ID: 1129553118

View in Genome Browser
Species Human (GRCh38)
Location 15:76474885-76474907
Sequence GAAACAGATGAGTCTCCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129553118 Original CRISPR GAAACAGATGAGTCTCCTTC TGG (reversed) Intronic
904556011 1:31364866-31364888 GAATCAGTTGATTCTACTTCAGG + Exonic
905441163 1:37997290-37997312 AAAAAAAATGGGTCTCCTTCTGG - Exonic
906919591 1:50048947-50048969 GAAACAAATGAGTCTCCTGCAGG - Intronic
908621519 1:65986344-65986366 GAAACAGCTGACTCTTCTTATGG + Intronic
909723595 1:78807243-78807265 GAAACATATGGGTCTGTTTCTGG + Intergenic
910486110 1:87716002-87716024 GAAACAGGTAAGTCTCTTCCTGG + Intergenic
912237825 1:107871252-107871274 AAAAAAGATGAATCTCTTTCTGG - Intronic
913189996 1:116405425-116405447 GAAAGAGATGTGTTTACTTCAGG + Intronic
917036651 1:170754898-170754920 CAAACAGGTGAGGCTCCATCTGG - Intergenic
919836212 1:201575239-201575261 GAGAGAGATGTGTCTTCTTCAGG + Intergenic
920144511 1:203847300-203847322 AAAACTGATGATTCTACTTCAGG + Exonic
921820461 1:219610882-219610904 AAAACTGATGATTCTACTTCAGG - Intergenic
922213233 1:223501057-223501079 CAACCAGAGGAGTCTTCTTCTGG - Intergenic
923566278 1:235078973-235078995 GCCACAGGTGTGTCTCCTTCAGG - Intergenic
1064355953 10:14618157-14618179 TATACAGTTCAGTCTCCTTCAGG + Intronic
1065382690 10:25105554-25105576 GAAACACAATAGTCTTCTTCTGG + Intergenic
1065872694 10:29969534-29969556 GCAACAGAAGACTCTCCTCCTGG - Intergenic
1067019484 10:42782445-42782467 GGACCAAATGTGTCTCCTTCCGG + Intergenic
1067811229 10:49428817-49428839 GGGACAGATGAGCCTCCTCCTGG + Intergenic
1067951164 10:50739601-50739623 GGACCAAATGTGTCTCCTTCTGG + Intronic
1069467002 10:68649842-68649864 AAAACAGCTGAGTCCCCTGCAGG - Intronic
1069777614 10:70936088-70936110 GAAACAGCAGAGCCTCCTTCAGG + Intergenic
1070139843 10:73730821-73730843 GGACCAAATGTGTCTCCTTCTGG - Intergenic
1070164467 10:73887502-73887524 GAAACAGCTGAGGCGGCTTCAGG + Intergenic
1076017582 10:127040464-127040486 GAAACGGATGAGGCTCATGCTGG + Intronic
1080193025 11:29573553-29573575 TAATCAGATAAGTCTCCTTAGGG + Intergenic
1080547672 11:33337159-33337181 GAAACAGATATGTCTCATTCTGG + Exonic
1082074516 11:47965963-47965985 GAAGCAAATGATCCTCCTTCTGG - Intergenic
1085219862 11:74864800-74864822 GATATAGGTGAGTCTCCCTCTGG - Intronic
1085767288 11:79294373-79294395 GAAAAAGATGTCTCTTCTTCTGG + Intronic
1087235690 11:95716024-95716046 GAAACATCTGTGTCTCTTTCAGG - Intergenic
1087511293 11:99098260-99098282 GAAACAGATGAATTTCCATCAGG + Intronic
1087966704 11:104423735-104423757 GAAACAGAGATGTCTTCTTCTGG + Intergenic
1088483155 11:110315174-110315196 AAACCAGTTGAGTCTCTTTCTGG + Intergenic
1089137293 11:116259899-116259921 GAGAAAAATGAGGCTCCTTCTGG + Intergenic
1090793265 11:130110995-130111017 GAAACAGAAGACTCTTCTCCTGG - Intronic
1095684706 12:45020214-45020236 GAAGCAGATGAATCTGCTTAGGG - Intronic
1097400496 12:59122840-59122862 GAAACAGATGTGTTGCCTTTTGG - Intergenic
1097993406 12:65861002-65861024 GAAAAAGATGTGTCTACTTTGGG + Intronic
1098849371 12:75576918-75576940 GAATCAGATGAGCCTTCATCAGG + Intergenic
1099304621 12:80937857-80937879 GGAACAGTTGCGTCTCCATCTGG - Exonic
1101511578 12:105397848-105397870 GGAACTGATGGGTCTGCTTCTGG - Intergenic
1102877658 12:116460311-116460333 GAAACAGAGGAGCCTGCTCCAGG + Intergenic
1102914065 12:116739750-116739772 GAAACAGATGATGCTACATCAGG + Intronic
1104279303 12:127359716-127359738 GAAATACATGAGACTCCTACAGG - Intergenic
1105689745 13:22824315-22824337 GAAACATATGAGACACCATCAGG + Intergenic
1106236441 13:27865077-27865099 CAAGGAGATGACTCTCCTTCAGG + Intergenic
1108531608 13:51331912-51331934 GAAACAGTTCAGGCTACTTCAGG + Intergenic
1109439425 13:62349830-62349852 GCAACAGGTCAGTCCCCTTCTGG + Intergenic
1110646170 13:77887057-77887079 GAAACAGAGGAGTCTACTGAGGG + Intergenic
1111555910 13:89881069-89881091 GAAACAGGTAAGTCTGCCTCTGG + Intergenic
1111727683 13:92033085-92033107 GAACCATATCAGTTTCCTTCAGG + Intronic
1114377929 14:22169120-22169142 GAAGCAAATGAATTTCCTTCAGG - Intergenic
1116937513 14:50757417-50757439 GAATCAGATTAGTCAGCTTCAGG - Exonic
1119115635 14:72018618-72018640 GAAACATACGAGTCTCTTTGTGG + Intronic
1119433824 14:74585263-74585285 GAAACCGAAGGGTCTTCTTCTGG + Intronic
1121135828 14:91497989-91498011 GAAGCAGATGAGAATCTTTCTGG + Intronic
1123926646 15:25119151-25119173 GAAAGAGAAGAGTCTCCATGCGG - Intergenic
1124431226 15:29610384-29610406 TAAACAGATGAGGCTGCTTCAGG + Intergenic
1124432377 15:29618745-29618767 TGACCAGATCAGTCTCCTTCAGG - Intergenic
1124476346 15:30038289-30038311 AAAACAAATGAGTCTGCTACAGG + Intergenic
1125357484 15:38831558-38831580 AAAAGAGGTGAGTCTTCTTCTGG - Intergenic
1126742980 15:51796987-51797009 CAAACAGATGATTCACCTCCTGG + Intronic
1129553118 15:76474885-76474907 GAAACAGATGAGTCTCCTTCTGG - Intronic
1134206881 16:12245716-12245738 GAAACAGATGCCACTCCTGCAGG - Intronic
1137448006 16:48543999-48544021 CAAGCAGAGGACTCTCCTTCTGG + Intronic
1139166914 16:64577017-64577039 GAAACAGATGAAACTCCTTAAGG + Intergenic
1139594741 16:67951066-67951088 AAAACAGATGAGACTCCCTCAGG + Intronic
1141955711 16:87370177-87370199 GAAGCAGATGAGTCTTCCCCGGG - Intronic
1143421364 17:6795443-6795465 TAAACATATTAGTCTTCTTCAGG + Intronic
1144278910 17:13704623-13704645 GAAGCAGCTCAGTCTCCTTGAGG - Intergenic
1153584816 18:6610304-6610326 GTAAGATTTGAGTCTCCTTCAGG - Intergenic
1154191089 18:12231571-12231593 CAGACAGAGGAGTTTCCTTCAGG + Intergenic
1156358923 18:36366854-36366876 GAAACAGATGTTTCACCATCTGG - Intronic
1156846640 18:41673322-41673344 GAAATGGATGGGTCTACTTCTGG + Intergenic
1159233288 18:65636717-65636739 GAAATAGAAGGGTCTCCTTTGGG + Intergenic
1159966597 18:74601106-74601128 GACACTGATGTGTCTGCTTCGGG + Intronic
1161509506 19:4662754-4662776 GAAACAGCTGGGGCCCCTTCTGG + Intronic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
925436330 2:3841189-3841211 GACACACATGAGTATCCTTAGGG + Intronic
926276726 2:11409183-11409205 GCATCAGATTAGTCTCCTTCGGG - Intergenic
928001450 2:27526365-27526387 GAGACAGAGGGGTCTCCATCTGG + Intergenic
933529078 2:83483127-83483149 CAAATAGATGTGTCCCCTTCTGG - Intergenic
933727038 2:85433004-85433026 GAAAAAGCAGAGTCTCCTTAGGG - Intronic
939020917 2:136957215-136957237 GGAAGAAATGAGTCTCTTTCTGG - Intronic
939334224 2:140804122-140804144 GAAACAGAAGAGACTCCTTAAGG + Intronic
939962010 2:148573445-148573467 CTAACAGAAGAGTCTCCATCTGG + Intergenic
940496228 2:154432604-154432626 GAAAAAGATGATTCTCCCTTAGG - Intronic
940999659 2:160188442-160188464 CAAATAGATGATTCTCCTTCAGG + Intronic
942675428 2:178421729-178421751 GAAACTGATGAGTCTCTTCTTGG + Intergenic
943574591 2:189616253-189616275 CAAGAAAATGAGTCTCCTTCTGG + Intergenic
944902260 2:204227476-204227498 GAAAAAGCTGTGTCTCCTTTGGG - Intergenic
948387591 2:237591246-237591268 GTAACAGAAGAGTCTCCTCCAGG + Exonic
948718583 2:239882044-239882066 GAAACACACGAGGCTCCCTCAGG + Intergenic
1170064956 20:12300927-12300949 AAACCAGATGAGTCTTCCTCTGG + Intergenic
1170404025 20:16017664-16017686 GAAACAGATGTTTCTCCTTAGGG - Intronic
1170904259 20:20498233-20498255 AAGAATGATGAGTCTCCTTCTGG + Intronic
1172806905 20:37618591-37618613 AAAACAGAGGAGTCACCATCGGG + Intergenic
1172945959 20:38689542-38689564 GGAATAGATGAGTTTCCTGCAGG - Intergenic
1174991157 20:55511473-55511495 AAAACAGATGAGTCTCTTAATGG - Intergenic
1178928838 21:36799324-36799346 CACACAGGTGAGTCTACTTCTGG + Intronic
1180197086 21:46203449-46203471 GCAACAGCAGATTCTCCTTCAGG + Intronic
1181795674 22:25307445-25307467 GAAACAGATGAGTGTTTGTCTGG - Intergenic
1182909441 22:33969373-33969395 GAAACAAATGATTTTCTTTCAGG + Intergenic
1182964589 22:34509336-34509358 TAAGCATGTGAGTCTCCTTCTGG - Intergenic
1183867335 22:40714275-40714297 GAAACAGAGCAGTCTCCATGGGG + Intergenic
949260359 3:2098312-2098334 GAAACAGATGCTTCTGCGTCTGG - Intergenic
950160099 3:10754078-10754100 GCAACTGAGGAGTCACCTTCAGG + Intergenic
953167460 3:40477884-40477906 GAGACAGATCAGTCTCATTGTGG + Intronic
955159661 3:56451903-56451925 GAAACAGATGAGGGCCTTTCTGG + Intronic
956573159 3:70719560-70719582 GAGACAGATCAGTCTTCTCCAGG + Intergenic
956660844 3:71595693-71595715 TAAACAGTTTGGTCTCCTTCTGG + Intergenic
957138718 3:76324845-76324867 AAAACAGATCAGTCTCCTTTGGG + Intronic
957527519 3:81396034-81396056 GTCACAGAAGAGTCTCCGTCTGG + Intergenic
958019978 3:87982908-87982930 GAAACAGATGAGGCTCCTTGAGG - Intergenic
959792511 3:110380004-110380026 GAAAATGATGAGTGTCCTGCAGG + Intergenic
960484148 3:118230266-118230288 GAAACAGACTAGTCTCTTCCAGG + Intergenic
962299304 3:134223905-134223927 GAAACAAATCACTCTCCTACAGG + Intronic
963712637 3:148764845-148764867 TAAACTGAAGATTCTCCTTCAGG + Intergenic
964071872 3:152645341-152645363 GAAACAGATGATCCTCTTTTTGG - Intergenic
964259466 3:154818999-154819021 GAAACAGTTGTGTCTTTTTCTGG - Intergenic
964549335 3:157869436-157869458 GAAAAAGAAGAATCTCCTCCAGG - Intergenic
968950817 4:3690478-3690500 GAAGCAGGTGAGCCTCCTGCAGG + Intergenic
971241211 4:24890620-24890642 GAAAAATATGATTCCCCTTCTGG + Intronic
972138883 4:35930507-35930529 GAAACAGATGAGTTTTCTCAAGG - Intergenic
972902245 4:43699838-43699860 GAAAGAGAAGAGTCTCTTCCTGG - Intergenic
976543647 4:86307652-86307674 GAAACATATGACTCACATTCAGG + Intronic
977015318 4:91684814-91684836 GAAACAAATGATTCCTCTTCAGG - Intergenic
981182722 4:141764534-141764556 GAAATAGATGAGGCTCCAACTGG + Intergenic
981849113 4:149207289-149207311 AATACATATGAGTCTCCTTTTGG + Intergenic
981955450 4:150466976-150466998 GAAACAGATGATTCTGTATCTGG + Intronic
983014101 4:162588543-162588565 AATACAGATGATTTTCCTTCAGG + Intergenic
983120909 4:163883455-163883477 TAAAGAGATGGGTCTCCTACTGG - Intronic
983505456 4:168548053-168548075 CAAACAAAAAAGTCTCCTTCAGG + Intronic
985921066 5:2974655-2974677 GAAATAAATGAGTCTCCTAGAGG - Intergenic
986131782 5:4938950-4938972 GAAAGAGAAGAGTCAGCTTCAGG - Intergenic
989217203 5:38917675-38917697 GAAACAAATGTGTCTTCCTCTGG + Intronic
989353364 5:40514267-40514289 GCAAGAGATGAGTCTCCTTTAGG - Intergenic
993351772 5:86858527-86858549 GAAACATATGCCTCTCCTTCTGG + Intergenic
993545755 5:89211153-89211175 GAAACAAACCAGTTTCCTTCAGG + Intergenic
995277713 5:110295766-110295788 CAAACAGATGATTCACATTCCGG - Intronic
996379853 5:122852315-122852337 GAAACAGAAGAGTCACTCTCAGG - Intronic
996844404 5:127883611-127883633 GAAACAGATGCTTATCCTTGCGG - Intergenic
997363346 5:133309492-133309514 GGAACAGGTGACTCTCCTCCAGG - Intronic
997696823 5:135867583-135867605 TAAACAGAAGAGCCTTCTTCTGG - Intronic
999417462 5:151411475-151411497 ACATCAGATTAGTCTCCTTCTGG + Intergenic
1001942403 5:175750119-175750141 GAAACTGATGAGTGGGCTTCAGG - Intergenic
1005007764 6:21307169-21307191 GAAACAACTGAGATTCCTTCAGG + Intergenic
1008888307 6:56455519-56455541 AAATCAGATGAGACTCTTTCTGG - Intergenic
1009565177 6:65303680-65303702 AAAACTGATGATTCTACTTCAGG + Intronic
1010657421 6:78527508-78527530 GAAAGAGATGATGCTCCTTTTGG + Intergenic
1011197506 6:84796840-84796862 TAAACAGTTGAATGTCCTTCTGG + Intergenic
1013037051 6:106395703-106395725 CAAATAGATGGGACTCCTTCAGG - Intergenic
1013362177 6:109404232-109404254 TGAACAGATCAGTCTCCTACTGG + Intronic
1014608243 6:123506004-123506026 GAAACATATGAGTTTACTGCAGG - Intronic
1014780348 6:125558378-125558400 GAAAAAGATAAGCCTCCTTGTGG - Intergenic
1020882475 7:13779157-13779179 CTCACAGATGAGTCCCCTTCCGG - Intergenic
1022472391 7:30689692-30689714 GGAACTGATGGGTGTCCTTCAGG + Intronic
1022777335 7:33541194-33541216 GAAGGAGGTGAGTTTCCTTCAGG - Intronic
1024124408 7:46277447-46277469 GAAACAGATGAGTGATCATCAGG - Intergenic
1030836102 7:114288103-114288125 GAAACAGGTAAGTGTCCTTTTGG + Intronic
1031753291 7:125605413-125605435 GAAACAGATGAGTCATCTTGTGG - Intergenic
1035086699 7:156265557-156265579 GAAACAGAACAGTCTCCACCAGG - Intergenic
1035713882 8:1739245-1739267 GAAACAGATGAGTTTCCTGATGG + Intergenic
1037094307 8:14965008-14965030 GACACAAATGAGTCTCCTCCTGG - Intronic
1037242974 8:16798546-16798568 GAAACAGATGAATAAACTTCTGG + Intergenic
1037276687 8:17187918-17187940 GAAACAGATGACTCACAGTCTGG - Intronic
1039123274 8:34172817-34172839 GAAACAGGTGAGTGTACTTTTGG + Intergenic
1041978904 8:63832468-63832490 GACAAAGATGAGTTTACTTCAGG + Intergenic
1042510955 8:69610403-69610425 GAAACAGGTTTGTCTGCTTCTGG - Intronic
1044929303 8:97236499-97236521 GATGCAGATGAGCCTCCTTGGGG + Intergenic
1045238378 8:100376301-100376323 GGAACAAATGACTCTCGTTCAGG - Intronic
1046538577 8:115549057-115549079 GAAACAGATGAGAGACATTCTGG + Intronic
1046655243 8:116886760-116886782 GCAACAGTGGAGTCTACTTCTGG + Intergenic
1046691054 8:117284678-117284700 AAAACAGAAGAGTATTCTTCAGG - Intergenic
1050196582 9:3090692-3090714 GGAAAAGAAGAGTCTACTTCAGG - Intergenic
1050342972 9:4659267-4659289 GAAACAGATAGGTCACTTTCTGG + Intronic
1051154733 9:14128735-14128757 GAAACAGAACAGTGTCGTTCTGG + Intronic
1051339617 9:16099469-16099491 GAAACAGCTGATTCGTCTTCAGG - Intergenic
1055513519 9:77016679-77016701 GGAACAGCAGAGTCTCCTTTTGG - Intergenic
1056662491 9:88554760-88554782 GAAAAAGAGGAGCCTCATTCAGG - Intronic
1056737864 9:89225182-89225204 CAAGCAGATGTGTGTCCTTCGGG - Intergenic
1061354364 9:130093006-130093028 TAAACACATGGGTCTCATTCAGG + Intronic
1062423939 9:136497540-136497562 GAAACAGGGGTGTCTCCTCCTGG + Exonic
1187762614 X:22604387-22604409 GAAACAGAACAGTTTCATTCAGG - Intergenic
1194143570 X:90235241-90235263 GAAACAGATGAATGTCCTAATGG - Intergenic
1197147838 X:123188610-123188632 ACAACAGATGAGTCTCAATCTGG + Intronic
1197564701 X:128067973-128067995 TAAACAGATGAGTTTCCATCAGG + Intergenic
1199965414 X:152816440-152816462 GGAACAAATGAGTCTCCATATGG + Intergenic
1200489323 Y:3804562-3804584 GAAACAGATGAATGTCCTAATGG - Intergenic