ID: 1129550732

View in Genome Browser
Species Human (GRCh38)
Location 15:76445987-76446009
Sequence TTGTAGAAATAGTGGTAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 267}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129550726_1129550732 16 Left 1129550726 15:76445948-76445970 CCAGAGGTAATATCCACTCTTAC 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1129550732 15:76445987-76446009 TTGTAGAAATAGTGGTAGAAGGG 0: 1
1: 0
2: 0
3: 27
4: 267
1129550729_1129550732 3 Left 1129550729 15:76445961-76445983 CCACTCTTACTGCACAGGGAATT 0: 1
1: 0
2: 1
3: 14
4: 168
Right 1129550732 15:76445987-76446009 TTGTAGAAATAGTGGTAGAAGGG 0: 1
1: 0
2: 0
3: 27
4: 267
1129550725_1129550732 28 Left 1129550725 15:76445936-76445958 CCTCTGATTCTTCCAGAGGTAAT 0: 1
1: 0
2: 0
3: 15
4: 161
Right 1129550732 15:76445987-76446009 TTGTAGAAATAGTGGTAGAAGGG 0: 1
1: 0
2: 0
3: 27
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129550732 Original CRISPR TTGTAGAAATAGTGGTAGAA GGG Intronic
901951386 1:12750545-12750567 TTGTGCAAATAGTGCCAGAAGGG + Intronic
902072625 1:13753740-13753762 ATGTAGAAAGAGTGGCAGGATGG + Intronic
906600051 1:47118177-47118199 TTGTGTAACTAGTGGTAGAGTGG + Exonic
909857497 1:80556600-80556622 TTGAAGAGATAGTGATAGAGTGG + Intergenic
913387433 1:118274459-118274481 TTGAAGAAATAGTGATAGATTGG - Intergenic
913668176 1:121069701-121069723 TTGTAGAAACAAAGGTAAAATGG - Intergenic
914019921 1:143857138-143857160 TTGTAGAAACAAAGGTAAAATGG - Intergenic
914234567 1:145796840-145796862 TCATAGAAACAGAGGTAGAATGG - Intronic
914658419 1:149765047-149765069 TTGTAGAAACAAAGGTAAAATGG - Intergenic
916418347 1:164613066-164613088 TTGTAAAAATATTTCTAGAAGGG - Intronic
916622111 1:166510580-166510602 TTGAAGAAAGAGTGAGAGAAAGG + Intergenic
916677538 1:167076358-167076380 TGGTAGATTTGGTGGTAGAAGGG + Intronic
917667819 1:177242328-177242350 TTGTTGAAATAGTGAATGAATGG - Intronic
918607119 1:186441419-186441441 ATGGAGAAAAAGTGCTAGAAAGG - Intergenic
918749048 1:188247598-188247620 ATGTAGAACTAATGGTACAAAGG - Intergenic
919003257 1:191861257-191861279 TTGTAGAAATACTGGTCCTAGGG + Intergenic
920905826 1:210166558-210166580 TTGTAGAAAGGGAGGAAGAAAGG + Intronic
1063173135 10:3527769-3527791 TTGCAAAAATGGTGGGAGAAAGG - Intergenic
1063274173 10:4546337-4546359 TTTTGGAAATTGTGGTATAAAGG - Intergenic
1063743616 10:8854523-8854545 TTGTAAAAATAATGTTAAAATGG + Intergenic
1064059608 10:12127088-12127110 TGGTAGAAAGAATGGTGGAAGGG + Intergenic
1064235142 10:13566905-13566927 TTGTTGAAATAATGAAAGAACGG + Intergenic
1065364091 10:24918012-24918034 TTCCTGCAATAGTGGTAGAAGGG + Intronic
1065744188 10:28823901-28823923 TTGTTGAAATAGTGAATGAATGG - Intergenic
1070670740 10:78375634-78375656 TAGCAGAAACAGTGATAGAAGGG + Intergenic
1071753523 10:88509411-88509433 TGATAGAATTAGTGGAAGAAAGG + Intronic
1072150394 10:92678394-92678416 GTGTAGACATAGTGGTGGAGAGG - Intergenic
1072423759 10:95311536-95311558 TTTTAGAAATAATGGCAAAATGG + Intergenic
1072444875 10:95490308-95490330 TGGTAGCTATAGTGGTAGGAAGG + Intronic
1072901249 10:99408798-99408820 ATGTAGGAATAGTGGTTGAAAGG + Intronic
1073527585 10:104199132-104199154 TTGTAGAAATAGTTGAGGTATGG + Intronic
1074051833 10:109887462-109887484 CTGTAGAAACAGAGGTAGATGGG - Intronic
1075586424 10:123661570-123661592 TTCTAAAGATAGTGGTGGAAAGG + Intergenic
1076886545 10:133265414-133265436 TTGCAGAAATAGTCCTAGAAGGG - Intronic
1078030450 11:7745764-7745786 GTGTACAAATAGGGGTAAAATGG + Intergenic
1080297532 11:30747693-30747715 TTGTAGAAATCATGTTGGAAGGG + Intergenic
1083452175 11:62753504-62753526 TTGTAGAAAAGCTGGAAGAATGG + Exonic
1084388032 11:68856271-68856293 TTGTAGATACAGTTCTAGAACGG + Intergenic
1085009470 11:73128059-73128081 TTGGAGAAATGGTGGTCAAAGGG - Intronic
1086222158 11:84460601-84460623 TTGAAGTAATAGTGTTAAAAAGG - Intronic
1086521084 11:87668529-87668551 TTCTAGAAATAGTTCTAAAAGGG - Intergenic
1089638436 11:119831547-119831569 TGGAAGAAATAGTGCTAAAAGGG + Intergenic
1090369594 11:126239375-126239397 ATGTATAAATAGTGGTTAAATGG - Intronic
1090769837 11:129910168-129910190 TTCTACAAATATTGGTGGAAGGG + Intronic
1091669458 12:2442452-2442474 TTGAAGAGAAAGTGGTAGAAAGG + Intronic
1091696316 12:2630500-2630522 CTGTTGAAATAGTGGGAGGAGGG + Intronic
1091871716 12:3896927-3896949 TTGTAGCCATAGTGTTAGCAAGG + Intergenic
1092010571 12:5107672-5107694 TTGTAGAAATAATGCTAGTTTGG + Intergenic
1092596129 12:10006753-10006775 TTTTAGAAATAGTGAAAGAAGGG + Intronic
1092753473 12:11740922-11740944 ATGTAGAAATTGAGGTTGAAGGG - Intronic
1093043768 12:14417432-14417454 CTGTAACAATAGTGGTAGATGGG + Intronic
1094050483 12:26215239-26215261 TTGTGGGAATAGAGGAAGAATGG - Intronic
1094298679 12:28936554-28936576 TGGAAGAAATAATGGTAGAATGG - Intergenic
1094641321 12:32278238-32278260 TTGTAGTAATTGTGGTATCAGGG + Intronic
1094674511 12:32605984-32606006 TTGTGAAAAGAGTGGTAGATTGG + Intronic
1096712625 12:53468588-53468610 GTGTAGAAATAATGCTCGAAAGG - Intronic
1097778301 12:63673393-63673415 TTGTAGAAAAAATCTTAGAAAGG - Intergenic
1098384297 12:69902424-69902446 ATGGAGAAACAGTGGTAGGAGGG - Intronic
1098761668 12:74433107-74433129 TGGTAGGAATAGTGGCACAAGGG - Intergenic
1100141026 12:91619128-91619150 TTTTAGAATTGGTTGTAGAAGGG + Intergenic
1102724523 12:115048973-115048995 TTGTAAAAATAAAGTTAGAAGGG + Intergenic
1102889983 12:116551188-116551210 TTGTAGAATTAGTGGATGGATGG + Intergenic
1103862151 12:124024085-124024107 TTGTAGAGATGGAGGTAGCAGGG + Intronic
1104654724 12:130565581-130565603 TCCTAGAAATAGTGATAAAATGG - Intronic
1108822038 13:54363976-54363998 TTATAGAAATATAGGTAGAAAGG + Intergenic
1109457872 13:62616613-62616635 TTCCAGAAATAGTGGAACAAAGG + Intergenic
1109566284 13:64120377-64120399 TTGAAAAAAGAGTGGAAGAAGGG - Intergenic
1110185074 13:72664474-72664496 TTGTAGGAAATGAGGTAGAAAGG - Intergenic
1111422788 13:88037772-88037794 TGGTAGAAATAATTGTAAAATGG + Intergenic
1111620776 13:90722675-90722697 TTGATTAAATAATGGTAGAAAGG + Intergenic
1111707986 13:91775327-91775349 CAGTAGAAATGGTGGTAAAATGG - Intronic
1112140521 13:96636285-96636307 TTGTACAGAAATTGGTAGAAAGG + Intronic
1113258558 13:108534271-108534293 ATGTAGAAATGGTGGTCCAAGGG - Intergenic
1113739452 13:112701162-112701184 ATGGAGAAATCATGGTAGAAAGG - Intronic
1114136416 14:19856914-19856936 TTGTAGGCATGGTAGTAGAAAGG - Intergenic
1115886419 14:37976620-37976642 TAGTACAAACAGTGGTGGAACGG + Intronic
1116010112 14:39341482-39341504 TTGCAGAAATTGTGGTAGCTGGG + Intronic
1116126301 14:40790599-40790621 TTGTAGGATTATTGGTAAAAAGG - Intergenic
1116172203 14:41417290-41417312 TTGTGGATATGGTGGTAGAGTGG - Intergenic
1116557541 14:46331661-46331683 TTGTAGGAGTAGAGATAGAAAGG + Intergenic
1116919427 14:50557299-50557321 GGGTAGAAATAATGGAAGAATGG - Intronic
1117319663 14:54608778-54608800 TCGTAGATATAGAGGTGGAAGGG + Intronic
1118177741 14:63458904-63458926 TTGGAGAAATAGAAGTAAAAGGG - Intronic
1118789093 14:69072677-69072699 CTGTAAGAATAGTGGCAGAAGGG + Intronic
1120011651 14:79422580-79422602 TGGTAGAAATAGATTTAGAAAGG + Intronic
1120678056 14:87445335-87445357 TTGCAGAAATAGAGTTAGCAGGG - Intergenic
1121374238 14:93391964-93391986 ATGTAGAACAACTGGTAGAAGGG + Intronic
1121705645 14:95991360-95991382 TGGGAGAAATGGTGGAAGAAGGG + Intergenic
1126232264 15:46341164-46341186 TTGCAGAAATAATGGTAGCAGGG + Intergenic
1126686648 15:51254028-51254050 TTGTGGAAATATAAGTAGAAAGG + Intronic
1127001841 15:54517928-54517950 TTGTATAAATAGAGGTAAAAAGG + Intronic
1127551232 15:60040456-60040478 ATGTAGAAATAGCGTTTGAATGG - Intronic
1127972500 15:63972471-63972493 TTGTAGAAATACAGATGGAAAGG + Intronic
1128771030 15:70282744-70282766 TTGTAGAATAAATGGGAGAATGG + Intergenic
1129550732 15:76445987-76446009 TTGTAGAAATAGTGGTAGAAGGG + Intronic
1133480851 16:6169086-6169108 TTGTAGAAAAATGGATAGAAGGG + Intronic
1136782277 16:32914192-32914214 TTGGGGAAATAGTAGAAGAAGGG + Intergenic
1138135558 16:54518277-54518299 TTGAAGAAATAGTGTCTGAAAGG + Intergenic
1139249322 16:65479880-65479902 CTGAAGAAATAGAGGTAGGAGGG + Intergenic
1140050778 16:71479148-71479170 TTGTAAAAATAGTCATATAATGG - Intronic
1147864494 17:43543774-43543796 TTGTGGAAATAATGGCTGAATGG - Intronic
1149017264 17:51922831-51922853 TCTTAGAAATAATGGTAGCAAGG - Intronic
1149525738 17:57354378-57354400 TTTAATAAATAGTGGTAGAGAGG + Intronic
1151799518 17:76369734-76369756 TTGACCAAAAAGTGGTAGAAGGG + Intronic
1152448466 17:80360865-80360887 TTTGAGAAAAAGTGGCAGAATGG - Intronic
1152753011 17:82074629-82074651 TCGAAGAAATAGTAGTAAAAGGG - Intergenic
1154314879 18:13296764-13296786 GTGTGAAAATAGTGGCAGAATGG - Intronic
1154460687 18:14581920-14581942 TTGTAGGCATGGTGGTAGAAAGG - Intergenic
1156168242 18:34450010-34450032 TGGTAGAAATAGTGCTAATAGGG + Intergenic
1156359220 18:36369273-36369295 TTTTAGAATCAGTGGTAGCAGGG + Intronic
1157238013 18:45982174-45982196 TTGAAGAAGTAGTGATAGGATGG + Intergenic
1157716921 18:49894265-49894287 TTGTAGAGATGGTGGTGGGAGGG + Intronic
1158179494 18:54697996-54698018 TTGTAAAAATAAATGTAGAAAGG + Intergenic
1159447488 18:68558509-68558531 TTCAAGAAATAGGGGTAGGAGGG - Intergenic
1159582454 18:70248611-70248633 CTGTAAAAATATTGTTAGAAAGG - Intergenic
1159815951 18:73073858-73073880 TCCTAAAAATAGTGCTAGAAAGG - Intergenic
1163889864 19:20001135-20001157 TTGTAGAAATATTAGAGGAAAGG + Intronic
1165799048 19:38536474-38536496 ATGAAGACATAGAGGTAGAAAGG - Intronic
1166239895 19:41483141-41483163 TTGTAGAAATAGTGAGAAATAGG - Intergenic
1167013399 19:46823714-46823736 TTGTAGAAATGGTGGTTTCAAGG - Intergenic
1167191612 19:47994018-47994040 TTGAAGAAATACTTGCAGAATGG - Intergenic
1167550797 19:50159416-50159438 TGGGAGAAAAAGTGGTAAAAGGG + Intronic
925704651 2:6672898-6672920 TTGTAGAAAGACTGGTCGAATGG - Intergenic
925818077 2:7772835-7772857 TTGTAGAAATCTTAATAGAATGG + Intergenic
927226599 2:20771955-20771977 TTGCAGGAATAGTGGTGAAAAGG - Intronic
929035035 2:37682580-37682602 TTGTAAGAATGGTGGTAGTATGG + Intronic
929243752 2:39679404-39679426 AAGTAGTAATAGTGGTAGATGGG + Intronic
929357834 2:41047932-41047954 TTGTAAAAATAGTGGTATTTGGG - Intergenic
929613422 2:43289253-43289275 TTCTAGAAAAAGTGAAAGAACGG - Intronic
929931117 2:46256289-46256311 TTATAGAAAAATTGGTGGAAAGG - Intergenic
930116782 2:47724969-47724991 TTGCAGGAATAGTGGGAGATAGG + Intronic
930550334 2:52826651-52826673 TAATAGGAATAGTGGCAGAAAGG + Intergenic
930568649 2:53056081-53056103 TTGCAGGAATAGTAATAGAAAGG - Intergenic
930668498 2:54123397-54123419 TTCTACAAATAGAGGTAGGAAGG + Intronic
930737254 2:54792099-54792121 TTGTAGAAGGAGTAATAGAAGGG + Intronic
930820386 2:55640689-55640711 TTGTAGAGATACTGGTGTAATGG - Exonic
931824870 2:65990167-65990189 TTGTAGAAAGAGGGATACAAGGG - Intergenic
931931167 2:67135637-67135659 TTATGCATATAGTGGTAGAAGGG - Intergenic
932263269 2:70344670-70344692 ATGGAGAAATAGTGGGAGAGAGG + Intergenic
932745296 2:74329142-74329164 TTGTAGAAGTAGCAGTAAAACGG + Intronic
932971093 2:76543124-76543146 TTGGAAAAATAGTGCTAGAAAGG + Intergenic
935857180 2:107287868-107287890 TTGTAGGAATATTTGTGGAAAGG - Intergenic
937454715 2:122031434-122031456 ATATAGACATAGTGGTAGATGGG + Intergenic
939136551 2:138301981-138302003 TTTTAAATATAGTGATAGAATGG - Intergenic
943108692 2:183579490-183579512 TTGAAGAAAGAGTGGCAGAGGGG - Intergenic
943467584 2:188247700-188247722 TATTAGAATTAGGGGTAGAAAGG + Intergenic
944541608 2:200758786-200758808 TTGAATAAAGAGTGGGAGAATGG + Intergenic
946061843 2:216949339-216949361 CTGGAGAAAAAGTGCTAGAAGGG + Intergenic
948957870 2:241308264-241308286 TTGCTGAAACACTGGTAGAAAGG - Intronic
1174912583 20:54622931-54622953 TTTTTGAAATGGTGGTAGCAGGG + Intronic
1175420062 20:58826140-58826162 ATTTAAAAATAGTGGGAGAAGGG + Intergenic
1177467511 21:21507254-21507276 TTGAAGAAATAGTGATCCAAAGG - Intronic
1177544885 21:22543791-22543813 TTGAAAACATAGTGATAGAATGG - Intergenic
1178823015 21:35992321-35992343 TCGTAGAGACAGAGGTAGAACGG - Intronic
1183016658 22:34993978-34994000 TAGTAGTAGTAGTAGTAGAAGGG + Intergenic
1184022483 22:41830260-41830282 CAGTAGAAATGGTGGAAGAAGGG - Intergenic
949284955 3:2391341-2391363 TTGTAAAAATAGTCATAAAAGGG - Intronic
949313608 3:2727647-2727669 TCTTAGAAACAGTGGTAGGACGG - Intronic
949382233 3:3459366-3459388 TTGGAGGAATGGTGGTGGAAAGG + Intergenic
949698419 3:6726893-6726915 CTGTAGAAATAGTGGTTGACAGG + Intergenic
949822362 3:8129213-8129235 TTGTACAAATAGATGTAGCAAGG - Intergenic
949867188 3:8555650-8555672 TAGTATAAAAAGTGGGAGAAAGG - Intronic
950837512 3:15935052-15935074 TTGTAAATATAGTGGAAGAAAGG + Intergenic
953127043 3:40101196-40101218 TTGCAGATATACTGGGAGAATGG - Intronic
955568929 3:60282051-60282073 TGGTGGAAATAATGGTAAAATGG + Intronic
956291248 3:67662421-67662443 TGGTAGAAGTAGGGGAAGAAAGG - Intergenic
956350066 3:68324750-68324772 TTGTAGAAATAATTCTAGATTGG + Intronic
956536074 3:70278425-70278447 AAGTAGAAATAATTGTAGAATGG + Intergenic
956622978 3:71239629-71239651 TTGTAGAAATACTTGTACTATGG - Intronic
956879395 3:73494897-73494919 TTGAAGAGATAGTGTTACAAGGG + Intronic
958987570 3:100800130-100800152 TTGAACTAATTGTGGTAGAAAGG - Intronic
959405504 3:105958031-105958053 TTGTGGAAACAGTGGAATAACGG + Intergenic
960198944 3:114808018-114808040 TTCTAGAAATAGAGCAAGAAAGG - Intronic
963716203 3:148807278-148807300 TTCCAAAAATAGTGGTAGAAAGG - Intronic
965077616 3:163999415-163999437 ATGTAGAAATAGTTGTTTAAAGG - Intergenic
965849195 3:173001959-173001981 ATGTAGAAAGAATGGAAGAATGG - Intronic
965872472 3:173278427-173278449 TTGTAGGTATAGAGGGAGAAAGG - Intergenic
966575434 3:181496212-181496234 TTGGAGAAATATTTTTAGAATGG + Intergenic
966916802 3:184588838-184588860 ATGTAGAGATAGTGGCAGGAAGG + Intronic
967974967 3:195028822-195028844 TTCTAGTCCTAGTGGTAGAATGG + Intergenic
968034196 3:195531891-195531913 TTCTAGAGATAGAAGTAGAATGG - Intronic
969634042 4:8355130-8355152 TTGAAGAAATAGTCTTAGATGGG + Intergenic
970047166 4:11867787-11867809 TTGAAGAAATACTGTTTGAAGGG + Intergenic
970457894 4:16243818-16243840 TTGTAGAAAAGGTGGCTGAAAGG + Intergenic
970751343 4:19366896-19366918 TTGTACAAACTGTGTTAGAAGGG + Intergenic
971415349 4:26421746-26421768 TTGCAGAAATTTTGGTTGAAAGG - Intronic
972953112 4:44354119-44354141 TTGAAAAAAGATTGGTAGAAAGG - Intronic
975664179 4:76718342-76718364 TTGTGGAAATATTGGTAGGTAGG + Intronic
976062136 4:81140821-81140843 TTCTAGAAATAGTGATGAAAGGG - Intronic
976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG + Intronic
976784602 4:88803874-88803896 TTGTTGAAATAGTCCCAGAATGG - Intronic
978113272 4:104988511-104988533 TTGTAGAAAAAGTCATAGAAGGG - Intergenic
978565044 4:110072484-110072506 TTCTAGAAATACTAGTACAAAGG - Intronic
978896290 4:113892029-113892051 TAGTAGAAATAATGGTCAAAAGG + Intergenic
980796051 4:137684437-137684459 TTATAAAAATAATGGTAAAATGG - Intergenic
981437341 4:144740933-144740955 TGGCAGAAACAGTAGTAGAAAGG - Exonic
982184994 4:152787240-152787262 TTATAAAAATAGTGTTAAAATGG + Intronic
982495755 4:156090031-156090053 TTGTAGAAATTTTGCAAGAATGG - Intergenic
983232492 4:165143276-165143298 GTGAAGAAATAGTGGTGGGAAGG - Intronic
984004154 4:174288203-174288225 TTGTAGTAATAATGGTTGGATGG - Intronic
984253510 4:177363309-177363331 TGGAAAAATTAGTGGTAGAACGG - Intergenic
984970268 4:185182501-185182523 TGTGAGAAATAGTGGAAGAAGGG - Intronic
986874418 5:12090388-12090410 TTTTATAAATAGAGGTAAAAGGG - Intergenic
989753563 5:44923697-44923719 ATGAAGAAAAAGTGGTATAATGG - Intergenic
990530801 5:56671545-56671567 TTGTAGAAATGGAGGCACAAAGG + Intergenic
990929361 5:61070909-61070931 TTGGAGTAATAGTTATAGAAAGG - Intronic
992164808 5:74038834-74038856 TTTTGGAATTACTGGTAGAACGG + Intergenic
993029791 5:82692944-82692966 TTGTAGAAATGCTGGGAGACTGG + Intergenic
996600927 5:125263064-125263086 TATAAAAAATAGTGGTAGAAAGG - Intergenic
997821249 5:137068077-137068099 TTTTAGAAATAGTGACAGTAGGG - Intronic
998664048 5:144275492-144275514 TTTTAGAGAGAGTGGGAGAAAGG - Intronic
998951546 5:147397688-147397710 TTGTAGACATAGTCGGAGAACGG + Exonic
1001197730 5:169688689-169688711 TTATATAAATAGTGTTACAATGG + Intronic
1001789537 5:174444046-174444068 GTGCAGAAAAGGTGGTAGAAGGG - Intergenic
1005907281 6:30274535-30274557 TCCTAGAAACAGAGGTAGAACGG + Intergenic
1008287078 6:49666890-49666912 TTGCAAAAATAGTGACAGAAGGG + Intergenic
1009405621 6:63308764-63308786 TGTTAGAAATAGTGGAAAAAGGG + Intronic
1009972881 6:70643579-70643601 TTGAAGAAACAGGGGTAGATGGG - Intergenic
1010256398 6:73763263-73763285 TTGTTGAAATAGTAACAGAAAGG - Intronic
1010558360 6:77314571-77314593 TTGCAGAAAAATTCGTAGAATGG + Intergenic
1011582070 6:88879464-88879486 TTGTAGAAATAGTTGTTGTGTGG - Intronic
1012216840 6:96597475-96597497 ATTTAGAAACAGTGATAGAAGGG - Intronic
1012316701 6:97790223-97790245 TTGGAGAAATAGTTGGAGAAAGG - Intergenic
1012637906 6:101570002-101570024 TTGTAGTAATATAGATAGAATGG + Intronic
1013571125 6:111426792-111426814 TTTTAGAAATAGTTGTACCATGG - Intronic
1013630311 6:111980044-111980066 TTGAGGTAATAGTGGAAGAATGG + Intergenic
1013904562 6:115199597-115199619 TAGGAGAGATAGTGGGAGAAAGG + Intergenic
1014149786 6:118041507-118041529 TTGGAGATATAGTGGTGGGATGG + Intronic
1014189483 6:118476580-118476602 CAGTAGAAATAGTGGGAAAATGG - Intronic
1014583978 6:123175725-123175747 TTATATAAATAGTGATAGTAGGG + Intergenic
1014595937 6:123338769-123338791 ATGTAGAAATAGTTGTGAAAAGG + Intronic
1017053649 6:150418663-150418685 TTGTACACATAGTGATAGAGAGG + Intergenic
1018160798 6:161040828-161040850 TTGTGCAAATAGGGATAGAAGGG + Intronic
1020424629 7:8050844-8050866 GTGAAGAAATACAGGTAGAAAGG - Intronic
1021970537 7:25961276-25961298 TTCTATAAATAGTTGTTGAATGG + Intergenic
1022164750 7:27747203-27747225 TTGTAGAATTAGTGATTGTACGG + Intronic
1022212841 7:28228121-28228143 TTGTAGCAAAAGTGGTATATAGG - Intergenic
1022260533 7:28700194-28700216 TTGGAGAGATATTGGTAGCAGGG - Intronic
1022764066 7:33390231-33390253 TTGTAGACACAATGGTGGAAGGG + Intronic
1022937233 7:35191064-35191086 TTGTAGAAAAAGTCTTAGAAAGG - Intergenic
1023124781 7:36944858-36944880 ATGTAGAATTAGAGCTAGAAGGG + Intronic
1027384926 7:77650126-77650148 TTGTTGAATTAGTGGGGGAAGGG + Intergenic
1027885176 7:83895015-83895037 TTGAAGAAACAGTAGTATAAAGG + Intergenic
1028372891 7:90114539-90114561 TTGTAGAAAAAGTCTTAGAAAGG + Intergenic
1028977365 7:96929059-96929081 TAGTAGAAATAATGGAATAATGG + Intergenic
1029209174 7:98891495-98891517 TTATAGAAAAAGTGGTAGGCCGG - Intronic
1029833395 7:103283706-103283728 TTGTAGAAAAAGTCTTAGAAAGG - Intergenic
1030081456 7:105782303-105782325 ATTTAGGAATAGTTGTAGAAAGG - Intronic
1030170276 7:106594543-106594565 CTTTAGAAATAGTGTTACAATGG + Intergenic
1030478544 7:110071507-110071529 TAGTAAAAATAGTGTCAGAAAGG - Intergenic
1030858146 7:114587806-114587828 TTGCAGAACTAGTGTGAGAATGG - Intronic
1030949401 7:115770622-115770644 TTGAAGAAATAAAGGAAGAAAGG - Intergenic
1031418439 7:121520690-121520712 TTCTAGAAGAAGTGGGAGAAAGG + Intergenic
1031944219 7:127821688-127821710 TTTTAAAAATAGATGTAGAAAGG + Intronic
1032062632 7:128737720-128737742 TTGTAGAGATAGGGGGAGGAAGG + Intergenic
1036215379 8:6875766-6875788 ATGTAGAAATAGAGGCATAAGGG + Intronic
1040981166 8:53247541-53247563 TTGTGGTAAGAGTGGCAGAATGG + Intronic
1041512349 8:58665863-58665885 AGGAAGAAATGGTGGTAGAAAGG - Intergenic
1041717772 8:60947699-60947721 TTGTGGAAAAAGAGGTAGATTGG + Intergenic
1041824278 8:62074409-62074431 TTGTAGAATTAGTGCTTGCATGG + Intergenic
1042585522 8:70333910-70333932 TAGAAGAAATAGTGGAAGGAAGG - Intronic
1043785550 8:84394101-84394123 CTGTAGAAACAGTGGAAGACTGG - Intronic
1043973668 8:86561772-86561794 TTGTAGAAATAATGGTCTAGTGG + Intronic
1044564107 8:93645207-93645229 TGGTAGAAATAGTCCTAGTAAGG + Intergenic
1046106277 8:109670882-109670904 AGGTAGAAATAGAGTTAGAATGG + Intronic
1046695696 8:117336911-117336933 TTCTTCAAATACTGGTAGAAAGG - Intergenic
1048804245 8:138224870-138224892 TTGTAGAAACAGAAATAGAAAGG + Intronic
1052432465 9:28384527-28384549 TTTTAAAAATAGTGGGAAAAAGG - Intronic
1052954167 9:34240155-34240177 TTGTTCCATTAGTGGTAGAAAGG + Intronic
1053578524 9:39378396-39378418 TTGTAGAAAAAGTGAGAGAAAGG - Intergenic
1053843048 9:42206475-42206497 TTGTAGAAAAAGTGAGAGAAAGG - Intergenic
1054100108 9:60937201-60937223 TTGTAGAAAAAGTGAGAGAAAGG - Intergenic
1054121505 9:61212828-61212850 TTGTAGAAAAAGTGAGAGAAAGG - Intergenic
1054586237 9:66969684-66969706 TTGTAGAAAAAGTGAGAGAAAGG + Intergenic
1056710123 9:88985666-88985688 ACATAGAAATAGTTGTAGAAAGG - Intergenic
1058807160 9:108603878-108603900 TGCAACAAATAGTGGTAGAAGGG - Intergenic
1059012852 9:110481530-110481552 TTCTAGAAATAGCGATAGACAGG - Intronic
1059181900 9:112223632-112223654 TTGTAGAAACCATGGTAAAAAGG + Exonic
1187344859 X:18454077-18454099 TTGAAGGAATAGTGTTAGCAGGG + Intronic
1187714327 X:22087319-22087341 TGGAAGAAATAGTGGCAGATTGG + Intronic
1187790452 X:22944614-22944636 TTCTAGAACTAGTGTTTGAAAGG + Intergenic
1188571125 X:31586073-31586095 TTGTAGAAATACAGATTGAATGG - Intronic
1191084178 X:56546718-56546740 TTCTTGACATAGTGGCAGAAAGG + Intergenic
1191101354 X:56731914-56731936 TTGTATACATAGTATTAGAAGGG - Intergenic
1191223615 X:58016885-58016907 TTGTAAATATAGTGGTGGAGAGG - Intergenic
1192018190 X:67354812-67354834 TTCCATAAATAGTGGTTGAAAGG - Intergenic
1192104480 X:68300989-68301011 TTGTAGATATAGTGTTTTAAAGG - Intronic
1192216253 X:69161383-69161405 TTGTGGAAATAGTGGTGGCACGG + Exonic
1192301597 X:69909597-69909619 TGGTACAAATAATTGTAGAAGGG - Intronic
1193505615 X:82338869-82338891 TTGTGGAAATAGATGGAGAAAGG - Intergenic
1196749454 X:119101751-119101773 TTGAAGAGATTGTGATAGAAGGG - Intronic
1199298239 X:146183308-146183330 TAGTAGTAATTGTGGTACAAAGG + Intergenic
1199866568 X:151855456-151855478 TTCTAGATAAACTGGTAGAATGG + Intergenic
1200255239 X:154578242-154578264 TTGTGGAAATGGCGGTGGAAGGG + Intergenic
1200262530 X:154626162-154626184 TTGTGGAAATGGCGGTGGAAGGG - Intergenic