCCACTGAGGG + Intronic
901466862 1:9427363-9427385 GCAGAGAACACCACCACTAATGG - Intergenic
903757455 1:25672529-25672551 GAAAAAGACTCCACCACTGCTGG - Intronic
907255092 1:53173210-53173232 GAAAAACACAACATCACTGAAGG + Intergenic
908924346 1:69235970-69235992 GTGATAAACACCTCCACTGTTGG - Intergenic
914339437 1:146746533-146746555 GTAAAACAAAACACCGCTGAGGG - Intergenic
918396373 1:184117322-184117344 GTCAGAAACATCATCACTGATGG + Intergenic
920220484 1:204396132-204396154 GTAAAGAAGCCCACCACAGAAGG + Intergenic
920645441 1:207800313-207800335 TTAACTAACACCACCACTTAGGG + Intergenic
1065120802 10:22528875-22528897 GTACTCAACACCAACACTGATGG - Intergenic
1071285176 10:84137966-84137988 GAAAAAAAGACTATCACTGAAGG + Intergenic
1071566920 10:86675970-86675992 GTAAAAACCAACATCAGTGAAGG - Intronic
1074104387 10:110377367-110377389 GTAAAAAACTCCATCATTGAGGG + Intergenic
1074377590 10:112951942-112951964 GAAACAAACACCACCACCAAAGG - Intronic
1074839526 10:117335482-117335504 GGCAAAAATAACACCACTGATGG + Intronic
1075515321 10:123103762-123103784 ATTAATAACACCACCACTTATGG - Intergenic
1078068798 11:8095098-8095120 GAAGAAAACACCAGCATTGATGG + Intronic
1078873179 11:15368008-15368030 AAGAAAAACACCACCACAGAAGG + Intergenic
1079199961 11:18368551-18368573 GAAAATAATAGCACCACTGATGG + Intergenic
1081155827 11:39688641-39688663 GTAAAAAAAATCACCAGTCATGG + Intergenic
1086596091 11:88572757-88572779 ATAAAAAATACAACCATTGATGG - Intronic
1088946707 11:114520836-114520858 GTATACAACACCACCTATGAAGG - Intergenic
1089880245 11:121766468-121766490 GCAAAAAGCACTACCAATGAGGG + Intergenic
1092035419 12:5330270-5330292 GTGAAAAAGACCACAGCTGAAGG - Intergenic
1093356917 12:18177677-18177699 CCAAACAACACCACCCCTGATGG + Intronic
1097767012 12:63537614-63537636 GAAAAAAACAGAAACACTGAAGG + Intergenic
1097783361 12:63732559-63732581 GAAAAAAACAGAAACACTGAAGG + Intergenic
1097957322 12:65499492-65499514 GTGATAAATACAACCACTGATGG - Intergenic
1099619405 12:84982230-84982252 GATAAAAATATCACCACTGATGG + Intergenic
1100833834 12:98546052-98546074 GTAAAAAACAAAATCAATGAGGG + Intronic
1102398831 12:112611312-112611334 GTAACCACCACCACGACTGATGG + Intronic
1102472307 12:113166158-113166180 GCAAAGAACACCAGCACTCAGGG + Intronic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1109592330 13:64502255-64502277 GAAAAAAACCCTACCAATGAAGG - Intergenic
1114146282 14:19981373-19981395 CCAAACAACACCACCCCTGATGG + Intergenic
1114707970 14:24746720-24746742 TTAAAAAGCACAACCCCTGATGG - Intergenic
1117333368 14:54736113-54736135 TTAACAAAAACCAACACTGAAGG - Intronic
1119258746 14:73223689-73223711 GTAAAAAACACTAGCACAGCTGG - Exonic
1120402820 14:84054159-84054181 GTACAAAACAACATCACTGAAGG + Intergenic
1121017773 14:90558812-90558834 GTAAAAAACTCCAGGAGTGAAGG - Intronic
1121741239 14:96253853-96253875 GAAAAAAACTCCAGGACTGATGG + Intronic
1123821262 15:24032540-24032562 GTAAGAAACAACCTCACTGAAGG - Intergenic
1124455466 15:29838689-29838711 ATAACCACCACCACCACTGAGGG + Intronic
1126310364 15:47309157-47309179 GTGAAAAGCAAAACCACTGATGG - Intronic
1126579011 15:50225652-50225674 ATAAAAAACACCAACATGGATGG + Intronic
1126955754 15:53931933-53931955 ATTAAAAACACTAACACTGATGG - Intergenic
1127656123 15:61057873-61057895 GGAAAAAAGACCACTACGGATGG + Intronic
1128872238 15:71169266-71169288 ATAAAAAACACTACCAGTGTTGG + Intronic
1129550443 15:76443031-76443053 GTAAAAAACACCACCACTGAGGG + Intronic
1131577849 15:93610100-93610122 GAATAAAAAACCACCATTGATGG - Intergenic
1131864105 15:96688658-96688680 GTATAAAATACCAACACTTAAGG - Intergenic
1135856866 16:26019699-26019721 GTTCAAACCATCACCACTGAGGG - Intronic
1140256073 16:73337372-73337394 GTAACAAAGCTCACCACTGAAGG - Intergenic
1141380741 16:83574394-83574416 CAAGAGAACACCACCACTGAGGG - Intronic
1146476928 17:33170452-33170474 GGAAAAAAATCTACCACTGATGG + Intronic
1147399564 17:40172076-40172098 ACAAAAAACACCACCACACATGG - Exonic
1147549227 17:41427225-41427247 GAAAAAAACCCCACCACTTATGG - Intergenic
1148594947 17:48846346-48846368 GTGAAAGCCACCACCAATGATGG + Intronic
1148892801 17:50820099-50820121 GGCAAAGACCCCACCACTGAGGG - Intergenic
1151101707 17:71563313-71563335 GGAAAAAACACCACGACTAAAGG + Intergenic
1153530214 18:6038596-6038618 GTAAAAGACAGCAACATTGATGG + Intronic
1154955222 18:21247233-21247255 GTCAAAAACAACTGCACTGAAGG - Intronic
1155215976 18:23643115-23643137 GCTGATAACACCACCACTGAGGG + Intronic
1156215388 18:34992976-34992998 GGAAAAAGCAGAACCACTGATGG + Intronic
1156413295 18:36857772-36857794 TTTAAAAACACCACCATGGAGGG - Intronic
1158205697 18:54990307-54990329 GTTGAATACATCACCACTGAGGG - Intergenic
1160148319 18:76381732-76381754 GTAAAAAACGCCAGCAGTTAAGG + Intronic
1161054468 19:2183167-2183189 CAAAAAAACAACACCACTGTGGG - Intronic
925500041 2:4492558-4492580 TTAAAAATCACCTCCACTAAAGG - Intergenic
926797431 2:16630344-16630366 CTCATAAACACCACCTCTGAGGG - Intronic
928859636 2:35841697-35841719 GCAAAAGACACCACCTCTGCTGG - Intergenic
930796749 2:55401011-55401033 GTAAACAGCACCACCATTAAGGG + Intronic
933180580 2:79222264-79222286 GTCAAATAAACCACTACTGAGGG + Intronic
933522087 2:83386876-83386898 GTAACAAACACCAAGACTAAAGG - Intergenic
933650955 2:84849907-84849929 GTAGAAAACACTACGACTGGCGG - Intronic
935404217 2:102691182-102691204 ATACTAAACACCACCTCTGAGGG - Intronic
936176352 2:110224251-110224273 GTAAAAAACACTACCATTTATGG - Intergenic
938695837 2:133834724-133834746 GGAAAACACACCACCTATGAAGG + Intergenic
939552437 2:143632272-143632294 GAAAAAAACACCAAAAGTGATGG - Intronic
946262685 2:218508050-218508072 GTAGAAAACAGGAACACTGAAGG + Intronic
946933856 2:224699286-224699308 GTCAAAAACACTACCAATAATGG - Intergenic
947030344 2:225785196-225785218 ATAAAATACACTACCACTAATGG - Intergenic
947353426 2:229270091-229270113 GTAAAATACAGCACCATTGGAGG - Intronic
948842922 2:240664899-240664921 GTATAAAACAACCTCACTGAAGG - Intergenic
1171374490 20:24682839-24682861 GCAAAGAACACCAACACAGATGG + Intergenic
1172562537 20:35902210-35902232 GTAGAAACAACCAGCACTGAAGG + Intronic
1173041366 20:39466721-39466743 CTAAAAAAAACTACCACAGAGGG - Intergenic
1176148572 20:63576848-63576870 GAAAAAAACACCACCATCAAAGG + Intergenic
1176944817 21:14966631-14966653 GAAAAAAACACCAGCCCTCAGGG - Exonic
1176970283 21:15257072-15257094 TTAAAAAAAAAGACCACTGAAGG + Intergenic
1179453172 21:41479487-41479509 ATAAGAAACACGACCAATGAAGG - Intronic
1179774363 21:43651166-43651188 GTAAATAACACCTCCTCAGATGG - Intronic
1180759075 22:18185723-18185745 GTACAAGACATCACCAATGAGGG - Intergenic
1180769361 22:18369508-18369530 GTACAAGACATCACCAATGAGGG - Intergenic
1180769386 22:18369823-18369845 GTACAAGACATCACCAATGAGGG - Intergenic
1180776922 22:18492566-18492588 GTACAAGACATCACCAATGAGGG + Intergenic
1180776948 22:18492881-18492903 GTACAAGACATCACCAATGAGGG + Intergenic
1180809645 22:18749905-18749927 GTACAAGACATCACCAATGAGGG + Intergenic
1180809670 22:18750220-18750242 GTACAAGACATCACCAATGAGGG + Intergenic
1180827232 22:18872739-18872761 GTACAAGACATCACCAATGAGGG - Intergenic
1181195811 22:21184445-21184467 GTACAAGACATCACCAATGAGGG + Intergenic
1181213718 22:21308679-21308701 GTACAAGACATCACCAATGAGGG - Intergenic
1183942447 22:41303114-41303136 GGAAAGAAGACCACCACGGAGGG - Intronic
1203230990 22_KI270731v1_random:110396-110418 GTACAAGACATCACCAATGAGGG - Intergenic
1203277382 22_KI270734v1_random:98651-98673 GTACAAGACATCACCAATGAGGG - Intergenic
1203277407 22_KI270734v1_random:98966-98988 GTACAAGACATCACCAATGAGGG - Intergenic
950008221 3:9704742-9704764 GTGTAAAGCACCACCACTGCAGG - Exonic
951617463 3:24563792-24563814 TTAAAAAACACAACCATTAAAGG - Intergenic
952668479 3:35937003-35937025 ATATAAATCACCACCACGGAAGG - Intergenic
955199749 3:56840243-56840265 GGAAAAAACACCCCCATTTAGGG + Intronic
956203830 3:66735741-66735763 CTAAAAATCACCACTGCTGATGG - Intergenic
956340377 3:68216389-68216411 ATATAAAACACCTTCACTGAAGG + Intronic
960013902 3:112863653-112863675 GTAAAAAAAAACACAGCTGAAGG - Intergenic
966228264 3:177621530-177621552 GTAATAATCACCTCCAGTGATGG - Intergenic
967216036 3:187211267-187211289 GTATAAAACAACACCTCTCAAGG - Intergenic
967585868 3:191214466-191214488 CAACAAAAAACCACCACTGATGG + Intronic
968516642 4:1018322-1018344 GTAAAAAACACAACTAGGGAAGG - Intronic
969564087 4:7967453-7967475 GTAACAAATATGACCACTGAAGG - Intronic
974315979 4:60281704-60281726 GGAAAACACACCACCACCAAAGG - Intergenic
975110821 4:70624582-70624604 GAAATAAACACCACCTCTGAGGG + Intergenic
976288821 4:83396721-83396743 GTAAAAAACAGCATCTCGGATGG + Intergenic
976331676 4:83839000-83839022 TTAAAAAAAACCACTACAGATGG + Intergenic
979662584 4:123275077-123275099 GTAAAAAAGACAATCACTCAAGG - Intronic
979887368 4:126046033-126046055 TCAAATAACACCACCACTGGTGG - Intergenic
980021360 4:127714055-127714077 GAAAAAAGCACCACCAGTTATGG + Exonic
980440320 4:132835280-132835302 ATAAACAATCCCACCACTGAAGG - Intergenic
982098143 4:151942163-151942185 CCAGAAAACAGCACCACTGATGG - Intergenic
984079135 4:175221350-175221372 GTAAAAGAGACCACCACTGTTGG + Intergenic
984834437 4:184006755-184006777 TTAAAAAACACCAGCACTTTGGG + Intronic
985350420 4:189055536-189055558 CTATAAAACCCCACCACTGCAGG + Intergenic
987474279 5:18371909-18371931 TAAAATAACACCACCACTGTGGG + Intergenic
988230663 5:28474440-28474462 GAATAAAACACCACTACAGAGGG + Intergenic
989451280 5:41589125-41589147 TTTAAAGACACCAGCACTGATGG + Intergenic
989489492 5:42033365-42033387 TAAAAAAACATCACCACTGAGGG - Intergenic
990518738 5:56556789-56556811 GCAAAAAACACCCCCTCTAAGGG - Intronic
991167511 5:63581584-63581606 GTAAAGCACACCAACACTGCTGG + Intergenic
991178598 5:63721413-63721435 TTCAGAAACATCACCACTGATGG - Intergenic
992598439 5:78370000-78370022 TTAAAAAACACCTCTAATGAAGG - Intronic
993495027 5:88599077-88599099 TTAAAACACACCACCACTGTTGG + Intergenic
993629851 5:90272662-90272684 TTTAAAAATACCACTACTGAAGG + Intergenic
994323669 5:98423508-98423530 TCAGAAGACACCACCACTGATGG - Intergenic
995339896 5:111046731-111046753 GTAAGCAGCACCACCACTTATGG + Intergenic
997800796 5:136859402-136859424 ATACAAAACTACACCACTGAAGG - Intergenic
1003484964 6:6567605-6567627 GTAAATAACTCCACCACCCAGGG + Intergenic
1005002116 6:21252285-21252307 GTATAAAACAACTTCACTGAAGG - Intergenic
1006528003 6:34624830-34624852 GTATAAAACATCATTACTGATGG + Intronic
1007862800 6:44930697-44930719 GTAACAAACTCCACCCCAGAGGG - Intronic
1008303840 6:49876196-49876218 GAAAAAAACACCACCAATAAAGG + Intronic
1008451054 6:51651303-51651325 GTAAAAAACAGTACCACCTACGG - Intronic
1010651481 6:78460495-78460517 TAAAAAAACACCTCCAGTGAGGG + Intergenic
1010803267 6:80202762-80202784 GTAAAAATCACCAACATTTAAGG - Intronic
1016408179 6:143753869-143753891 TGAAAAAACACCACCTCTGGAGG + Exonic
1018017115 6:159722468-159722490 GTAATAGACACTACCAATGATGG + Intronic
1023799242 7:43819141-43819163 CCAAACAACACCACCCCTGATGG + Intergenic
1023799683 7:43823056-43823078 CCAAACAACACCACCCCTGATGG + Intergenic
1024526790 7:50355948-50355970 GTCAAAGACATCCCCACTGAAGG - Intronic
1025947755 7:66117510-66117532 GGAAACAACAGGACCACTGATGG - Intronic
1027664277 7:81024847-81024869 GTAAAGAAGACCGACACTGATGG - Intergenic
1028110907 7:86940009-86940031 GTAAAAAATATCACAATTGAAGG - Exonic
1028273626 7:88823835-88823857 GTAAAAAAGAAAAGCACTGATGG + Intronic
1030336675 7:108335885-108335907 GTAGAAAGCACTACCATTGATGG + Intronic
1030515316 7:110531278-110531300 GAAAACAACACCACCACCAAAGG + Intergenic
1031407900 7:121407371-121407393 ATAAAAAACACCATGACAGATGG + Intergenic
1034089296 7:148349347-148349369 GTAAAACACACTAACACTAACGG + Intronic
1035244110 7:157551323-157551345 GTGAAAAATACCACAACTGTAGG + Intronic
1037078684 8:14755701-14755723 GTAAATATCACCTCCACTAAAGG + Intronic
1038148319 8:24918427-24918449 GTAGAAAAAATCACCAGTGAGGG + Exonic
1038258818 8:25974989-25975011 AGAAACACCACCACCACTGAAGG - Intronic
1039195330 8:35024702-35024724 GTAAAAAATAACACGGCTGAGGG - Intergenic
1039394321 8:37210343-37210365 GTAAGAAAAACAAACACTGATGG + Intergenic
1042819088 8:72910442-72910464 GAAAAAAACACCAACATTGAAGG + Intronic
1045524723 8:102931928-102931950 ACAAAAAACAAAACCACTGAGGG - Intronic
1048380054 8:133857546-133857568 GTAAAAAACACCAATGCAGAGGG - Intergenic
1048526764 8:135209991-135210013 GTAAAACAAACCAGCCCTGATGG - Intergenic
1052502339 9:29307533-29307555 GTAAAAACCAACAACTCTGAAGG - Intergenic
1056724200 9:89098299-89098321 GGAAAAAAAACCATCAATGAAGG + Intronic
1058756970 9:108091642-108091664 GGAAAAAAGACCACTAATGAAGG - Intergenic
1061325992 9:129864917-129864939 GAGAAAAACACCACCACCAATGG - Intronic
1062672469 9:137719638-137719660 ATCAAAGACATCACCACTGAAGG - Intronic
1186289078 X:8077084-8077106 GTAAAAAGCACCACAATGGATGG - Intergenic
1186307281 X:8275737-8275759 GTTAAAAAAAACACCAATGATGG - Intergenic
1187106743 X:16251113-16251135 GTAAAAAATACCACAAATGTGGG - Intergenic
1189034735 X:37483916-37483938 CCAAACACCACCACCACTGATGG + Intronic
1189833685 X:45000029-45000051 CCAAACACCACCACCACTGATGG - Intronic
1191784615 X:64903924-64903946 GAAAAAAACAGCATCACTCAGGG + Intergenic
1193449516 X:81648263-81648285 CTACAAAACAACATCACTGATGG + Intergenic
1193500369 X:82266788-82266810 GTCAAAGACACCACATCTGAAGG - Intergenic
1198720773 X:139617174-139617196 GTACAAACCATCACCAGTGAAGG + Intronic
1199034542 X:143034255-143034277 GGACAAATCATCACCACTGATGG + Exonic
1199073840 X:143508770-143508792 GGACAAATCATCACCACTGATGG - Exonic
1199322439 X:146456069-146456091 GACTAAAACACCAGCACTGAGGG - Intergenic