ID: 1129553651

View in Genome Browser
Species Human (GRCh38)
Location 15:76481024-76481046
Sequence AAAAAGTAGAATAGTGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1515
Summary {0: 1, 1: 1, 2: 17, 3: 142, 4: 1354}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129553651_1129553655 19 Left 1129553651 15:76481024-76481046 CCCGGCCCACTATTCTACTTTTT 0: 1
1: 1
2: 17
3: 142
4: 1354
Right 1129553655 15:76481066-76481088 ACATTTATTCTCAGCCAATCTGG 0: 1
1: 0
2: 2
3: 30
4: 521

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129553651 Original CRISPR AAAAAGTAGAATAGTGGGCC GGG (reversed) Intronic
900678302 1:3901868-3901890 AAAGAAAAGAACAGTGGGCCTGG - Intergenic
900807970 1:4780314-4780336 GAAGAGTAGAATTGGGGGCCAGG - Intronic
900905611 1:5555002-5555024 TAAATGGAGAATAGTGGGGCAGG - Intergenic
901116235 1:6847162-6847184 AAAAAGTAGAAAAATAAGCCAGG - Intronic
901408818 1:9068438-9068460 AAAAAAAAAAAGAGTGGGCCTGG - Intronic
901432975 1:9229143-9229165 AAAAAATACAAAAATGGGCCAGG + Intergenic
901610391 1:10493586-10493608 AAAAAATATAAAAATGGGCCAGG - Intronic
901614454 1:10527222-10527244 AAAAAGAAAATTTGTGGGCCAGG + Intronic
901688284 1:10956770-10956792 AAAAAGTAAAATCATCGGCCGGG - Intronic
902271203 1:15306544-15306566 AAAAAGTGGTTTTGTGGGCCAGG + Intronic
902309967 1:15574671-15574693 AATAAGTAGAAAATGGGGCCAGG - Intronic
902325777 1:15699694-15699716 AATAAATAGGAGAGTGGGCCGGG + Intronic
902407617 1:16194053-16194075 TAAAAATAAAATAGTTGGCCAGG + Intergenic
902411818 1:16216247-16216269 ATAAAGTAGAAAAGGGGGCTTGG + Intergenic
903463943 1:23539104-23539126 AAAAAGTAGATTAGTGGGGCTGG + Intergenic
903495775 1:23766146-23766168 AAAAAATAAAATATTAGGCCAGG + Intergenic
903537916 1:24079554-24079576 TAAAAGTAGAATCCTGTGCCAGG - Intronic
903596704 1:24501047-24501069 AAAAAGTAGAAAAATTAGCCAGG + Intergenic
903698834 1:25231099-25231121 AAAATGTAAGATACTGGGCCGGG - Intronic
903869712 1:26425036-26425058 ATAAAATAGAACAGAGGGCCGGG - Intronic
903940924 1:26930719-26930741 AAAAAAAAAAATAGTGGGCTGGG + Intronic
903982915 1:27202878-27202900 AAAAATAAGAATAATGGGCTGGG + Intergenic
904144831 1:28381596-28381618 AAAAAGTAAAAAAATAGGCCAGG - Intronic
904386199 1:30143696-30143718 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
904640298 1:31922187-31922209 AAAAAATAAAAAAGTTGGCCGGG + Intronic
904652710 1:32017900-32017922 AGAAAGTAGAAAAATAGGCCGGG - Intronic
904726609 1:32553588-32553610 AAAAAGTAGAATTCTGGGGCCGG + Intronic
904726662 1:32553902-32553924 AAAAGGTAGAATTTTGGGCCGGG + Intronic
904731531 1:32595951-32595973 AAGAAGTAAAATGATGGGCCAGG - Intronic
904779539 1:32935123-32935145 AAAAAATAAAATAATGGGCTGGG - Intergenic
904780816 1:32946165-32946187 TAAAGGTAGAATGCTGGGCCAGG - Intronic
904844854 1:33403114-33403136 AAAAAAAAAAAAAGTGGGCCGGG - Intronic
905053271 1:35071491-35071513 AAAAATTAGAAAAGTTAGCCAGG - Intronic
905153403 1:35951547-35951569 AAAAAGTAGAAAAATTAGCCAGG - Intronic
905163331 1:36057033-36057055 AAGAAAAAGAATAGTAGGCCGGG - Exonic
905189530 1:36222966-36222988 AAAAAGTAGAAAAATTAGCCGGG + Intergenic
905209942 1:36367141-36367163 AGAATGTAGAAGAGTTGGCCAGG - Intronic
905398651 1:37685368-37685390 AAAAAAAAGAATTTTGGGCCAGG - Intronic
905406832 1:37739367-37739389 AGAAAGTAGAATAGTAGGCCAGG + Intronic
905433534 1:37941641-37941663 AAAAAATAAAATAAAGGGCCGGG + Intronic
905819455 1:40978805-40978827 AAAAATAATAATAGTAGGCCGGG - Intergenic
905836269 1:41124753-41124775 AAAAAATAGAAAAATTGGCCAGG - Intronic
906023821 1:42656023-42656045 AAAAAGTACAAAAATGAGCCAGG - Intergenic
906170392 1:43720080-43720102 AAAAAATAGAATAATTGGCTAGG + Intronic
906393487 1:45440110-45440132 AAAAAGTACAAAAGTTAGCCAGG - Intronic
906667189 1:47630321-47630343 AAACAGGAGCATAGTGGGCCAGG + Intergenic
906735711 1:48125104-48125126 AAAAAGTAAAAAAGTGGGCTGGG + Intergenic
906750671 1:48256545-48256567 AAAAAGCTGAATAGAGGGCAGGG + Intergenic
907026118 1:51121293-51121315 AGACAGTAGAATGGTGGGCTGGG - Intronic
907296264 1:53457506-53457528 AAAAATATGATTAGTGGGCCGGG - Intergenic
907347889 1:53798848-53798870 AAAAAGTCATATAATGGGCCAGG - Intronic
907522273 1:55031959-55031981 AAAAAGTGGTTTTGTGGGCCAGG + Intergenic
907890902 1:58635728-58635750 AAAAAGTGGTTTTGTGGGCCGGG + Intergenic
908149023 1:61280651-61280673 AAAAAGCAGACTAGTTGGACAGG - Intronic
908545645 1:65159672-65159694 AAAAAGAAAAAAAGTTGGCCGGG + Intronic
908744582 1:67363194-67363216 AAAAATAAGAATAATTGGCCAGG - Intronic
909274373 1:73666046-73666068 AAAATGTGGTTTAGTGGGCCAGG + Intergenic
909288408 1:73850819-73850841 AAAATGTAGAATAATATGCCTGG - Intergenic
909422788 1:75484975-75484997 AAAAAGTGGTTTTGTGGGCCAGG - Intronic
909441106 1:75697489-75697511 AGAAAATAGAAAAGTAGGCCAGG + Intergenic
909660414 1:78075961-78075983 AAACATTAGAAGAGTGGGCCTGG - Intronic
909767966 1:79381748-79381770 AAATAGTAAAATAGTGTGACTGG + Intergenic
909807034 1:79884475-79884497 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
909853200 1:80495584-80495606 AAAAAGCAGATTTTTGGGCCGGG - Intergenic
910076661 1:83288426-83288448 AGAAAGTAAAATAGTGGGTGGGG + Intergenic
910165524 1:84323880-84323902 ACAAAGCAGAAGAGTGGGCTAGG - Intronic
910460985 1:87447686-87447708 TAAAAGTAGGCTGGTGGGCCGGG - Intergenic
910631771 1:89362845-89362867 AAAATGTAAAATTCTGGGCCAGG - Intergenic
910958141 1:92730203-92730225 AAAAAGTACAAAAGTTAGCCAGG + Intronic
911262494 1:95702314-95702336 AAAAAAAAAAAAAGTGGGCCAGG - Intergenic
911563444 1:99434235-99434257 AAAAATCAGTAGAGTGGGCCGGG + Intergenic
911697672 1:100910683-100910705 AAAAAGTAGAAGAAAGGGTCTGG - Intronic
911704197 1:100991799-100991821 AAAAAGTCTCACAGTGGGCCAGG + Intronic
912263613 1:108132571-108132593 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
912579180 1:110704775-110704797 AAAAAGTGGTTTTGTGGGCCGGG - Intergenic
912652778 1:111454600-111454622 AAAAAATAGAAAAATGAGCCGGG - Intronic
912788402 1:112626444-112626466 AAAAATTAAAATGGTGGGACAGG + Intronic
913166112 1:116187227-116187249 AAAAAATAGAACAATAGGCCAGG - Intergenic
913307751 1:117450610-117450632 AAAAAGTGGTTTCGTGGGCCAGG + Intronic
913336898 1:117717055-117717077 AAAAAGTGGTTTTGTGGGCCAGG + Intergenic
913458967 1:119063561-119063583 AAAAAGTGGTTTTGTGGGCCAGG + Intronic
913534506 1:119758392-119758414 AAAAAGTACAAAAGTTAGCCAGG - Intronic
913970603 1:143412829-143412851 AAAAAAAAGAAAAGTTGGCCGGG - Intergenic
914064979 1:144238440-144238462 AAAAAAAAGAAAAGTTGGCCGGG - Intergenic
914114172 1:144727914-144727936 AAAAAAAAGAAAAGTTGGCCGGG + Intergenic
914318224 1:146534021-146534043 TAAAAGTAGGCTGGTGGGCCGGG - Intergenic
914496135 1:148199335-148199357 TAAAAGTAGGCTGGTGGGCCGGG + Intergenic
914674462 1:149897827-149897849 AAAAAAAAGAATTTTGGGCCAGG + Intronic
914685359 1:149974015-149974037 AAAAAATAGAAAACTTGGCCGGG - Intronic
914769128 1:150667887-150667909 AAAGAAAAGACTAGTGGGCCGGG - Intronic
914862192 1:151396175-151396197 AAAAAGTGGAGTAGTGGCCCGGG + Intergenic
914890662 1:151619594-151619616 AAAAAATACCAGAGTGGGCCCGG - Intronic
914920359 1:151842774-151842796 AGAAAGTAAAATGGGGGGCCAGG - Intergenic
914936638 1:151987293-151987315 AAAAAGAGGAACACTGGGCCGGG - Intronic
915031250 1:152882129-152882151 AAAAAATAGAAAAATGGGCATGG - Intronic
915058474 1:153158990-153159012 AAAAAATTGTTTAGTGGGCCAGG - Intergenic
915139613 1:153759122-153759144 AAAAAATAGAAAAATGAGCCAGG + Intronic
915199553 1:154216807-154216829 AAAAAGTTTAAAAATGGGCCAGG - Intronic
915349584 1:155216068-155216090 AAAAAATAGAAAAGTTAGCCGGG - Intergenic
915350414 1:155221389-155221411 AAAAAGAAGAAAAGAGGGGCGGG - Intergenic
915404544 1:155649544-155649566 AAAAAATAGTATATAGGGCCAGG - Intergenic
915413316 1:155720162-155720184 AAAAAGTAAAAAAATGAGCCAGG + Intronic
916080945 1:161231795-161231817 AAAAAATTAAAAAGTGGGCCGGG - Intronic
916182588 1:162099480-162099502 AAAAAGTCCAAAAGTAGGCCAGG - Intronic
916548871 1:165830741-165830763 AAAAAGTCCAAGACTGGGCCTGG + Intronic
916721550 1:167488033-167488055 AGAAAGTAGTATTGTGGGGCTGG - Intronic
917094432 1:171385927-171385949 TAAAAGGGGAACAGTGGGCCGGG - Intergenic
917102606 1:171461114-171461136 CAAAAGAAAAATTGTGGGCCAGG + Intergenic
917229889 1:172824254-172824276 AAAAAGCAAAAAAGTGGGGCAGG + Intergenic
917396662 1:174601218-174601240 AAAAAGTAGTTTTGTGGGCTGGG - Intronic
917402812 1:174669807-174669829 AAGAAACAGAATAGAGGGCCTGG - Intronic
917409303 1:174741876-174741898 AAAAAGTAGAAAAATTAGCCAGG + Intronic
917477142 1:175378694-175378716 AAGAAGCAGACTTGTGGGCCTGG + Intronic
917681858 1:177375602-177375624 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
917766138 1:178219478-178219500 AAAAAGTAGAAAAATTAGCCAGG + Intronic
917919271 1:179736512-179736534 AAAAAGTCAAAAGGTGGGCCAGG + Intergenic
917954611 1:180081161-180081183 AAAAAGCAGTACAGTGGGCCGGG - Intronic
918049233 1:180959785-180959807 AAAAAGTGGTTTCGTGGGCCAGG - Intergenic
918599737 1:186342266-186342288 AAAAAATAATATAATGGGCCGGG - Intronic
918711569 1:187737150-187737172 AAAAAGTAGTTTTGTGGGCTGGG - Intergenic
918718180 1:187818329-187818351 AAAAAGTAGTTTTGTGGGCTGGG - Intergenic
918806156 1:189048212-189048234 AAAAAATGGAATCATGGGCCTGG - Intergenic
919081098 1:192866740-192866762 AACAAATATAATAGTGGTCCTGG + Intergenic
919852246 1:201680814-201680836 AGAAAGGAGAATGGTGGGCAGGG + Intronic
919913711 1:202127609-202127631 AGAAATTATAATAATGGGCCGGG - Intronic
920896004 1:210049890-210049912 AAAAAGTGGTTTTGTGGGCCAGG - Intronic
921560618 1:216653960-216653982 AAAAAGTAGAAAAATAAGCCAGG + Intronic
921929060 1:220739239-220739261 AAAAAGTATAAAAGTAAGCCAGG - Intergenic
922300697 1:224297439-224297461 AAAAAGTAGAATGGTGGTGATGG + Intronic
922344777 1:224687391-224687413 AAAAAATAAAAAAGTCGGCCAGG - Intronic
922617647 1:226972392-226972414 AAAAAGCAGGTCAGTGGGCCAGG + Intronic
922928018 1:229366755-229366777 AAAAAATAAAATAGTTAGCCAGG + Intergenic
922977072 1:229794030-229794052 AAAAAGTATAAAAGTCAGCCAGG + Intergenic
923159864 1:231306694-231306716 AAAGAGTAGAAAGGTCGGCCGGG - Intergenic
923361361 1:233214555-233214577 AAAAACTAGAGCAGTGTGCCCGG - Intronic
923655638 1:235913793-235913815 AGAAAGTAGCAAATTGGGCCAGG + Intergenic
923939380 1:238803498-238803520 AAAAAGTAAAAAATTGGGCCAGG + Intergenic
924104979 1:240640621-240640643 AAAAAGTAGAATATTTAGGCCGG + Intergenic
924733082 1:246730067-246730089 AAAAAGTAGAGTAGTTGGAAGGG - Intronic
1063642540 10:7844669-7844691 AAAAAGAAGAAAAGCTGGCCAGG - Intronic
1063698332 10:8359410-8359432 AAAAATAAGAATAATAGGCCAGG + Intergenic
1063899645 10:10719251-10719273 AAAAAGTATAATAATAGGCCGGG - Intergenic
1064051431 10:12063256-12063278 AAAAAGTACAAAAATGAGCCTGG + Intergenic
1064202443 10:13296279-13296301 AACAAGTGCATTAGTGGGCCGGG + Intronic
1064236919 10:13584836-13584858 AAAAAGTGAAATATTGGGACTGG - Intergenic
1064461418 10:15538215-15538237 AAAAAGTTCTATAGTTGGCCAGG + Intronic
1064735734 10:18379980-18380002 AGAAGGTAGAATAGTGGGCCAGG - Intronic
1064767683 10:18691718-18691740 AAAAAGTAAAAAAGTAGGCTGGG + Intergenic
1065181815 10:23133832-23133854 AAAAAAAAGAATAGTGGGCATGG + Intergenic
1065347783 10:24765183-24765205 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
1065753937 10:28913538-28913560 AAAAAGTAGAAAAATTAGCCAGG + Intergenic
1065994906 10:31049238-31049260 AAAATATAGGATAGTAGGCCTGG + Intergenic
1066002807 10:31119996-31120018 AAAAAGTAAAAATGTTGGCCAGG - Intergenic
1066062527 10:31736681-31736703 AAAAAGTGGTTTCGTGGGCCAGG - Intergenic
1066429807 10:35340797-35340819 AAAAATGAAAAGAGTGGGCCAGG - Intronic
1066448722 10:35508919-35508941 AAACAGTAGACTAGTGGGGGAGG - Intronic
1066975164 10:42361635-42361657 AAAAAGTAGAAGAGAGAGGCCGG + Intergenic
1067480481 10:46593609-46593631 AAAAAAAAGTATAGTGTGCCTGG + Intronic
1067614257 10:47748190-47748212 AAAAAAAAGTATAGTGTGCCTGG - Intergenic
1068268576 10:54688193-54688215 AAAGAGTAGAATAATGGGAGTGG + Intronic
1068350935 10:55844431-55844453 AAAAAGTAGCAAACTAGGCCAGG + Intergenic
1068474212 10:57505236-57505258 AGAGAGTAGAATTGTGGGCTGGG - Intergenic
1068676869 10:59777840-59777862 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
1069008351 10:63343740-63343762 AAAAATTAATTTAGTGGGCCAGG + Intronic
1069011378 10:63377217-63377239 CGAAAGTAGAATGGTGGGCCAGG + Intronic
1069027281 10:63556415-63556437 AAAAAATAGAATCATAGGCCAGG - Intronic
1069069978 10:63983164-63983186 AAGAAGTTGTATTGTGGGCCGGG + Intergenic
1069126343 10:64640139-64640161 AAAAAGTATATTTGTAGGCCGGG + Intergenic
1069488801 10:68843883-68843905 TAATAGTTGGATAGTGGGCCGGG + Intronic
1069497186 10:68916058-68916080 AAAAAGAAGCTTTGTGGGCCGGG + Intronic
1069710891 10:70487898-70487920 AGAAAGTAGATGAGTGGGCCTGG - Intronic
1069804105 10:71107166-71107188 AAAAAGTGGTTTCGTGGGCCAGG + Intergenic
1069917291 10:71795571-71795593 AAAAGGTAGCAAAGTGGGCAAGG - Intronic
1069957008 10:72058169-72058191 AAAAAATAGAATCATGGGCCGGG + Intergenic
1070102732 10:73403326-73403348 AAAAAGTAAAATAATTAGCCAGG + Intronic
1070103400 10:73410486-73410508 AAAAAGTCAAAAAATGGGCCGGG + Intronic
1070521252 10:77255616-77255638 AAAAAATATAAAAGTGGGCTGGG + Intronic
1070623496 10:78032168-78032190 AAAAAGAAAAATAGTCGGCCGGG + Intergenic
1070869736 10:79740313-79740335 AAAAAGTATAAAAATGAGCCAGG - Intergenic
1071484555 10:86090268-86090290 AAAAAAAAAAATAGTGGGCATGG + Intronic
1071521916 10:86336837-86336859 AAAAAAAAAAATAGTGGGCCAGG - Intronic
1071706269 10:88002441-88002463 AAAAAGGAGGATTTTGGGCCGGG - Intergenic
1072239741 10:93484457-93484479 AAAAATCAGGAGAGTGGGCCAGG - Intergenic
1072332983 10:94371691-94371713 AAAAAGAAGATAAGGGGGCCGGG + Intergenic
1072340637 10:94445063-94445085 AAAAACTTGATGAGTGGGCCGGG + Intronic
1072412566 10:95217052-95217074 AGAAAATAGAGAAGTGGGCCAGG + Intronic
1072585893 10:96781736-96781758 AAAAATTGGATTATTGGGCCGGG - Intergenic
1072589760 10:96818686-96818708 AAAAAGTAAAATAGTTGGCCAGG - Intergenic
1072708117 10:97696814-97696836 AAAAGGTGGAATGGAGGGCCCGG + Intergenic
1072919286 10:99562248-99562270 AAAAAGTAGAACCATGGGCCTGG - Intergenic
1072922436 10:99587843-99587865 AGACAGTAGGATTGTGGGCCAGG - Intergenic
1072927859 10:99632189-99632211 AAAAAATAACATACTGGGCCAGG - Intergenic
1072995991 10:100244648-100244670 AAAAAATAAAATAACGGGCCAGG - Intronic
1073261602 10:102194807-102194829 AAAAAATGGAAAGGTGGGCCAGG - Intergenic
1073274386 10:102296747-102296769 AAAAAAAAGAATTGTAGGCCAGG + Intronic
1073401289 10:103259766-103259788 AAAAAATAGTTTAGTGGGCCAGG + Intergenic
1073485484 10:103815593-103815615 AGAAAGAAAAATACTGGGCCAGG + Intronic
1073494214 10:103876702-103876724 AAAAAGTACAAAAGTTAGCCAGG - Intergenic
1073682107 10:105716042-105716064 AAAAAGTGGGAGAGTGAGCCAGG - Intergenic
1074025274 10:109627412-109627434 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
1074396915 10:113105553-113105575 AAAAAGGAGAGAAATGGGCCTGG - Intronic
1075036601 10:119074635-119074657 AAAAAATAGAAAAATGGGGCCGG + Intronic
1075193287 10:120330918-120330940 AAAAAGTAAAATAGGTGGTCAGG - Intergenic
1075543711 10:123337506-123337528 AAAAAGTTGTTTTGTGGGCCAGG - Intergenic
1075948387 10:126457147-126457169 AAAAAGTACAAAAATTGGCCAGG - Intronic
1076225658 10:128773036-128773058 AAAAAGTGGTTTTGTGGGCCAGG + Intergenic
1077260884 11:1619574-1619596 AAAACATAGCATTGTGGGCCTGG - Intergenic
1077320915 11:1941609-1941631 AAAAAATAGACAAGTGAGCCAGG - Intergenic
1077449303 11:2626687-2626709 AAAAAATAAAATAATTGGCCAGG - Intronic
1077735097 11:4782713-4782735 AAAAAGTGGTATATTGGGCCAGG + Intronic
1077998157 11:7471667-7471689 AGAAAGTAGAATAGTGGGGCTGG - Intergenic
1078228960 11:9421254-9421276 AAAAATTAGAATTCTGGGCCGGG - Intronic
1078259921 11:9695953-9695975 AAAAAATACAAAAGTGAGCCAGG - Intronic
1078345859 11:10547774-10547796 TAAAAGAAGAATATTGGACCAGG - Intergenic
1078598443 11:12710029-12710051 AAAAAATGGAATTGTAGGCCAGG + Intronic
1078666013 11:13325907-13325929 AAAGAGTAGAACAAGGGGCCGGG + Intronic
1079196058 11:18328213-18328235 AAAAAAAAGAATATGGGGCCAGG + Intronic
1079838691 11:25367068-25367090 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
1080008429 11:27433524-27433546 AAAGAATAGAAGAGTGGGCCGGG - Intronic
1080153342 11:29078537-29078559 AAAAAGTGGTTTTGTGGGCCTGG + Intergenic
1080325616 11:31069144-31069166 AAAAAATACATTAATGGGCCAGG - Intronic
1080374197 11:31688344-31688366 AATAAGTAGAAAATTGGTCCTGG - Intronic
1080379713 11:31755744-31755766 AAAAAGAATATTAGTGGACCTGG + Intronic
1081008231 11:37774644-37774666 AAAAAGTAGTTTCGTGGGCCGGG - Intergenic
1081209779 11:40318521-40318543 AGAAAGTAAAATAATGGGCTTGG - Intronic
1081472471 11:43388676-43388698 AAAACATAGAAAAGTTGGCCAGG + Intronic
1081519731 11:43870279-43870301 TAAAATTAGATCAGTGGGCCGGG + Intergenic
1081848953 11:46261515-46261537 TAAAAATTGAACAGTGGGCCAGG + Intergenic
1081908304 11:46683197-46683219 AAAAAGTAGAAAAAAGAGCCGGG - Intronic
1081985970 11:47304523-47304545 AAAAAATACAATAGAGGGCCAGG - Intronic
1083484721 11:62976207-62976229 AAAAAGGACAATAGCTGGCCAGG - Intronic
1083604233 11:63968131-63968153 AAAAAGTAGGATAGGGAGCCAGG - Intergenic
1083806006 11:65074366-65074388 AAAAAGGAGGAAATTGGGCCAGG - Intronic
1083907318 11:65681539-65681561 AAAAAGTAGCAAATGGGGCCAGG - Intergenic
1084058883 11:66656433-66656455 AAAAAATAGAAAATTAGGCCAGG - Intronic
1084129788 11:67124605-67124627 AAAAAAAAAAAAAGTGGGCCAGG - Intronic
1084134351 11:67164891-67164913 AAAAAGTACAATAGCAGGCCAGG - Intronic
1084202993 11:67574577-67574599 AAAAAGTACAATAATTAGCCGGG - Intergenic
1084284845 11:68124345-68124367 AAAAAATAAAATAATTGGCCAGG + Intergenic
1084745367 11:71166776-71166798 AAAAAAAAGAAGTGTGGGCCCGG - Intronic
1084852587 11:71954688-71954710 AAAATCTGGAATACTGGGCCAGG - Intronic
1085226306 11:74924178-74924200 AAAAAGAGTAAGAGTGGGCCGGG + Intronic
1085373145 11:76030541-76030563 AAAAAAGTAAATAGTGGGCCAGG - Intronic
1085906805 11:80774178-80774200 AAAAAGTGGTTTCGTGGGCCAGG + Intergenic
1085987097 11:81800738-81800760 AAAAAGTGGTTTTGTGGGCCGGG + Intergenic
1086592608 11:88533836-88533858 AAAAAGTGGTTTCGTGGGCCAGG + Intronic
1086604964 11:88685616-88685638 AAAAAGTAGTTTCCTGGGCCTGG + Intronic
1086611021 11:88755875-88755897 CAAAAGTAGGATACTGTGCCAGG + Intronic
1086923236 11:92611688-92611710 AAGAAATAGAAGGGTGGGCCAGG - Intronic
1087435075 11:98106163-98106185 AAAAAGTAGATTAAGAGGCCAGG + Intergenic
1087455127 11:98375114-98375136 TAAAAGTTAAATAGTGGGACAGG - Intergenic
1087768440 11:102181148-102181170 AAAAAATAAAATAATAGGCCAGG + Intronic
1087908318 11:103724748-103724770 AAAAAATGGTTTAGTGGGCCAGG - Intergenic
1087959681 11:104333034-104333056 CAAAAGTAGAAAATTAGGCCAGG - Intergenic
1088377687 11:109159964-109159986 AAAAAGTGGCTTTGTGGGCCAGG - Intergenic
1088426989 11:109714960-109714982 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
1088591447 11:111407373-111407395 TAAAAATAGCATAATGGGCCGGG + Intronic
1088704932 11:112453584-112453606 AATAAATAGAATAGTAGGCTGGG - Intergenic
1088869658 11:113879851-113879873 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
1089132410 11:116223009-116223031 GAACTGTAGAATAGTGAGCCTGG - Intergenic
1089731377 11:120521365-120521387 AGAAAGTGGCATTGTGGGCCGGG - Intronic
1089834274 11:121356500-121356522 AAAAAATAGAATAATGTGTCTGG - Intergenic
1089844885 11:121450983-121451005 GAAAAGTACTAGAGTGGGCCGGG + Intergenic
1090292624 11:125558789-125558811 AAAAAGAATAATAATGGGCTGGG + Intergenic
1090298919 11:125616836-125616858 AAAAAGTATAAAAATTGGCCGGG - Intronic
1090713649 11:129411074-129411096 AAAGAATAGCAGAGTGGGCCGGG + Intronic
1090780141 11:130000944-130000966 AAAAAGTAGAAAAATTAGCCAGG + Intronic
1090970890 11:131642019-131642041 AAAATCTAGAATATTGGGGCCGG - Intronic
1091033608 11:132213716-132213738 AAAAAAAAGAATGGTGGCCCAGG - Intronic
1091643997 12:2259773-2259795 AAAAAGTAAAATAATTAGCCAGG + Intronic
1091725512 12:2843962-2843984 AAAAAGTAGTAAACTAGGCCAGG + Intronic
1091742973 12:2973230-2973252 AAAAAGTACAAAAATGAGCCGGG - Intronic
1091966096 12:4743139-4743161 GAAAAGTACCATAGTGGGCATGG - Intronic
1091971398 12:4789923-4789945 AAAGAGTAAAATAATGAGCCGGG + Intronic
1092256968 12:6931736-6931758 AAAAAGAAAACTAGTTGGCCGGG + Intronic
1092326244 12:7534469-7534491 AAAAAGTAGTTTTGTGGGCCAGG + Intergenic
1092344846 12:7706551-7706573 GAAAAGAAAAATAGCGGGCCGGG + Intergenic
1092485896 12:8901757-8901779 AAAAAGTGGTTTCGTGGGCCAGG - Intergenic
1092561448 12:9618355-9618377 AAAAAGACAAATAATGGGCCGGG - Intergenic
1092912597 12:13160625-13160647 AGAAAGGAGATCAGTGGGCCGGG - Intergenic
1093453838 12:19344959-19344981 AAAAAGTACAAAAATTGGCCAGG + Intronic
1093494370 12:19738792-19738814 AAAAAGAATAATAGTGCTCCTGG + Intergenic
1093747677 12:22761754-22761776 TAAAGGTAGAATTTTGGGCCAGG + Intergenic
1093775447 12:23068439-23068461 AAAAATTACAATCTTGGGCCAGG - Intergenic
1093928411 12:24931199-24931221 AAAAAATAGCATCCTGGGCCAGG - Intronic
1094216647 12:27949496-27949518 AAAAAGTAAAATCATGGGCCAGG + Intergenic
1094398237 12:30032046-30032068 AAAAACTAGAACAATTGGCCTGG + Intergenic
1094705810 12:32913437-32913459 AAAAAATACAAAAGTTGGCCAGG - Intergenic
1095136406 12:38609785-38609807 AAAAAGAAAAATACAGGGCCGGG + Intergenic
1095807721 12:46338706-46338728 AATAACTAGAAGAGTGGACCTGG - Intergenic
1095925156 12:47570861-47570883 AAAAAGTACAAAAGTTGGCCAGG + Intergenic
1096066654 12:48746299-48746321 AAAAATTAGATTTGGGGGCCGGG + Intergenic
1096158148 12:49353486-49353508 AAAAAGTACAAAAATGAGCCAGG + Exonic
1096165868 12:49423425-49423447 AAAAAATAGAGTATTAGGCCAGG - Intronic
1096166823 12:49432604-49432626 AGAAAGTAGAATGGTGGGCCAGG - Intronic
1096211758 12:49771558-49771580 AAAAAGTACAAAAATTGGCCAGG + Intergenic
1096213693 12:49786608-49786630 AAAAAATAGAAAATTAGGCCAGG - Intergenic
1096287204 12:50310691-50310713 TTAAAGTATAATAGTTGGCCAGG + Intergenic
1096382129 12:51167898-51167920 AAAAAGTAGAAAAACTGGCCAGG + Intronic
1096468008 12:51858626-51858648 AAAAAAAAAAAAAGTGGGCCGGG + Intergenic
1096654768 12:53081896-53081918 AAAAGGCAGATTAGTGGGCTGGG - Intergenic
1096855905 12:54482699-54482721 AAAAATGAGCAGAGTGGGCCGGG + Intergenic
1097056546 12:56253505-56253527 AATATGTAGAATCCTGGGCCTGG - Intronic
1097400746 12:59124979-59125001 AAAATGTAGTTTTGTGGGCCAGG - Intergenic
1097430245 12:59496853-59496875 AATAAGTAAAATAGTGGCCAGGG - Intergenic
1097519760 12:60652294-60652316 AAAATGGAGAACAGAGGGCCGGG + Intergenic
1097565610 12:61265153-61265175 AAAAAGTGGTTTAGTGGGCTGGG + Intergenic
1097570564 12:61326310-61326332 AAAAAATAGTTTTGTGGGCCGGG - Intergenic
1097625140 12:61990626-61990648 AAAAATTGGCACAGTGGGCCGGG - Intronic
1097643699 12:62211282-62211304 AAAAAGCAGAAAAATGGGCCAGG + Intronic
1097821344 12:64131879-64131901 CAAAAGGAGAGTAGTTGGCCAGG + Intronic
1097832595 12:64241272-64241294 TAAAAATAGAAAAATGGGCCGGG + Intergenic
1097864511 12:64548483-64548505 AAGAAGTAAAATTGTTGGCCAGG - Intergenic
1097999064 12:65921784-65921806 AAAAAGTGGTTTTGTGGGCCAGG + Intronic
1098253983 12:68597925-68597947 AGAAAGTAGAATGGTGGTCAGGG - Intergenic
1098258566 12:68644293-68644315 AAAGAGTGGAACAGTGGGCCGGG + Intronic
1098273994 12:68795499-68795521 ATAAAGTAAAAAAGTTGGCCGGG - Intergenic
1098299292 12:69037737-69037759 AAAACCTTGAAAAGTGGGCCGGG - Intergenic
1098582376 12:72115231-72115253 ATAGAGTAGAATAGTGGGAGGGG - Intronic
1099085957 12:78246147-78246169 AAAAAGTAGAAAAATATGCCAGG - Intergenic
1099334518 12:81336786-81336808 AGAAAATAGAATAGTATGCCAGG - Intronic
1099407865 12:82285186-82285208 AAAAAGTGGTTTTGTGGGCCAGG + Intronic
1100261273 12:92934527-92934549 ATAAATTAGAACATTGGGCCAGG + Intergenic
1100497786 12:95142126-95142148 AAAAAATACAAAAGTGAGCCTGG - Intronic
1100497831 12:95142436-95142458 AAAAAATAGAAAAATGGGCTGGG - Intronic
1100558030 12:95717103-95717125 AAAAAGTGGAAAAGAGGGCCAGG - Intronic
1100939699 12:99712695-99712717 AAAAAGTACAATGGTGGCACAGG + Intronic
1101274188 12:103180921-103180943 AAAAAGCAAATTAGTGGGCTGGG - Intergenic
1101747753 12:107556713-107556735 TAAAAGTGGAATAGTGGGCCGGG + Intronic
1101903584 12:108809294-108809316 AAAAAATAGAAAAGTTAGCCGGG + Intronic
1101942194 12:109107818-109107840 CAAAAATGGAATAGTTGGCCGGG - Intronic
1102117285 12:110412389-110412411 AAAAATTGGAATACTTGGCCAGG - Intergenic
1102248919 12:111372520-111372542 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
1102253346 12:111402382-111402404 AAAAATTCAAAAAGTGGGCCAGG - Intergenic
1102367907 12:112355298-112355320 AAAAAAAAAAATTGTGGGCCAGG + Intronic
1102449277 12:113028744-113028766 AAAAAAAAAAATAGGGGGCCAGG + Intergenic
1102758725 12:115366844-115366866 AAAAAGTGGTTTTGTGGGCCAGG + Intergenic
1102899694 12:116626710-116626732 AAAAAGTAAAATAGATGGTCGGG + Intergenic
1103001488 12:117388558-117388580 AAAAGGTAGACAAATGGGCCGGG - Intronic
1103122783 12:118394844-118394866 AAAAAGTACAAAAATGAGCCAGG - Intronic
1103541236 12:121668026-121668048 AAAAAATACAAAAATGGGCCAGG - Intronic
1103631402 12:122264549-122264571 AAAAAGTACAAAAATTGGCCAGG - Intronic
1103643982 12:122376230-122376252 AAAAAATAAAATAATTGGCCGGG - Intronic
1103646938 12:122401381-122401403 AAAAAGTAGGTCAATGGGCCGGG + Intronic
1103705948 12:122872514-122872536 AAAAAGGAGAATCTTGGGACTGG + Intronic
1103766614 12:123284675-123284697 AAAAACAAGAATAATGGGCCGGG - Intergenic
1103833239 12:123797551-123797573 AAAAAATACAAAAATGGGCCAGG - Intronic
1104003636 12:124876863-124876885 AAAAAGTAGAATTGGAGGCTGGG + Intronic
1104488160 12:129169833-129169855 AAAAGGTAGAATAGTGGAAGTGG - Intronic
1104524065 12:129501663-129501685 AAAAATTACAAAAGTTGGCCAGG - Intronic
1104740512 12:131168874-131168896 AAAAACTGGAATTGTAGGCCGGG + Intergenic
1105332181 13:19428151-19428173 AGAAATTAGAAAAATGGGCCAGG + Intronic
1105372433 13:19813663-19813685 AACAAGTAGAAAACTGGGGCTGG - Intergenic
1105462030 13:20601068-20601090 AGAAAATAGACTAATGGGCCGGG + Intronic
1105526376 13:21181530-21181552 TAAAAGTAGAAAAGTTAGCCAGG + Intergenic
1105657531 13:22456958-22456980 AAAAAATAGTTTTGTGGGCCGGG - Intergenic
1105879624 13:24592615-24592637 AGAAATTAGAAAAATGGGCCAGG - Intergenic
1105920215 13:24956439-24956461 AGAAATTAGAAAAATGGGCCAGG + Intergenic
1106562645 13:30859940-30859962 AAAAATTAGATTAGTGGGCAGGG + Intergenic
1106683628 13:32033718-32033740 AAAAATTAATATAGTGGGCAGGG - Intronic
1106727513 13:32501161-32501183 AATAGTTAGAAAAGTGGGCCAGG - Intronic
1106729493 13:32524921-32524943 AAAAAGTAGAAAAATTAGCCAGG - Intronic
1106886731 13:34193656-34193678 AATAAGTAAAATCCTGGGCCAGG - Intergenic
1107112348 13:36711666-36711688 TAAAAGAAGAATTGTAGGCCAGG - Intergenic
1107142424 13:37015988-37016010 ATAAAGTAGAATAGTGGCCGAGG + Intronic
1107209575 13:37836900-37836922 AAAAAGTGGTTTAATGGGCCAGG + Intronic
1107318613 13:39161444-39161466 AAAAAGTATAAAATGGGGCCGGG + Intergenic
1107498209 13:40949279-40949301 AAAAATTAAAGTATTGGGCCAGG - Intronic
1107575788 13:41720704-41720726 GAAAAGTAGAAAGGTGGGGCAGG - Intronic
1107933309 13:45324289-45324311 AAAAATTAGCTGAGTGGGCCAGG + Intergenic
1107955364 13:45506055-45506077 AAAAAGTAGAAAAGTTAGCTAGG - Intronic
1108138646 13:47393891-47393913 AGAAAGTAGATCAGTGGGCCAGG + Intergenic
1108276505 13:48815768-48815790 AAAAAGTAAAATTCTGGGCCAGG + Intergenic
1108352737 13:49601948-49601970 AAAAAATAAATTAGTAGGCCGGG - Intergenic
1108419437 13:50233729-50233751 AAAAAGTGGTTTTGTGGGCCAGG + Intronic
1108420103 13:50240070-50240092 AAAAAAAAAAATAGTGGGCCGGG - Intronic
1108603658 13:52016479-52016501 AAAAAGTGGTTTTGTGGGCCAGG + Intronic
1108677868 13:52753086-52753108 AAAAAGAAAAAAAGTAGGCCGGG - Intergenic
1108861870 13:54870626-54870648 GCAAAGTAGAAAAGTGGGCCAGG - Intergenic
1108875504 13:55044155-55044177 ACAAAATAGATAAGTGGGCCTGG + Intergenic
1109197886 13:59398749-59398771 AAAAAGGAAAATAGAAGGCCAGG - Intergenic
1109250837 13:60018794-60018816 AAAAACAAGAAAAGTGGGACAGG + Intronic
1109302670 13:60605265-60605287 AAGAAGTAGGAAAGTGGGCCAGG + Intergenic
1109407356 13:61919048-61919070 AAAAAGTAGTTTTGTGGGCCAGG - Intergenic
1110098005 13:71555635-71555657 AAAAATTAGTATAGTGGGGCTGG - Intronic
1110293627 13:73836919-73836941 AATAAATAAAATAGTGTGCCAGG + Intronic
1110804564 13:79739091-79739113 AAAAAGTAGGAAAGTGGGCCAGG - Intergenic
1110829515 13:80014191-80014213 TAAAAATAGAATAGTAGTCCAGG + Intergenic
1110961595 13:81633216-81633238 AAAAATTATAATAGTGAGCGAGG + Intergenic
1111066979 13:83106978-83107000 AAAAAGTGGTTTTGTGGGCCAGG + Intergenic
1111072529 13:83187615-83187637 AAAAAGTTGTTTTGTGGGCCAGG + Intergenic
1111217967 13:85169119-85169141 ATACAGTAGAATATTGGGCCAGG - Intergenic
1111294904 13:86265685-86265707 AAAAAATACAAAAATGGGCCAGG - Intergenic
1111296347 13:86283843-86283865 AAAAAGTAAAATATACGGCCGGG + Intergenic
1111437027 13:88224487-88224509 AAAAAACAGAACTGTGGGCCTGG - Intergenic
1111625606 13:90781540-90781562 ATAAAGTAGAATATTGGGGAGGG + Intergenic
1111715712 13:91876870-91876892 AAAAAGTAGTTTCATGGGCCAGG + Intronic
1112177117 13:97036816-97036838 AAAAAGTTAAAAAGTTGGCCAGG + Intergenic
1112561434 13:100518237-100518259 CAATCGTAGAATGGTGGGCCTGG + Intronic
1112857821 13:103792553-103792575 AAAAAGTGGTTTAGTGGGCTAGG - Intergenic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1114217185 14:20665645-20665667 AAAAAGTGGTTTCGTGGGCCGGG - Intergenic
1114272326 14:21108813-21108835 ATAAAGAATAAGAGTGGGCCGGG - Intergenic
1114294934 14:21320584-21320606 AAAAAAAAAAAGAGTGGGCCGGG - Intronic
1114297994 14:21347657-21347679 AGAAAGTAGATTAGTGGTTCAGG + Intronic
1114668129 14:24393200-24393222 AAAAAATAGAAAAATCGGCCGGG + Intergenic
1114899138 14:27034097-27034119 CAAAAGTAGAAGAGTCGGCCGGG - Intergenic
1115495431 14:33999642-33999664 AGAAAGTAGATTAATGGGCTGGG + Intronic
1115596683 14:34916411-34916433 AAGAATTAGCAAAGTGGGCCGGG - Intergenic
1115640950 14:35335316-35335338 AATAACTGGAATAGTGGGCCGGG - Intergenic
1115649006 14:35389882-35389904 AGAAAGGAGATTTGTGGGCCAGG - Intergenic
1116216530 14:42024316-42024338 AAAAAGTAGAAAAATAGGCCAGG - Intergenic
1116264776 14:42674239-42674261 AAAAAATGGTTTAGTGGGCCAGG - Intergenic
1116448129 14:45035814-45035836 AAAAATAAAAGTAGTGGGCCAGG + Intronic
1116673578 14:47875852-47875874 AAAAAGTAGGATGGAGGGACAGG - Intergenic
1116694027 14:48149850-48149872 AAAAAATGGTATTGTGGGCCAGG + Intergenic
1116794583 14:49376047-49376069 CAAAAGTAAAATAGTTGGCCGGG + Intergenic
1116841417 14:49822358-49822380 AAAAAGTACAAAAGTTAGCCGGG + Intronic
1116986282 14:51223240-51223262 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
1117172258 14:53113118-53113140 AAAAAATAGAAAAGTTAGCCAGG - Intronic
1117346364 14:54836810-54836832 AGAAAGTGGTAAAGTGGGCCAGG + Intergenic
1117404661 14:55390364-55390386 AAAAAATAAAAAAGTTGGCCAGG - Intronic
1117669372 14:58090918-58090940 AGAAAGAAGCACAGTGGGCCAGG + Intronic
1117744540 14:58854775-58854797 AAAAAGTGGTATATAGGGCCGGG - Intergenic
1117779478 14:59217675-59217697 AAAAAGTACAAAAATGAGCCAGG + Intronic
1117826938 14:59713938-59713960 AAAAATTAGACTAATAGGCCGGG + Intronic
1118196596 14:63632333-63632355 AAAAACTAGGAAAGTAGGCCGGG + Intronic
1118354240 14:64999140-64999162 AGAAAGTAAATTAGTGGACCAGG + Intronic
1118463014 14:66003801-66003823 AACAAGTAGAATAGTGGAATGGG + Intronic
1118591881 14:67407990-67408012 ATAAAATAAAATAGAGGGCCGGG + Intronic
1118644967 14:67829535-67829557 AGAAAATAAAATACTGGGCCGGG - Intronic
1118874019 14:69767516-69767538 GACACGTAGAATAGTGGGCCGGG + Intronic
1119072729 14:71604156-71604178 AAAAAATATAAAAGTGAGCCAGG - Intronic
1119075567 14:71634639-71634661 AAAAAGTAGCTAAGTTGGCCGGG + Intronic
1119361405 14:74053404-74053426 AAAAAATAAAAAAGTCGGCCGGG - Intronic
1119396858 14:74332648-74332670 AAAAAATAGATTAGGAGGCCAGG - Intronic
1119755223 14:77113005-77113027 AAAAAGTAACATATTGGGCCAGG - Intronic
1119844025 14:77815149-77815171 AAAATGTAGATTCCTGGGCCAGG - Intronic
1120036120 14:79700360-79700382 AAAAAAGTGAATAATGGGCCCGG - Intronic
1120091171 14:80334509-80334531 AAAAAGTGGTTTCGTGGGCCAGG - Intronic
1120392778 14:83929632-83929654 AAAAAGTGGTTTTGTGGGCCAGG + Intergenic
1120537883 14:85719376-85719398 AAAAAGTTGACAAGTTGGCCAGG - Intergenic
1120678954 14:87456123-87456145 AAAAACTAAAATATTTGGCCAGG - Intergenic
1121202268 14:92128241-92128263 AAAAAGAAAAAAAATGGGCCAGG + Intronic
1121354701 14:93204581-93204603 ATAGAGTAGATTAGTGAGCCAGG - Intronic
1121367373 14:93326304-93326326 AAAAAGTACAAAAGTTAGCCAGG + Intronic
1121420345 14:93808682-93808704 AAAAAGTACAAAAATGTGCCAGG - Intergenic
1121524163 14:94606975-94606997 AAAAGGAAGAGCAGTGGGCCTGG + Intronic
1121742718 14:96265371-96265393 AAAAAATAGAAAAGTTAGCCAGG - Intronic
1122211019 14:100174293-100174315 ATAAAATAAAATAGTTGGCCTGG + Intergenic
1122756452 14:103984352-103984374 AAAAAGTGGTTTCGTGGGCCAGG + Intronic
1123002505 14:105303222-105303244 AAAAACTAGAAAAAGGGGCCGGG - Exonic
1123812943 15:23947554-23947576 AAAAGGCAGGTTAGTGGGCCGGG + Intergenic
1124072094 15:26404939-26404961 AAAAAGTATAATAATTAGCCAGG + Intergenic
1124948975 15:34298578-34298600 AAAAAGTAGAAAAATGGGTGGGG + Intronic
1125425484 15:39544313-39544335 TAAAAATTGAAAAGTGGGCCAGG + Intergenic
1125658489 15:41377707-41377729 AAAAAGTGGTATCATGGGCCAGG + Intronic
1125663066 15:41409337-41409359 AAAAAGAAAAAATGTGGGCCGGG - Intronic
1125881347 15:43198770-43198792 AAAAAGTGGTTTAGTGGGCCAGG + Intronic
1126063555 15:44807199-44807221 AAAAAGTAGATTCCAGGGCCGGG + Intergenic
1126170171 15:45688806-45688828 AAAAAGTGCAAAACTGGGCCAGG - Intronic
1126188517 15:45854424-45854446 AAGAAGTTGGAGAGTGGGCCAGG - Intergenic
1126590549 15:50335601-50335623 AAAAAGAAGACTGGTCGGCCGGG + Intronic
1126648852 15:50901772-50901794 AAAAATTAGTTGAGTGGGCCAGG - Intergenic
1126774044 15:52084500-52084522 AAAAAAAAGAATCTTGGGCCAGG + Intergenic
1126961295 15:53998096-53998118 AAAAAGAACAAGATTGGGCCAGG - Intergenic
1127069901 15:55278775-55278797 AATAATTAGAAGACTGGGCCAGG - Intronic
1127115699 15:55724596-55724618 AAAAAGTACAAAAGTTAGCCAGG + Intronic
1127256101 15:57295132-57295154 AAAGAGTAGAATGGTGGGCCTGG + Intronic
1127610826 15:60634696-60634718 AGAAGGTAAAAAAGTGGGCCAGG - Intronic
1127813137 15:62581746-62581768 AAAAGAGTGAATAGTGGGCCGGG + Intronic
1127916024 15:63455784-63455806 AAAAAGTAGATTAGTGGTTTAGG - Intergenic
1127919535 15:63482324-63482346 AAAATGTAGGATAGTTGGCCAGG - Intergenic
1128051106 15:64665612-64665634 AAAAAGTAAACAAATGGGCCGGG + Intronic
1128129992 15:65220210-65220232 AAAAACTAGAGAACTGGGCCGGG - Intergenic
1128483296 15:68058983-68059005 AAAAAGTAGAATAATCTGACAGG - Intronic
1128732940 15:70033392-70033414 AAAATGTAAAGTAGTGGGGCAGG + Intergenic
1129201356 15:74003136-74003158 AAAAAGAAAAAAAGTGGGCCAGG + Intronic
1129282756 15:74499020-74499042 AAAAAATAGAAAAATTGGCCGGG - Intergenic
1129283327 15:74503302-74503324 AGAAAGTAGAATGGTAGGCCAGG - Intergenic
1129370692 15:75092498-75092520 AAAAGTTAGAACAGTGGGCCGGG + Intronic
1129441361 15:75583225-75583247 AAAAAATATAAAAATGGGCCAGG - Intergenic
1129469416 15:75742500-75742522 AAAAAGTGGTTTTGTGGGCCGGG + Intergenic
1129553651 15:76481024-76481046 AAAAAGTAGAATAGTGGGCCGGG - Intronic
1129620142 15:77136914-77136936 AAAAAGTAGTTTCGTGGGCCAGG + Intronic
1129761716 15:78132570-78132592 AAAAAATACAATAATTGGCCGGG - Intronic
1129804902 15:78447743-78447765 GAAAAGCAGAATAATGGGCCGGG - Intronic
1129861961 15:78870116-78870138 AAAAATGAAAATAGTGGGCCGGG - Intronic
1129979912 15:79859272-79859294 TCAAAGTAGAATAATGGGGCAGG + Intronic
1130266233 15:82406876-82406898 AAAAAATACAAAAGTTGGCCGGG - Intergenic
1130505777 15:84540001-84540023 AAAAAATACAAAAGTTGGCCGGG + Intergenic
1130694900 15:86121191-86121213 AAAAATGATAAAAGTGGGCCAGG - Intergenic
1130963859 15:88682726-88682748 AAAAATTAGCATACTAGGCCTGG + Intergenic
1131190612 15:90313426-90313448 AAAAAGTAGAAAAACAGGCCAGG - Intronic
1131207871 15:90466794-90466816 AAAAATTAAAAAACTGGGCCGGG + Intronic
1131426992 15:92354004-92354026 AAAAAATAGTTTCGTGGGCCAGG + Intergenic
1131473699 15:92717915-92717937 AAAATGTACATTTGTGGGCCGGG + Intronic
1132152627 15:99473469-99473491 AGAAAGGAGAAGAGTTGGCCGGG - Intergenic
1133069785 16:3237783-3237805 AAAAAATAGAACAATAGGCCGGG + Intergenic
1133085774 16:3361968-3361990 CAAAATTAGAAAAATGGGCCAGG + Intergenic
1133250665 16:4478453-4478475 GAAAATTAGAATTGTGGGCCCGG + Intronic
1133529267 16:6639579-6639601 AAAGATTACAATTGTGGGCCGGG + Intronic
1133593795 16:7271446-7271468 AAAAATTACAACAGTGGTCCTGG - Intronic
1133746129 16:8688049-8688071 AATAAGTAAAATAGCGGGGCAGG - Intronic
1133806777 16:9131664-9131686 AATAAGAAAAATAGGGGGCCGGG + Intergenic
1134188962 16:12106632-12106654 AAAAAATAGAAAAATGAGCCAGG - Intronic
1134222454 16:12365745-12365767 CAAAAGCAGAACAGTGGGCCGGG + Intronic
1134534205 16:15012398-15012420 AAAAAATTGTATTGTGGGCCGGG - Intronic
1134581543 16:15375446-15375468 AAAAAGTAACAAGGTGGGCCGGG + Intronic
1134589840 16:15443620-15443642 GAAAAGTACAAGTGTGGGCCAGG + Intronic
1134622160 16:15697550-15697572 AAAAAATAGAAAAATGAGCCAGG + Intronic
1134765750 16:16756018-16756040 AGAAAGTAGTTCAGTGGGCCAGG - Intergenic
1134980303 16:18603201-18603223 AGAAAGTAGTTCAGTGGGCCAGG + Intergenic
1135123845 16:19790055-19790077 AAAAAATACAAAAATGGGCCAGG + Intronic
1135127805 16:19825530-19825552 AAAATGTAAAATATTTGGCCAGG + Intronic
1135241125 16:20807604-20807626 AAAAACTGGGATGGTGGGCCGGG + Intronic
1135512637 16:23100475-23100497 ACAAAGCAGAATAGTGGGCCGGG + Intronic
1135549505 16:23387440-23387462 AAAAAGAAAAAATGTGGGCCAGG + Intergenic
1135587866 16:23684512-23684534 AAAAATTAGAAAAGTCAGCCAGG - Intronic
1135753493 16:25076400-25076422 AAAGAGTAGATCAGTGGTCCAGG - Intergenic
1135955289 16:26951829-26951851 AGAAAGCAGAAGGGTGGGCCTGG + Intergenic
1135964358 16:27023572-27023594 AAAATGAAGAATATTGGGCTTGG + Intergenic
1136015619 16:27398845-27398867 ATAAAGTAGACGAGTGGCCCTGG + Intergenic
1136137967 16:28269192-28269214 AAAAAATACAAAAGTGAGCCAGG - Intergenic
1136241349 16:28946278-28946300 AAAAAGTTGTAAAATGGGCCTGG + Intergenic
1136404657 16:30037245-30037267 AAAAATTAGAATAATAGGCCGGG + Intronic
1136448229 16:30336955-30336977 AAAAAGAAAAAAAGAGGGCCGGG - Intergenic
1136474985 16:30507162-30507184 AAAAAATACAAAAATGGGCCGGG + Intronic
1136523565 16:30813555-30813577 AAAAAAAAGAAAAGAGGGCCAGG + Intergenic
1137283643 16:46999122-46999144 AAAAATTATAAAAGTAGGCCAGG + Intergenic
1137355716 16:47761489-47761511 AGAAAGAGGAATAGAGGGCCAGG - Intergenic
1137630446 16:49939628-49939650 AAAAAATACAAAAATGGGCCAGG + Intergenic
1137653863 16:50143461-50143483 AAAAATTAAAAAAGTTGGCCAGG + Intergenic
1137738966 16:50746196-50746218 AAAAAGTACAAAAGTTAGCCAGG - Intronic
1138001285 16:53282443-53282465 AAAAAGTAGAAAAATTGGCTAGG + Intronic
1138123006 16:54415431-54415453 AGAAAATACAATACTGGGCCGGG + Intergenic
1138124575 16:54428345-54428367 ATAAAGTAGACTAGAGGGGCAGG + Intergenic
1138365666 16:56474613-56474635 AAAAAGTTGAATTTTGGGCCGGG - Intronic
1138557516 16:57781155-57781177 AGAAAATACAAAAGTGGGCCAGG + Intronic
1138621471 16:58214637-58214659 AAAAATAAGAATAATGGGGCTGG + Intergenic
1139745359 16:69069909-69069931 AGAAAATAAAGTAGTGGGCCAGG + Intronic
1140098231 16:71893455-71893477 AAAAAAAAAAAAAGTGGGCCAGG - Intronic
1140155454 16:72420448-72420470 AAAAATAATAATAATGGGCCGGG - Intergenic
1140163947 16:72529480-72529502 AAAAAGTAACATAATGGGCTGGG - Intergenic
1140358732 16:74327397-74327419 AAAAAATAGAATTATCGGCCGGG + Intergenic
1140447004 16:75037631-75037653 ACAAACAAGAAGAGTGGGCCAGG - Intronic
1140685078 16:77425745-77425767 AAAAAGAGGAGGAGTGGGCCGGG + Intronic
1141226649 16:82122593-82122615 AAAACCTAGTATATTGGGCCGGG + Intergenic
1141526624 16:84616005-84616027 AAAAAGTACAAAATTGTGCCAGG - Intronic
1142288502 16:89181642-89181664 AAAAAGAAGAAAAGAGGACCGGG + Intronic
1142301492 16:89261151-89261173 AAAAAAAAGAAAAGTCGGCCGGG + Intergenic
1142326033 16:89415247-89415269 AAAAAAAAGAATAGCTGGCCAGG - Intronic
1142350740 16:89578356-89578378 AAAAAGAGGAAAAGTGGGCTGGG - Intronic
1142350780 16:89578597-89578619 AAAAAGTACAATAATTAGCCGGG + Intronic
1142391362 16:89802696-89802718 AAAAAAAAGAATAGCTGGCCGGG - Intronic
1142576511 17:912231-912253 AAAAAATAGAGTATTTGGCCGGG - Intronic
1142882330 17:2891434-2891456 TAAAAGTAGAAAAATAGGCCAGG - Intronic
1143131605 17:4681866-4681888 ATAAAGTAAGATAGGGGGCCAGG + Intronic
1143153620 17:4822329-4822351 AAAAAGTACAAAAGTTAGCCGGG + Intronic
1143182771 17:4994065-4994087 AAAACATAAAACAGTGGGCCAGG - Intronic
1143572146 17:7766070-7766092 GAAAAGTAGAAATGCGGGCCGGG - Intronic
1143737172 17:8920042-8920064 TAAAAGTAGAATAATTAGCCTGG - Intronic
1143896672 17:10141931-10141953 AAAAAGTTACATAGTAGGCCGGG + Intronic
1144059212 17:11567528-11567550 AAAAAGTTTAATAGAAGGCCGGG + Intergenic
1144067221 17:11635474-11635496 AAAAAATTGAAAAGAGGGCCGGG - Intronic
1145008444 17:19352044-19352066 AAAAAATAGAAAAATTGGCCAGG - Intronic
1145182375 17:20764687-20764709 AAAAAATAAATTAGTGGGCCAGG - Intergenic
1145292233 17:21557221-21557243 AAAAAAAAGAATTGTAGGCCAGG + Intronic
1145319700 17:21757499-21757521 AAAAGGCAGAATAAGGGGCCCGG - Intergenic
1145950828 17:28815529-28815551 AAAAAATAAAAAAGCGGGCCAGG + Intronic
1146963641 17:37006172-37006194 AAAAAGAAAAAAAGAGGGCCAGG + Intronic
1147202856 17:38815073-38815095 AAAAAGAAGAAAAGTTGGACTGG - Exonic
1147223036 17:38951184-38951206 AAAAAAATAAATAGTGGGCCAGG - Intronic
1147618068 17:41842644-41842666 AAAAAGTATAAAATTTGGCCAGG + Intronic
1148163215 17:45463686-45463708 AAAAAGGAGAGAAGGGGGCCGGG - Intronic
1148526959 17:48348177-48348199 AAAAAGTAGAAAAATTAGCCAGG + Intronic
1148651696 17:49254810-49254832 AAAAATTAGCATAGTGGCACAGG - Intergenic
1148901491 17:50881768-50881790 AAAAAGAAAAAAAGTAGGCCAGG + Intergenic
1149051446 17:52310035-52310057 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
1149064632 17:52465558-52465580 AAAAAGTGGTTTTGTGGGCCAGG + Intergenic
1149587029 17:57797440-57797462 AAACAATAGAATTTTGGGCCAGG + Intergenic
1149786073 17:59436175-59436197 AAAAAATAGAATGGTGGGCCAGG - Intergenic
1149838937 17:59941044-59941066 AAAAAAAAAAAAAGTGGGCCAGG - Intronic
1149840512 17:59960650-59960672 AAAAAGTACAAAAGTTAGCCAGG + Intronic
1149878283 17:60261349-60261371 AAAAAGTACAAATGTAGGCCAGG + Intronic
1149938314 17:60832407-60832429 AAAAAGCAGAATATTGTGACAGG + Intronic
1150203066 17:63377125-63377147 AAAAAGTGGCTTAGTGGGCTGGG - Intronic
1150608311 17:66713210-66713232 AAAAAGTAAAAAAATTGGCCGGG - Intronic
1150732463 17:67707916-67707938 AAAAAGTAAAATACCAGGCCTGG + Intergenic
1150745816 17:67815710-67815732 AAAAAGTATAAAAATGAGCCAGG - Intergenic
1151501028 17:74488925-74488947 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
1151645715 17:75430024-75430046 AAAAAGTAGAAAAATTAGCCAGG + Intergenic
1151720493 17:75852748-75852770 AGAAAATAGAAGAGTTGGCCGGG - Intronic
1151741445 17:75985304-75985326 AAAAAATACAAAAATGGGCCAGG - Intronic
1151916675 17:77123403-77123425 AAAAAAAAAAAGAGTGGGCCTGG - Intronic
1151997143 17:77617206-77617228 AGAAAGTAGACGAGTGGGCCGGG - Intergenic
1152097807 17:78282072-78282094 AAAAAAAAAAAAAGTGGGCCGGG + Intergenic
1152402385 17:80075258-80075280 AAAAAGTAATATTTTGGGCCAGG - Intronic
1152581466 17:81167130-81167152 AAAAATTAGAAAAATGAGCCAGG + Intergenic
1152620370 17:81361136-81361158 AAAAAAAAAAAAAGTGGGCCTGG - Intergenic
1152708278 17:81856941-81856963 AAAAAATAGAAAAATTGGCCGGG - Intronic
1152789494 17:82271363-82271385 AAAAAGGAGTATTTTGGGCCGGG - Intronic
1152885684 17:82847923-82847945 AAAAATTCAAATCGTGGGCCCGG - Intronic
1153097855 18:1429275-1429297 AAAAATGAGAATACTGGGTCTGG + Intergenic
1153145989 18:2033273-2033295 AAAAAATAGACAAGTAGGCCGGG - Intergenic
1154273350 18:12938807-12938829 AAAAAGTAAATTTCTGGGCCTGG + Intergenic
1154401757 18:14044884-14044906 AAAAAATAGAATGGGAGGCCGGG - Intergenic
1154472613 18:14719718-14719740 AAAGACTTGAATAGTAGGCCAGG - Intergenic
1154977611 18:21474711-21474733 AAAAAGTATTTTTGTGGGCCAGG - Intronic
1155076875 18:22365340-22365362 AGAGAGTAGAATGATGGGCCGGG - Intergenic
1155153355 18:23139101-23139123 AAAAATTAGAATGTCGGGCCGGG + Intronic
1155217214 18:23653864-23653886 AAAAATAAGAATAATAGGCCAGG - Intronic
1155261817 18:24050574-24050596 AAAAAAAAAAAAAGTGGGCCAGG + Intronic
1155773078 18:29724848-29724870 AAAAAGTAGCTTTATGGGCCAGG - Intergenic
1156090413 18:33461178-33461200 AAAAATTAGGACAGTGTGCCTGG + Intergenic
1157249641 18:46083277-46083299 AAAAAGTAGAAAAATTGGCTGGG + Exonic
1157249889 18:46085634-46085656 AAAAAACAGAATACAGGGCCGGG + Intronic
1157278913 18:46333251-46333273 AAAAGGTAGATGAGTGGCCCTGG + Intronic
1158006868 18:52682462-52682484 GTGAAGAAGAATAGTGGGCCTGG + Intronic
1158021597 18:52848380-52848402 AAACATTAGAAAAGTCGGCCGGG - Intronic
1158414302 18:57235872-57235894 AAAAAGTAGAAAAATTAGCCAGG - Intergenic
1158600090 18:58849159-58849181 AAAAATTGGAATATGGGGCCAGG + Intergenic
1158905338 18:62006015-62006037 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
1159250077 18:65864591-65864613 AAAAATTACATTTGTGGGCCAGG + Intronic
1160398683 18:78591909-78591931 AAAAAGTATAACATTTGGCCAGG + Intergenic
1160804333 19:985328-985350 AAAAAATACAAATGTGGGCCGGG - Intronic
1160848828 19:1179823-1179845 AAAAAGTAAAAAAATTGGCCAGG - Intronic
1160854959 19:1212837-1212859 AAAAAATAAAAAGGTGGGCCGGG - Intronic
1161095341 19:2387196-2387218 AAAAAATAGAAAAGTGAGGCTGG + Intergenic
1161099117 19:2411845-2411867 AAAAATTATAATTGTCGGCCGGG - Intronic
1161155331 19:2729639-2729661 AAAAAAAAAAAAAGTGGGCCGGG + Intronic
1161444129 19:4308560-4308582 AAAAAATAAAATAATTGGCCAGG + Intronic
1161559686 19:4965750-4965772 AAAAAGTACAAAAATCGGCCAGG - Intergenic
1161758343 19:6151466-6151488 AAAAAGTGGAAAAGTTCGCCGGG - Intronic
1161906160 19:7158203-7158225 AAAATGAAGCATAATGGGCCAGG + Intronic
1162172712 19:8803968-8803990 GAAAAGTAGAAATTTGGGCCAGG - Intergenic
1162257471 19:9502503-9502525 AAAAAGTAGAACAGGAGGCCGGG - Intergenic
1162285891 19:9738452-9738474 AAAAAATACAAAAGTGAGCCAGG + Intergenic
1162333988 19:10048931-10048953 GAAAAGGAGAAAAGGGGGCCGGG + Intergenic
1162355082 19:10178259-10178281 AAAAAATAAAATAAAGGGCCAGG + Intronic
1162508002 19:11098841-11098863 AAAAAGTAGAAAAATTAGCCTGG + Intronic
1162537456 19:11271725-11271747 AAAAAAAAAAAAAGTGGGCCAGG - Intergenic
1162576364 19:11501337-11501359 AAAAAGTACAAAAGTTAGCCGGG - Intronic
1162644558 19:12039367-12039389 AAAAAGTAGAAATGAAGGCCGGG - Intronic
1162969627 19:14172441-14172463 AAAAAATAGAACACTGGGGCAGG + Intronic
1163231664 19:16007158-16007180 AAAAAGTACAAAAATGAGCCAGG + Intergenic
1163252578 19:16134973-16134995 AAAAAGTACAAAAATTGGCCGGG + Intronic
1163336240 19:16673940-16673962 AAAAAGTATAAAAATTGGCCAGG + Intronic
1163422388 19:17221160-17221182 AAAAAGTAGAACATAGAGCCAGG + Intergenic
1163438780 19:17311014-17311036 AAAAAGTACAAAAATGAGCCTGG - Intronic
1163469946 19:17490310-17490332 AAAAAATTCAAAAGTGGGCCAGG - Intronic
1163482596 19:17566816-17566838 AAAAAGTAAAATAGTAGGCCAGG + Intronic
1163543736 19:17928206-17928228 AAAAAGTAGAAAAATTGGCTGGG + Intergenic
1163543778 19:17928472-17928494 AAAAAGTAGAAAAATTGGCTGGG + Intergenic
1163610797 19:18300558-18300580 AAAAATTAAAAAAATGGGCCAGG - Intergenic
1163651007 19:18517724-18517746 AAAAAGAAAAAAACTGGGCCAGG + Intronic
1163665629 19:18602766-18602788 AAAAAGTAGAACACTGAGTCAGG - Intronic
1163682465 19:18691039-18691061 AAAAAAAAGAAGAGTGGGCTGGG + Intronic
1163788913 19:19294361-19294383 AAAAAGTACAAAAGTTAGCCAGG + Intronic
1163853578 19:19681587-19681609 AAAAAATAGAAAAGTTAGCCAGG + Exonic
1164176837 19:22782961-22782983 AAAAAGTAGATTATCAGGCCTGG - Intronic
1165041938 19:33074756-33074778 AAAAAGGAAAATAATGGGCTGGG + Intergenic
1165238063 19:34439667-34439689 AAAAAATAGAAAAATGAGCCAGG + Intronic
1165431185 19:35774272-35774294 AAAATATAGAATATTAGGCCAGG - Intergenic
1165479832 19:36056002-36056024 AAAAAGTAGAAAAATTAGCCCGG + Intronic
1165798015 19:38530247-38530269 AAAAAATAAAAAAGTAGGCCAGG - Intronic
1165848561 19:38835339-38835361 AAAAAATAAGAAAGTGGGCCGGG - Intronic
1165857151 19:38886276-38886298 AAGATTTAGAATAGTGGGCAAGG - Intronic
1165911864 19:39234032-39234054 AAAAAAAATAATAGTAGGCCAGG + Intergenic
1166143368 19:40818079-40818101 AAAAAGTCAAAAAGTGGGGCAGG - Intronic
1166184186 19:41128697-41128719 AAAAAGTCAAAAAGTGGGGCAGG + Intergenic
1166342544 19:42147402-42147424 ATAAACTAGAATAGGGAGCCAGG - Intronic
1166383268 19:42366492-42366514 AAAAAGAACAATGCTGGGCCAGG - Intronic
1166398721 19:42462042-42462064 AAGAAGCAGAATTGTGGGCCAGG + Intergenic
1166516995 19:43454543-43454565 AAAAAGTACAAAAGTTAGCCAGG - Intergenic
1166642800 19:44508683-44508705 AAAAAGAAGAAAACTGGGCCAGG - Intronic
1166643079 19:44511312-44511334 AAAAAGGAGAGTTCTGGGCCAGG - Intronic
1166668281 19:44694669-44694691 AAAAAGTACAATAATTAGCCAGG - Intergenic
1166796260 19:45428241-45428263 AAAAAATACAAAAGTTGGCCAGG - Intronic
1167032018 19:46968789-46968811 AGAAAGTAGATTAGTGGGCCGGG + Intronic
1167253122 19:48411668-48411690 AATAAGAAGAATAGTTGGTCAGG + Intronic
1167341246 19:48917789-48917811 AAAAAGTAAAAAATTGGGCCGGG - Intronic
1167344638 19:48937515-48937537 AAAAAGTACAAAAATTGGCCGGG + Intronic
1167403441 19:49288409-49288431 AAAAAGTGGTTTTGTGGGCCAGG + Intergenic
1167557381 19:50204732-50204754 AAAAAGTAAAAGAGTTAGCCGGG + Intronic
1167588939 19:50392010-50392032 AAAAAGTAAAATGATGGGCCAGG - Intronic
1168032296 19:53690264-53690286 AAAAAATACAAAAGTGAGCCAGG - Intergenic
1168038066 19:53736225-53736247 AAAAAATACAAAAGTGAGCCGGG - Intergenic
1168039977 19:53750589-53750611 AAAAAATACAAAAGTGAGCCAGG - Intergenic
1168041223 19:53760522-53760544 AAAAAATACAAAAGTGAGCCGGG - Intergenic
1168048194 19:53809235-53809257 AAAAAAAAAAATCGTGGGCCGGG + Intronic
1168143726 19:54407179-54407201 TAAAAGTAGAATTGTTGGCCGGG + Intergenic
1168221084 19:54961076-54961098 AAAATATAAAATAATGGGCCAGG + Intronic
1168429002 19:56262312-56262334 AGAAGTTAGAAAAGTGGGCCGGG - Intronic
1168704181 19:58459101-58459123 AAAAAAAAAAAAAGTGGGCCGGG - Intergenic
1168723204 19:58566149-58566171 AAAAAGAAGAGGAATGGGCCAGG + Intronic
925052310 2:825899-825921 ATGAAGTAGAATAGTGGCACTGG + Intergenic
925674020 2:6340940-6340962 AGTGGGTAGAATAGTGGGCCTGG - Intergenic
926169862 2:10546168-10546190 AAAAAGAAAAATTCTGGGCCAGG - Intergenic
926865907 2:17357985-17358007 AAAAAGTACAAAAGTTGGCTGGG + Intergenic
927123820 2:19994927-19994949 AAAAAGTAAAATAGTTAGCCAGG + Intronic
927147346 2:20175019-20175041 AAAAAAAAGAATTCTGGGCCAGG + Intergenic
927398229 2:22680805-22680827 AAAAAGTACAATATTGGGCCCGG + Intergenic
927529862 2:23786134-23786156 AAAAAGTCGAATGGAGGACCAGG - Exonic
927626532 2:24726839-24726861 AAAAAAAAAAAAAGTGGGCCCGG + Intronic
927628297 2:24747488-24747510 AAAAAATAGAATAGTTAGCCGGG - Intronic
927641046 2:24845810-24845832 AAAAAGTAGTTTCGTGGGCCAGG + Intronic
927899252 2:26807280-26807302 AAAAAAAAAAATTGTGGGCCAGG + Intergenic
927925669 2:27011912-27011934 ATAAAGAAGAAAACTGGGCCAGG + Intronic
928380486 2:30813654-30813676 AAAATGTTGAATACTGAGCCTGG + Intronic
928563755 2:32520520-32520542 AAAAAGTAAATAAATGGGCCAGG + Intronic
928727236 2:34188734-34188756 AAACAGTAGAAGAGTGAACCTGG - Intergenic
928761263 2:34586241-34586263 TAAAAATAGGAGAGTGGGCCGGG + Intergenic
929157315 2:38799758-38799780 AAAAAAAAAAAAAGTGGGCCAGG + Intronic
929278702 2:40054444-40054466 TAAAAGTATAGAAGTGGGCCAGG + Intergenic
929482071 2:42318863-42318885 AAAAATTAAAAAAGTGAGCCGGG - Intronic
929489822 2:42386200-42386222 AAGAAGAAGAAGAGGGGGCCAGG + Intronic
929637675 2:43541787-43541809 ATAAATTAAAATACTGGGCCTGG - Intronic
929696131 2:44117379-44117401 AAAAAGAAGAAAATGGGGCCAGG - Intergenic
930057961 2:47266423-47266445 AAAAGGTAGGAGAGTAGGCCTGG + Intergenic
930280467 2:49362881-49362903 AAAAAGTGGATTCATGGGCCGGG - Intergenic
930503736 2:52255930-52255952 AAAAAGTGGTTTAGTGGGCTGGG - Intergenic
930815237 2:55590030-55590052 AAAAAATAAATTTGTGGGCCAGG + Intronic
931205061 2:60138913-60138935 AAAAAATAGATTAATTGGCCAGG - Intergenic
931338614 2:61376029-61376051 AGAAAGTAGATTAGTGAGGCTGG + Intronic
931654952 2:64502470-64502492 AAAAAACAAAATTGTGGGCCGGG + Intergenic
931731219 2:65155103-65155125 AAAAAGGAGAATTATGGGCTGGG - Intergenic
931970184 2:67577310-67577332 AAAAAGTGGAATATGGGGCCGGG + Intergenic
932157611 2:69432852-69432874 AGAAAGTATACTATTGGGCCAGG + Intronic
932339393 2:70951610-70951632 AAAAAATAGAACACTCGGCCAGG + Intronic
932428329 2:71657809-71657831 AAAAAGTGGTTTTGTGGGCCGGG - Intronic
932825793 2:74938878-74938900 AAAAAGCAGAAAAGTGAGGCAGG + Intergenic
932960608 2:76408687-76408709 AAAAAGTGGTTTTGTGGGCCAGG + Intergenic
933094068 2:78156204-78156226 ATAAATTAGAACAGTTGGCCAGG - Intergenic
933413621 2:81955908-81955930 AAAAAGTAGAACAGTGTTCATGG + Intergenic
934091371 2:88553482-88553504 AAAAAGTAGAAAAATGAGCCGGG - Intergenic
934106950 2:88703617-88703639 AAAAAGTGGTTTTGTGGGCCAGG - Intronic
934285614 2:91648115-91648137 AAAAAAAAGAAAAGTTGGCCGGG - Intergenic
934603207 2:95674341-95674363 AAAAGGGAGAACAGTGAGCCAGG + Intergenic
935100073 2:99985903-99985925 AAAAAATAAAAAGGTGGGCCAGG + Intronic
935417194 2:102831459-102831481 AAGAAGAAGAGTGGTGGGCCAGG + Intronic
935484399 2:103635332-103635354 TAAAAATAGAATAGGGGGCCGGG - Intergenic
936340367 2:111626023-111626045 AGAAAGTTGAATAGGGAGCCAGG + Intergenic
936536589 2:113316547-113316569 AAAAGGGAGAACAGTGAGCCAGG + Intergenic
936969605 2:118164582-118164604 AAAAAGTGGTTTTGTGGGCCGGG + Intergenic
937191283 2:120101847-120101869 AAAAAGGAGAAAATGGGGCCAGG - Intronic
937466672 2:122138990-122139012 ATGAAGTAGAATTGTGGGCCTGG - Intergenic
938024581 2:127935376-127935398 AAAAAGTACAAAAGTTAGCCGGG + Intergenic
938339386 2:130525318-130525340 AAAGAGTACAAGAATGGGCCGGG - Intronic
938350453 2:130595434-130595456 AAAGAGTACAAGAATGGGCCGGG + Intronic
938510455 2:131936802-131936824 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
938769519 2:134489276-134489298 AAAAAGTTGCAGTGTGGGCCAGG + Intronic
938774487 2:134529590-134529612 AAAAAGTACAAAAATTGGCCGGG + Intronic
938849981 2:135250531-135250553 AAAAAGTGGTTTTGTGGGCCAGG + Intronic
939723033 2:145678875-145678897 AAAAAGTACAAAAATGAGCCTGG + Intergenic
939971008 2:148661009-148661031 AAAAAGTAGAATAATGAGTAAGG - Intronic
940327668 2:152442542-152442564 AAAAAGGACAGAAGTGGGCCAGG - Intronic
940547209 2:155102628-155102650 AAAAAATGGTATTGTGGGCCAGG - Intergenic
940568179 2:155395848-155395870 AAAAAATATAATAGTGGGATAGG - Intergenic
940797519 2:158096301-158096323 AAATAATAAAATAGTGGGCCAGG + Intronic
940835524 2:158516954-158516976 AAAAATAAGAAAAGTAGGCCGGG - Intronic
941232780 2:162931607-162931629 AGAAAGTAGAGGAGAGGGCCCGG - Intergenic
941335716 2:164241023-164241045 AAAAAATGGTTTAGTGGGCCAGG - Intergenic
941455186 2:165706550-165706572 AGAAAGTAACAGAGTGGGCCGGG - Intergenic
941477542 2:165967900-165967922 AAAAAGTGGTTTTGTGGGCCGGG + Intergenic
941598368 2:167507209-167507231 AAAAAGTAGAATAAGAGGGCGGG + Intergenic
942230555 2:173857691-173857713 AAAAATTAGAATTCTAGGCCAGG + Intergenic
942884049 2:180900427-180900449 TAAAAGTAGCATTCTGGGCCAGG - Intergenic
942981919 2:182093332-182093354 AAAAAGTGGTTTCGTGGGCCAGG - Intronic
943205340 2:184886819-184886841 AAAAAGTGGTTTTGTGGGCCAGG - Intronic
943289198 2:186046805-186046827 AAAAATAATAATAGTTGGCCAGG - Intergenic
943305016 2:186250137-186250159 AAGATGTAGAATATTTGGCCAGG + Intergenic
943363643 2:186949187-186949209 AAAAGGTACAAATGTGGGCCGGG + Intergenic
943370941 2:187014745-187014767 AAAAACCAAAATATTGGGCCGGG - Intergenic
943470307 2:188287468-188287490 AAAAAGTAGTAGTATGGGCCGGG + Intergenic
944037531 2:195313295-195313317 AAAAAGTAGAAAACCTGGCCGGG - Intergenic
944044022 2:195388311-195388333 AAAAAGTGGTTTTGTGGGCCTGG + Intergenic
944052396 2:195485440-195485462 AAAAAGTACTATAGTAGGCCAGG + Intergenic
944087685 2:195868377-195868399 AAAAAGATGAATAATAGGCCAGG - Intronic
944091781 2:195919638-195919660 AAAAAGTAGACTTTTTGGCCTGG - Intronic
944244534 2:197517842-197517864 AAAAACTATAATAGAGGGCTGGG + Intronic
944447404 2:199805302-199805324 AGAAAGTAGAGTATGGGGCCAGG + Intronic
944458604 2:199920659-199920681 AAAAAGTCAAATGATGGGCCAGG + Intronic
944624844 2:201560130-201560152 AAAATGTAAAATTGTGGGCCAGG + Intronic
944823591 2:203457477-203457499 AAAAATTAAAATATTAGGCCAGG - Intronic
944828037 2:203504502-203504524 AAAAAGTGGTTTCGTGGGCCGGG - Intronic
945292524 2:208139912-208139934 AAAAAGTAAAAGAATAGGCCAGG - Intergenic
945834624 2:214823906-214823928 AAAAAGTAAATGAGAGGGCCAGG - Intergenic
946385159 2:219379625-219379647 ATAAAGTAAAAAAGTTGGCCGGG + Intronic
946757526 2:222962702-222962724 AAAAAGTGGTTTCGTGGGCCAGG + Intergenic
946911237 2:224463547-224463569 AAAAAGTACAAGAGGAGGCCAGG + Intergenic
946930160 2:224662863-224662885 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
947386334 2:229594291-229594313 AAAAAGAAGAGCAGAGGGCCGGG + Intronic
947483273 2:230522783-230522805 AAAAAATAGAACACTGGGGCTGG - Intronic
947502289 2:230680119-230680141 AAAATGCAGAGTACTGGGCCTGG + Intergenic
948489940 2:238306106-238306128 AAAAAGTGGAAGAGGGAGCCAGG + Intergenic
1168777306 20:458607-458629 TAAAAGTAGAATTGGAGGCCAGG - Intronic
1169243290 20:4003262-4003284 AAAAAGAAAAATTCTGGGCCGGG - Intronic
1169454757 20:5742604-5742626 AGAGAGTAAAATGGTGGGCCAGG - Intergenic
1169668509 20:8067760-8067782 AAAAAGAAAAATAATGGGACTGG - Intergenic
1170146755 20:13183732-13183754 AGAAAGTAAAATAGTGGACCGGG + Intergenic
1170192210 20:13655482-13655504 AAAAAGTAGAGTGGGAGGCCAGG - Intergenic
1170301872 20:14892972-14892994 AGAAAGTAGAATCATGGGCTGGG - Intronic
1170636489 20:18109831-18109853 AAAAAGTACAAAAATTGGCCAGG - Intergenic
1170676591 20:18487654-18487676 ATAAAGTAAAATAAGGGGCCGGG + Exonic
1170715994 20:18831495-18831517 AAAAAGTACAATATTCAGCCAGG - Intergenic
1170989415 20:21288195-21288217 AAAAAATAGAAAAATGGGGCTGG + Intergenic
1170989462 20:21288510-21288532 TAAAAATAGAAAAATGGGCCAGG + Intergenic
1171007880 20:21485427-21485449 AGAAAGCAGACTAGTGGGCCAGG + Intergenic
1171050014 20:21849125-21849147 AAAAACCAGAAAAGTGGGCCAGG - Intergenic
1171118749 20:22549766-22549788 AAAAAGTAGTTTTGCGGGCCAGG - Intergenic
1171224729 20:23432469-23432491 AAAAAGAAGAATATTTGGTCGGG - Intergenic
1171503854 20:25617504-25617526 AAAAAGTACAGAATTGGGCCAGG - Intronic
1171787414 20:29481568-29481590 AAAAAGTCTAATTGTAGGCCAGG + Intergenic
1172089373 20:32417881-32417903 AAAAAATAAAAAAGTTGGCCGGG + Intronic
1172130916 20:32654545-32654567 AAAAAGAATAATGGTGGGCCAGG + Intergenic
1172133405 20:32671545-32671567 AAAAAATAGTAGAATGGGCCAGG + Intergenic
1172422900 20:34832519-34832541 AAAAATTAGGATAGTGGCTCTGG - Intergenic
1172542289 20:35728080-35728102 AAAAATAAGAATTGTAGGCCAGG - Intronic
1172565220 20:35924894-35924916 AAAAAAAAGAAAAATGGGCCAGG - Intronic
1172709568 20:36910432-36910454 TAAAAGTTAAATAATGGGCCGGG + Intronic
1172743545 20:37188446-37188468 AAAAAGTACGACAATGGGCCGGG - Intronic
1172901465 20:38337969-38337991 CAAAAGCAGAACAATGGGCCAGG + Intergenic
1172969930 20:38865829-38865851 AAAAAGTTGAAAAGTGGCCAGGG + Intronic
1173058024 20:39635329-39635351 AAATAGGTGAGTAGTGGGCCGGG - Intergenic
1173489026 20:43464520-43464542 AAAAATTAGAAGAGTGGGTGCGG + Intergenic
1173489557 20:43468772-43468794 AAAAAATAGAAAAATTGGCCAGG + Intergenic
1173494703 20:43510157-43510179 AAAAAGTACAAAAGTTAGCCAGG - Intronic
1173894949 20:46543629-46543651 AAAAAGAAAAATAGGGGGCTGGG - Intronic
1174025140 20:47567864-47567886 AGAAAGTAAAATAATTGGCCTGG - Intronic
1174028955 20:47605159-47605181 AAAAAGTGAACTAATGGGCCAGG - Intronic
1174198435 20:48789947-48789969 AAGAAGGAGAAAAATGGGCCTGG + Intronic
1174198831 20:48792908-48792930 AGAAAGTACATTAGTGGGCCAGG + Intronic
1174230672 20:49043395-49043417 TTAAAGTAGATTAGTGGGCCGGG + Intergenic
1174240160 20:49127408-49127430 AAAAAGTAAAAAAGGGGGCCAGG + Intronic
1174600364 20:51719437-51719459 AAAAAGAAGAAACATGGGCCAGG + Intronic
1174635006 20:51991738-51991760 AAAAATTAGAAAAGTGCGGCCGG + Intergenic
1174796059 20:53523426-53523448 AAAAAGATGAAAACTGGGCCGGG + Intergenic
1174818807 20:53710001-53710023 AAAAAATAGAATTCTGGGCTGGG - Intergenic
1175869138 20:62199348-62199370 AAAATGTAGCATTGTTGGCCAGG + Intronic
1176308877 21:5139255-5139277 AAAAAGTAGAAAAATTAGCCAGG - Intronic
1176333637 21:5575710-5575732 AGAAACTAGACTTGTGGGCCTGG - Intergenic
1176394120 21:6245242-6245264 AGAAACTAGACTTGTGGGCCTGG + Intergenic
1176467299 21:7070932-7070954 AGAAACTAGACTTGTGGGCCTGG - Intronic
1176490860 21:7452710-7452732 AGAAACTAGACTTGTGGGCCTGG - Intergenic
1176509782 21:7685673-7685695 AGAAACTAGACTTGTGGGCCTGG + Intergenic
1176689082 21:9882050-9882072 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
1176718426 21:10373905-10373927 AAAAAGTACAAAAGTGAGCTGGG + Intergenic
1176740828 21:10600432-10600454 AGAAATTAGAAAAATGGGCCAGG - Intronic
1176801875 21:13438173-13438195 AAAGACTTGAATAGTAGGCCAGG + Intergenic
1176950802 21:15044112-15044134 AAACAGATGAGTAGTGGGCCGGG - Intronic
1177308070 21:19347431-19347453 AAAAACTTCAATAATGGGCCGGG + Intergenic
1177393236 21:20502502-20502524 AAAAAGTGGGTTAGTGGGCTGGG - Intergenic
1177424761 21:20908383-20908405 AAAAAGGAAAATAAGGGGCCTGG + Intergenic
1177484993 21:21745799-21745821 AAAAAGCAGTTTTGTGGGCCGGG + Intergenic
1177502150 21:21970634-21970656 AAAAAGTAGAAAACTAAGCCGGG - Intergenic
1177556151 21:22691224-22691246 AAAAAGTACAAAAATTGGCCAGG + Intergenic
1177562906 21:22779679-22779701 GAAAAGGAGAAAAGGGGGCCGGG - Intergenic
1177676316 21:24305319-24305341 AGAAAGAAGAATAGTGAGGCTGG + Intergenic
1177901798 21:26926108-26926130 AAAAAGTAAAAGAGTTAGCCAGG + Intronic
1177947717 21:27492578-27492600 AAAAAGTAGAAGAGAGATCCTGG - Intergenic
1177981017 21:27915302-27915324 AAAAAGTGGTTTTGTGGGCCAGG + Intergenic
1178213430 21:30564287-30564309 AAAAAGTAGAAAAATTAGCCAGG + Intergenic
1178292142 21:31377839-31377861 AAAAAAAAAAAAAGTGGGCCAGG + Intronic
1178536768 21:33416525-33416547 AAAGAATAGAAAAGTAGGCCAGG + Intronic
1179473517 21:41628159-41628181 AAAAAATAGAACAAGGGGCCAGG - Intergenic
1179834445 21:44020418-44020440 AAAAATAAGAAAAATGGGCCAGG - Intronic
1179848185 21:44122778-44122800 AAAAAGTAGAAAAATTAGCCAGG + Intronic
1180038391 21:45263009-45263031 AAAAATTAGCCTAGTGGGCGTGG - Intergenic
1180296365 22:10940807-10940829 AAAAAGTCTAATTGTAGGCCAGG + Intergenic
1180299654 22:11026810-11026832 AAAAAGTACAAAAGTGAGCTGGG + Intergenic
1180691179 22:17717314-17717336 AAAAATTAGAAGAGTTAGCCAGG + Intronic
1180739106 22:18040874-18040896 AGAAAGTAGAAGAGGTGGCCGGG - Intergenic
1180939588 22:19649689-19649711 AGAAAATAGAAGAGTTGGCCAGG + Intergenic
1181272706 22:21669004-21669026 AAAAAAAAAAATAGAGGGCCAGG - Intronic
1181295756 22:21837295-21837317 AGAAAGTAAAACAGTGGGCAGGG + Intronic
1181298975 22:21866225-21866247 AAAAAATACAAAAATGGGCCGGG + Intronic
1181318586 22:21987441-21987463 ACAAACAAGAATATTGGGCCAGG + Intergenic
1181424883 22:22828354-22828376 AAGAAGTAGAGGAATGGGCCGGG + Intronic
1181568956 22:23756617-23756639 AAAAAGAAAAAGAGTTGGCCAGG - Intergenic
1181796586 22:25316027-25316049 AAGAAGTGTAATATTGGGCCAGG - Intergenic
1182229160 22:28823726-28823748 AGAAATTAGAACAGTGGGACGGG + Intergenic
1182377656 22:29859569-29859591 CAATAAAAGAATAGTGGGCCAGG + Intergenic
1182472883 22:30559532-30559554 AAAATGTATAAAAATGGGCCAGG - Intronic
1182478251 22:30588790-30588812 AAAAAAAAAAAAAGTGGGCCAGG + Intronic
1182587853 22:31355774-31355796 AAAAAGTATAAAAGTTAGCCAGG - Intergenic
1182617983 22:31601416-31601438 GAAAAGTAGAAAGGTTGGCCGGG - Intronic
1182883259 22:33752076-33752098 TAAAATGAGAATAGTGGGGCTGG - Intronic
1182957019 22:34436155-34436177 AAAGAGTAGCTTAGAGGGCCAGG + Intergenic
1183158935 22:36097509-36097531 AGAAAGCAGAGTAGTGGGCTGGG - Intergenic
1183373116 22:37446721-37446743 AAAAAGTTAAATATAGGGCCGGG - Intergenic
1183436742 22:37800626-37800648 AAAAAGTAGAACAAGGGGCCAGG + Intergenic
1183506299 22:38210897-38210919 AAAAAGTACAAAAATTGGCCAGG + Intronic
1183681722 22:39334798-39334820 AGAAAGTAGAGGAATGGGCCGGG + Intergenic
1184209461 22:43026979-43027001 AAAAAGTATAAAAATGGGCCGGG - Intergenic
1184588465 22:45463877-45463899 AAAAAGTGGTTTCGTGGGCCTGG - Intergenic
1185135564 22:49069912-49069934 CAAAATTAGAATACTGGGCCAGG - Intergenic
1185359424 22:50396709-50396731 ATAAAGCAGGATAGTGAGCCAGG + Intronic
949550559 3:5109271-5109293 TAAAAATAAAATAATGGGCCGGG + Intergenic
949650617 3:6154780-6154802 GAAAAGTGGAACAGGGGGCCAGG + Intergenic
949735139 3:7163053-7163075 AAAAACTAGAAGAGTAGGCTGGG - Intronic
949990892 3:9578210-9578232 AAAAAGAACCATAGTTGGCCCGG - Intergenic
950350522 3:12346793-12346815 AAAAAATAAAATAATTGGCCAGG - Intronic
950855473 3:16100700-16100722 TAAAATTAACATAGTGGGCCAGG + Intergenic
951127057 3:18996403-18996425 AAAAAATGGTTTAGTGGGCCAGG - Intergenic
951317535 3:21205126-21205148 AAAAAGTGGTTTTGTGGGCCAGG + Intergenic
951893316 3:27586888-27586910 AAAAAGCAGACAAGTTGGCCTGG + Intergenic
952070018 3:29623295-29623317 TAAAAGTATAAAAGTCGGCCGGG + Intronic
952347025 3:32497562-32497584 AAAAAGTGTAAAAGTTGGCCGGG + Intronic
952352445 3:32553172-32553194 AAAAAATAGAAAAATTGGCCAGG + Intronic
952480914 3:33760963-33760985 AAAAAATAAAATAGTTGGCCAGG - Intergenic
952486208 3:33813368-33813390 AAAAAGTAAAATACTGGCACTGG - Intronic
952739015 3:36717393-36717415 AAAAAGTAGAATAGGAGGCTGGG - Intronic
953425385 3:42792682-42792704 AAAAAGTAGAGTTTTAGGCCAGG + Intronic
953589045 3:44233968-44233990 AAAGATTAGAATGGTGGGCTAGG + Intergenic
953590019 3:44242197-44242219 AAAGAGGAGAATGGTGGCCCGGG + Exonic
954166889 3:48767181-48767203 AGAAAGTATAATAATGGGCTGGG + Intronic
954183808 3:48901577-48901599 AAAAAAAAGAATTATGGGCCGGG + Intergenic
954207564 3:49071602-49071624 AAAAAGTACAAAAATTGGCCAGG + Intronic
954516895 3:51186628-51186650 AAAAAGTGGTTTCGTGGGCCAGG + Intronic
954741774 3:52757878-52757900 AGAAAGTAGAATGGTGGGCCAGG + Intronic
954777666 3:53034639-53034661 TAAAAGAATAATTGTGGGCCAGG + Intronic
954942667 3:54389007-54389029 AAAAAATAGACAAATGGGCCAGG + Intronic
955267732 3:57463491-57463513 TAAAAATAAAATAGGGGGCCAGG - Intronic
955296887 3:57744121-57744143 AAAAAGTAGAGTCTGGGGCCAGG + Intergenic
955731646 3:61993512-61993534 CAAAACTAGTACAGTGGGCCGGG - Intronic
955823922 3:62924904-62924926 AAAACATAGATTAGTGGGCAGGG + Intergenic
956082489 3:65572825-65572847 AAAAGGTAGTGTAGTGGGCATGG - Intronic
956203103 3:66728078-66728100 AAAAAGCAGAAGAGAGTGCCAGG - Intergenic
956308284 3:67850511-67850533 TAAAAATAAAATAGTTGGCCGGG - Intergenic
956446899 3:69334491-69334513 AAAAAATACAATAGTGGGACTGG + Intronic
956494161 3:69806379-69806401 AAAAATTAGTAAAATGGGCCGGG - Intronic
956532346 3:70234486-70234508 AAAAAATAGAATAATCAGCCAGG + Intergenic
956938629 3:74132083-74132105 AAAAAGTAGTTTAGTGGGCTGGG - Intergenic
956961446 3:74407248-74407270 AAAAAATAGAATATTTGGCCTGG - Intronic
957199295 3:77112050-77112072 AAAAAATACAATAGTTAGCCGGG + Intronic
957450621 3:80377290-80377312 AAAAAGAAGTACAGTAGGCCAGG - Intergenic
957683749 3:83473379-83473401 AAAAAGTGAAAAAGTGGGACTGG + Intergenic
957736999 3:84215552-84215574 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
957810090 3:85210699-85210721 AAAAAGTACAATAATTAGCCGGG - Intronic
958176638 3:90003637-90003659 AGAAAGGACAAAAGTGGGCCCGG - Intergenic
958465122 3:94448236-94448258 AAAAAGTCAAAAAATGGGCCGGG + Intergenic
958847596 3:99283782-99283804 AAAAAGGAGAAAAATGGGACAGG - Intergenic
958880280 3:99661928-99661950 AGAAAGTAGAATGATGTGCCAGG + Intronic
959480456 3:106866027-106866049 AATAACTATAAAAGTGGGCCAGG + Intergenic
959767788 3:110053449-110053471 AAAAAGAAGCTTAGTTGGCCAGG - Intergenic
960175006 3:114506795-114506817 TAAAAGTAGAGAGGTGGGCCGGG - Intronic
960280502 3:115776462-115776484 AAAAAGTTAAATAGTGGGTCAGG + Intergenic
960792373 3:121447456-121447478 AAAAAGTTAAAAAGTGGGCCAGG - Intronic
960842901 3:121978477-121978499 AAAAAGTGGTTTTGTGGGCCGGG + Intergenic
960983765 3:123257536-123257558 AAAAAGTACAAAAATTGGCCAGG + Intronic
961358823 3:126355268-126355290 AAAAAGTACAGTAGGGGGGCTGG + Intronic
961710217 3:128822777-128822799 AAAAAGTAGAACAGAGTGCGGGG + Intergenic
963244822 3:143048015-143048037 GAAGAGTAGAATAGTGGGTGGGG + Intronic
963494533 3:146042933-146042955 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
963716645 3:148811481-148811503 AAAAAGTGGTTTTGTGGGCCGGG + Intronic
963937893 3:151073417-151073439 AAAGAATAGTATAATGGGCCAGG + Intergenic
963943171 3:151115760-151115782 AAAGAATAGTATAATGGGCCAGG + Intronic
964348741 3:155781780-155781802 AAAAAAAAAAATAGTGGGCCGGG + Intronic
964428701 3:156580934-156580956 AAAATGAAGAATAGTTGACCAGG - Intergenic
964568090 3:158080545-158080567 CAAAAGAAGAACATTGGGCCAGG + Intergenic
964589155 3:158341324-158341346 AAAAAGTGGTTTCGTGGGCCAGG + Intronic
964610658 3:158611639-158611661 AAAGAGTAGAATAGTAGGTGGGG - Intergenic
964721908 3:159775624-159775646 AAACAGTACAAGAGTGGGCCTGG - Intronic
964750396 3:160048916-160048938 AAAAGGTACAAATGTGGGCCGGG - Intergenic
965142038 3:164850294-164850316 AAAAAGTACAAAAATGAGCCAGG - Intergenic
965388375 3:168073512-168073534 AAGGATTAGAATAGTGGGCATGG + Intronic
965786315 3:172339030-172339052 AAAAAATTTAATGGTGGGCCGGG - Intronic
965937091 3:174127869-174127891 ATAAATTAGTATAGTGAGCCTGG + Intronic
966074436 3:175919599-175919621 AAAAAGTAGTTTTGTGGGCTGGG - Intergenic
966115654 3:176458117-176458139 AAAAAGTGGTTTCGTGGGCCAGG + Intergenic
966202966 3:177376605-177376627 AAAAAGAAAAATACTTGGCCGGG - Intergenic
966425900 3:179779236-179779258 AAAAAAAAGACTAATGGGCCTGG + Intronic
966576677 3:181510695-181510717 AAAAAATGGTTTAGTGGGCCAGG + Intergenic
966798988 3:183744833-183744855 AAAAAAAAGAATAGTGGGAAGGG - Intronic
966957304 3:184895927-184895949 AAAAAATCAAATTGTGGGCCAGG - Intronic
966987727 3:185197470-185197492 AGAAAATAGAATGGTTGGCCAGG - Intronic
967412538 3:189181142-189181164 AAAAAGTGGTTTAGTGGGCTGGG - Intronic
967513701 3:190341530-190341552 AAAAAATTGTTTAGTGGGCCAGG - Intronic
967734020 3:192933379-192933401 AAAAAATAAAAAAGTGGGCTGGG - Intergenic
967871803 3:194236014-194236036 AAAAAGTAAAAAGCTGGGCCAGG + Intergenic
967959292 3:194907586-194907608 CAAAAGTGGCATATTGGGCCGGG + Intergenic
968014674 3:195318956-195318978 AAAAAATAGTATTGTGGGCCAGG + Intronic
968016716 3:195341616-195341638 AAAAACTAGAAATCTGGGCCAGG - Intronic
968125652 3:196158159-196158181 AAAAAGTAGAAAAATTAGCCAGG - Intergenic
968413710 4:410021-410043 TAAAAGTGGAATCATGGGCCAGG + Intergenic
968530469 4:1088681-1088703 AAAAAGTAGTTTTATGGGCCGGG + Intronic
968681777 4:1925961-1925983 AAAAAATAGAAAAGTTAGCCAGG - Intronic
969194592 4:5550774-5550796 AAAAAGTGGTTTTGTGGGCCTGG + Intronic
970426937 4:15954260-15954282 AAAAAGTGGTTTAGGGGGCCAGG - Intergenic
970427526 4:15959205-15959227 CAAGAGTGGACTAGTGGGCCAGG + Intergenic
970552630 4:17198421-17198443 ACAAATAAGAATAGTCGGCCAGG + Intergenic
970557297 4:17247304-17247326 AAGAAGTACAAAAGTGGGCCAGG + Intergenic
970584640 4:17503652-17503674 GAAAAGTTGAAAAATGGGCCAGG + Intronic
970587228 4:17526262-17526284 AAAAATTGGAAGAGTGGGCCGGG + Intronic
971063222 4:22996580-22996602 GAAAAGTAGAAGAGTGGACTGGG - Intergenic
971219850 4:24694974-24694996 AACAAGAAGAAAAGGGGGCCAGG - Intergenic
971224381 4:24737673-24737695 AAAAAGTGGTTTAGTGGGCCAGG + Intergenic
971397773 4:26245500-26245522 CAAAAGTACATTAGTGGGCCGGG - Intronic
972301198 4:37787286-37787308 AAAAAGTGGTTTTGTGGGCCAGG + Intergenic
972392280 4:38624990-38625012 AAAAAGTAGAGCATTTGGCCAGG + Intergenic
972603445 4:40592717-40592739 AAAAAATACAAAAGTTGGCCAGG - Intronic
972701493 4:41498201-41498223 ACAAACGAGAATAGTGGACCTGG + Intronic
972749328 4:41973041-41973063 AAAAAGTGGTTTCGTGGGCCAGG + Intergenic
972957539 4:44411172-44411194 AAAAGGTACAAAAGTGGGCCAGG + Intronic
973101414 4:46276003-46276025 AAAAAGTAGAATAATGAGAGTGG + Intronic
973303159 4:48612882-48612904 ATAAAATAGAACAGTTGGCCGGG - Intronic
974012999 4:56624530-56624552 AAAAAGTGGTTTTGTGGGCCAGG + Intergenic
974145078 4:57937026-57937048 AAAAAGTGGTTTTGTGGGCCAGG + Intergenic
974381227 4:61142915-61142937 AAAAAATAGAAGAAGGGGCCAGG + Intergenic
974424037 4:61717735-61717757 AAAATGTAGCATAATGGGGCTGG + Intronic
974688413 4:65263928-65263950 AAAATGAAAGATAGTGGGCCAGG + Intergenic
974915462 4:68173436-68173458 AAAAAGTGGTTTTGTGGGCCAGG + Intergenic
975630485 4:76396826-76396848 AAAAAGTTAATTAATGGGCCAGG - Intronic
975774218 4:77766766-77766788 AAAAAATAAAACAGTTGGCCAGG + Intronic
975804352 4:78096755-78096777 AAAAAGTGGTTTCGTGGGCCAGG - Intronic
975859256 4:78658675-78658697 TAGAAGTAGATTTGTGGGCCAGG - Intergenic
975875765 4:78835328-78835350 AAAAAGTCAAATAGTTGGCCTGG + Intronic
975887687 4:78984597-78984619 AAAATGTAGAAAAGTGTGCTGGG - Intergenic
975931792 4:79533253-79533275 AAAAAGTAGAATAGAGTGAGGGG - Intergenic
975952311 4:79788819-79788841 AAAAAGTAGTTTCATGGGCCAGG + Intergenic
976051600 4:81016788-81016810 AAAAAGTAGTTTTGTGGGCCGGG - Intergenic
976287605 4:83385271-83385293 AAAAAATGGTTTAGTGGGCCAGG - Intergenic
976632473 4:87253130-87253152 AAAAAGGACAGTAGTTGGCCGGG - Intergenic
976763097 4:88571051-88571073 AAAAAGTAAAATAGGAGGCCGGG - Intronic
977041488 4:92024663-92024685 AAAAAGTGGTCTTGTGGGCCAGG - Intergenic
977599710 4:98923144-98923166 AAACAGTAGGAAAATGGGCCGGG - Intronic
978097618 4:104797263-104797285 AAAAAGGAATATAATGGGCCAGG - Intergenic
978154741 4:105475614-105475636 AAAAAGTACAAAAATCGGCCAGG + Intergenic
978608338 4:110507678-110507700 CAAAATCAGAATATTGGGCCAGG + Intronic
979426446 4:120572765-120572787 AAAAAATAGCTTTGTGGGCCAGG - Intergenic
979444471 4:120794919-120794941 AAAAAATAGAATAGAAGGCTGGG - Intronic
979464682 4:121022494-121022516 AAAAAATGGTTTAGTGGGCCAGG - Intergenic
979526179 4:121719563-121719585 AAAAAATAGAAAAATGAGCCAGG - Intergenic
979847280 4:125531540-125531562 AAAAAGTAAAATTCTAGGCCAGG - Intergenic
979874139 4:125865903-125865925 AAAATATAGAATAATGGGCTGGG + Intergenic
980256384 4:130385475-130385497 AAAAAATATAATTGTGGGCTGGG + Intergenic
980352464 4:131699868-131699890 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
980853406 4:138410995-138411017 AAAAAATAAAATGGTGGGGCCGG - Intergenic
980926156 4:139140456-139140478 TAAAAGTAGAAAAGTTGGCTGGG + Intronic
980958019 4:139447960-139447982 TAAAAGTAGTAGACTGGGCCGGG - Intergenic
981478631 4:145213199-145213221 AAAAAGGAGCCTAGTGTGCCTGG - Intergenic
981792377 4:148553064-148553086 AAAAAATAAAAAAGTAGGCCAGG + Intergenic
981925918 4:150138957-150138979 AAAAATTTGAAAAATGGGCCAGG - Intronic
981930453 4:150183891-150183913 AAAAAATAGAAAAATGAGCCAGG - Intronic
982041221 4:151398993-151399015 AAACACTAGAATAGTTGGCCGGG + Intergenic
982128060 4:152201454-152201476 AAAGAATAGAATAGAGGACCAGG + Intergenic
982771214 4:159399199-159399221 AAAATGTAGCCAAGTGGGCCGGG + Intergenic
983088399 4:163474762-163474784 AAAAACTAAATTTGTGGGCCGGG + Intergenic
983236739 4:165188312-165188334 AAAAAGTGGTCTTGTGGGCCAGG - Intronic
983318925 4:166169712-166169734 AAAAAACAAAATAGTGGACCAGG - Intergenic
983620206 4:169753327-169753349 AAAACATAGAATAATTGGCCAGG - Intronic
984116591 4:175689011-175689033 AAAAAGTAGAATAATTAGCCAGG - Intronic
984238212 4:177186920-177186942 AAAAAGTAAAATAGAGAGCTTGG + Intergenic
984408556 4:179366294-179366316 ATAAAGAAGATAAGTGGGCCGGG + Intergenic
984774240 4:183466932-183466954 AAAAAGTGGTTTTGTGGGCCAGG + Intergenic
984780722 4:183523517-183523539 AAAAAGTAGAATCATGGTCTCGG - Intergenic
984797829 4:183681483-183681505 AAAATGTAAATTAATGGGCCGGG + Intronic
984870615 4:184321795-184321817 AAAAAGTATAACATTTGGCCAGG + Intergenic
984974069 4:185214933-185214955 AAGAACTAGAATAATGGGCCTGG + Intronic
985106856 4:186508577-186508599 AGAAAATAGATTAGTGGGACAGG - Intronic
985272131 4:188203619-188203641 AAGAAGCAGAATTATGGGCCGGG - Intergenic
985283690 4:188312549-188312571 AAAAAATAGAAAAGTTAGCCTGG - Intergenic
985438720 4:189961701-189961723 AAAAAGTCTAATTGTAGGCCAGG - Intronic
985934652 5:3087587-3087609 AGAAAGTAGAATAGTGGTAGGGG + Intergenic
986598227 5:9445372-9445394 AAAAAAAAAAAAAGTGGGCCGGG + Intronic
987272821 5:16329666-16329688 GAAAAATAGAATTTTGGGCCAGG - Intergenic
987357059 5:17072908-17072930 TAAAAGTAGATTAGTGGGCTGGG - Intronic
987435214 5:17885541-17885563 AAAAAATAGTTTTGTGGGCCAGG + Intergenic
988199958 5:28054902-28054924 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
988255458 5:28813944-28813966 AAAAAAAAAAAAAGTGGGCCAGG + Intergenic
988620261 5:32815939-32815961 AAAAAGTGGTTTTGTGGGCCAGG + Intergenic
988680462 5:33480154-33480176 AAACAGCAGAATAGTTGCCCAGG + Intergenic
989054414 5:37353301-37353323 AAAAAGTAAGAAAGTTGGCCGGG + Intronic
989161396 5:38394702-38394724 AAAAAAAAAAAAAGTGGGCCCGG - Intronic
989259952 5:39407494-39407516 TAAAACTAGCATGGTGGGCCGGG - Intronic
989267992 5:39499864-39499886 AAAAAGTACAAAAATTGGCCAGG - Intergenic
989389155 5:40882470-40882492 AAAAAGTGGTTTTGTGGGCCAGG + Intergenic
989441757 5:41480623-41480645 AAAGTATAGCATAGTGGGCCAGG + Intronic
989686241 5:44090457-44090479 AAGAAGAAGAATAGTGGGGAGGG - Intergenic
989990544 5:50759212-50759234 AAAAAATTTATTAGTGGGCCGGG - Intronic
990193335 5:53286525-53286547 AAAAAGCAGTTTCGTGGGCCAGG - Intergenic
990264512 5:54061118-54061140 AAAAAGTGGTTTCGTGGGCCAGG + Intronic
990526041 5:56628830-56628852 AAAAAGTGGTTTTGTGGGCCAGG + Intergenic
990583340 5:57185837-57185859 AAAAAGTATAAAAGTAAGCCTGG + Intronic
990622054 5:57570640-57570662 AAAAGGTTGCAGAGTGGGCCGGG + Intergenic
991298627 5:65106021-65106043 CAAAAGTAGAAAAGGGGTCCTGG + Intergenic
992108912 5:73474177-73474199 AAAAAATAGAAAAATTGGCCAGG + Intergenic
992113632 5:73519004-73519026 TAAAAGTAGCTTTGTGGGCCGGG - Intergenic
992312518 5:75515444-75515466 TAAAAAAAGAATATTGGGCCTGG - Intronic
992788076 5:80188725-80188747 AAAAAGTAAAAAAATTGGCCAGG + Intronic
992834826 5:80629967-80629989 AAAATGTAGCATTGTTGGCCAGG + Intronic
992880937 5:81109359-81109381 AAAAATTAAAATAATAGGCCAGG + Intronic
993186429 5:84627773-84627795 AAAAAGGAGAGTAGAGGGCCTGG + Intergenic
993229891 5:85221053-85221075 CGAAAGTAGAAAACTGGGCCGGG - Intergenic
993724012 5:91348038-91348060 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
993842544 5:92898437-92898459 AAGAAGTATAATATTGGACCTGG + Intergenic
993860983 5:93136837-93136859 AAAAATTAACATAGTGGGCCGGG - Intergenic
993880089 5:93351484-93351506 AAAAAGAAGGGGAGTGGGCCGGG + Intergenic
994477171 5:100286102-100286124 AAAACATAGAATATTAGGCCAGG - Intergenic
994727854 5:103457450-103457472 AGAAAGTAGAATGGTGGTCTGGG - Intergenic
995043970 5:107622724-107622746 CAAAAGTTGAATACTCGGCCGGG + Intronic
995091466 5:108183332-108183354 TAAAAGTAGAAAACTGGGCCAGG - Intronic
995119738 5:108522970-108522992 AAAAAGAACAAAAGTAGGCCAGG - Intergenic
995196861 5:109380510-109380532 TAAAAGAAGAAAAGTTGGCCGGG + Intronic
995213640 5:109570229-109570251 TGAAAATAGGATAGTGGGCCAGG - Intergenic
996011291 5:118483851-118483873 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
996431630 5:123385898-123385920 AAAAAATATAATAGTAGGCCTGG - Intronic
996636102 5:125691906-125691928 AAAAAGTGGTTTTGTGGGCCAGG + Intergenic
996733818 5:126740943-126740965 AAAAAGTAGGCAAGTGGGCAAGG - Intergenic
997056702 5:130452326-130452348 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
997108271 5:131046114-131046136 AAAAAGCAGTTTAGTGGGCTGGG - Intergenic
997274658 5:132574439-132574461 AAAAAATAGTTTCGTGGGCCAGG - Intronic
997310946 5:132882050-132882072 AAAAAGTAGAAAAATTAGCCAGG + Intronic
997324899 5:133012170-133012192 AAAAAAGAAAAAAGTGGGCCAGG + Intronic
997330659 5:133058830-133058852 AAAAAGTACAAAAATTGGCCGGG + Intronic
997541348 5:134665530-134665552 AAAAATAAAAATAGGGGGCCAGG - Intronic
997544277 5:134692205-134692227 AAAAAGTACAAAAATGAGCCAGG - Intronic
998046111 5:138988126-138988148 AAAAAGTAAAAAACTTGGCCAGG - Intronic
998162014 5:139818383-139818405 AAAAAGTAGAAAAATTAGCCAGG + Intronic
998576695 5:143324491-143324513 AAAAAGTGGTTTCGTGGGCCAGG - Intronic
998614701 5:143727202-143727224 TAAAAGTAAAATTGTGGGCTGGG - Intergenic
998727681 5:145036425-145036447 AAAAAGTAACATGGAGGGCCGGG - Intergenic
998884269 5:146677686-146677708 AAAAAATACAATAGTTAGCCAGG - Intronic
998910616 5:146956070-146956092 AGAAAGAAGACTATTGGGCCAGG - Intronic
998937723 5:147248593-147248615 GCAAAGTAGAACAGTGGGGCAGG - Intronic
999285993 5:150394619-150394641 AAGCAGCAGAAAAGTGGGCCTGG + Intronic
999579349 5:153018620-153018642 TAAAAGTAAAATTGTCGGCCGGG + Intergenic
999669406 5:153945376-153945398 AAAAAGTGGTTTCGTGGGCCAGG - Intergenic
999894225 5:156011731-156011753 TAAAAATAGAATTCTGGGCCAGG - Intronic
999984815 5:156993128-156993150 AAAAAGTACAAAAGTTAGCCGGG - Intergenic
1000083671 5:157870257-157870279 AATAAATAGAATAGTTGGCTGGG + Intergenic
1000392266 5:160736466-160736488 AAAAAGTCTACTAGTAGGCCAGG + Intronic
1000687849 5:164274797-164274819 AAAAAATAAAAAAGTAGGCCGGG + Intergenic
1000802961 5:165751644-165751666 AAGAATAAAAATAGTGGGCCAGG - Intergenic
1001037105 5:168305117-168305139 AAAAAAAAAAATACTGGGCCAGG - Intronic
1001998168 5:176178785-176178807 AATATGTAGAATATTGGGGCTGG - Intergenic
1002396627 5:178961222-178961244 AAAAACTAAGATTGTGGGCCAGG - Intronic
1003306889 6:4937196-4937218 AAAAAGTTGAAAAATGAGCCAGG + Intronic
1003376026 6:5578512-5578534 AAAAAAGAAAACAGTGGGCCAGG + Intronic
1003453311 6:6257529-6257551 ATAAAGTAGAGTAGTTCGCCAGG + Intronic
1003575858 6:7293707-7293729 AAAAAATACAATATTTGGCCAGG - Intronic
1003735559 6:8874165-8874187 AAAGAATAGAATATAGGGCCGGG - Intergenic
1003841043 6:10119644-10119666 AAAAATCAAAATATTGGGCCAGG + Intronic
1004133977 6:12948973-12948995 AAGAAATAGAAAAATGGGCCAGG + Intronic
1004218770 6:13726729-13726751 AAAAAATAGAAAAGTTAGCCAGG + Intergenic
1004227936 6:13804477-13804499 AAAAAGTAGAAGTCTTGGCCGGG + Intronic
1004371377 6:15055577-15055599 ATAAAGTAAAATAAAGGGCCAGG - Intergenic
1004484890 6:16057191-16057213 AAAAAAAAAAACAGTGGGCCGGG - Intergenic
1004612869 6:17262409-17262431 AAAAAGTACAAAAGTTAGCCAGG + Intergenic
1004648449 6:17585567-17585589 AAAAAATAAAATAATAGGCCAGG + Intergenic
1004983092 6:21048074-21048096 AAAAATTAGAGTCGTGGACCTGG + Intronic
1005026160 6:21465022-21465044 AACAGGGAGAATGGTGGGCCTGG - Intergenic
1005064525 6:21805593-21805615 AAAAAGTACAATTTTTGGCCAGG + Intergenic
1005133441 6:22538611-22538633 AAAAGGTAGCATAGAGGGTCAGG - Intergenic
1005316308 6:24606093-24606115 AAAAAGTACAAAAGTTAGCCAGG - Intronic
1005631928 6:27716609-27716631 AAAAAATAGAAAAATTGGCCAGG - Intergenic
1005725555 6:28644207-28644229 AGAAAGTACATTACTGGGCCGGG + Intergenic
1005953960 6:30650488-30650510 TAAAAATAGAAAACTGGGCCTGG + Intronic
1006355442 6:33554206-33554228 AAAAAGTAACATTATGGGCCGGG + Intergenic
1006520394 6:34568007-34568029 AAAAAATACAATAGTTAGCCGGG - Intergenic
1006665945 6:35693456-35693478 AAAGAGTAGAATAACTGGCCGGG - Intronic
1006753966 6:36398684-36398706 ACAAAGTAGATTGGTGGGGCTGG + Intronic
1006949561 6:37810244-37810266 AAAAAGTAAAAAAGTTAGCCAGG + Intergenic
1006976166 6:38104004-38104026 AAAAAGTAATATAGTTGGGCAGG + Intronic
1007040310 6:38715485-38715507 AAAAAGAAGGAAAGTGGGCGGGG - Intronic
1007659238 6:43472582-43472604 AGAAAATAGAATGGTCGGCCGGG - Intergenic
1007669882 6:43543168-43543190 AAAAGTCAGAATAGTGGGCTGGG + Intronic
1008141603 6:47838506-47838528 AAAAAGTAGAAAAATTAGCCAGG - Intergenic
1008650061 6:53552723-53552745 AAAAAGTGGTTTTGTGGGCCAGG + Intronic
1008860504 6:56143493-56143515 AAAAAATTGTATAGTCGGCCGGG - Intronic
1008936910 6:57001322-57001344 AAAAAATAGAAAAATTGGCCAGG - Intronic
1008962046 6:57276092-57276114 AAAAAGTTAAAAACTGGGCCAGG + Intergenic
1009447336 6:63758058-63758080 AAAAAATAGAATAATTAGCCAGG - Intronic
1009720776 6:67466774-67466796 AAATAAAATAATAGTGGGCCGGG + Intergenic
1010418335 6:75641816-75641838 AAAAAATAAAATAATTGGCCTGG + Intronic
1010905239 6:81479045-81479067 AAAAATTAGAATCCTGGCCCAGG - Intergenic
1010920406 6:81673380-81673402 AAAAAGTGGTTTTGTGGGCCGGG - Intronic
1011152555 6:84290261-84290283 AAAAAGTTGTTTTGTGGGCCAGG - Intergenic
1011256137 6:85423092-85423114 AAAAAGGAGCATCCTGGGCCAGG + Intergenic
1011293077 6:85797481-85797503 AAAAAATAGAATAGAGAGGCAGG + Intergenic
1012347851 6:98213671-98213693 AAAAAGCCAGATAGTGGGCCAGG + Intergenic
1012469592 6:99556270-99556292 AGAAAGTAGAATGGTAGGGCTGG - Intronic
1012706729 6:102540202-102540224 GAAAAGTAGAATGGTGATCCGGG - Intergenic
1012830773 6:104201397-104201419 AAAAAGTGGATTTGTGGGCTGGG + Intergenic
1012955516 6:105565466-105565488 AAAAAGCACTATACTGGGCCAGG - Intergenic
1013086609 6:106863038-106863060 AAAAAGTGGCTTCGTGGGCCAGG + Intergenic
1014315326 6:119857247-119857269 AAAAAGTACGACAGTAGGCCAGG + Intergenic
1014426306 6:121311432-121311454 AAAAATTATAATAGTAGGCTGGG + Intronic
1014816135 6:125937929-125937951 AAAAATTATATTAGTTGGCCGGG + Intergenic
1015397863 6:132755275-132755297 AAAAAGTAGCATGATGGTCCAGG - Intronic
1015720633 6:136237514-136237536 AAAAATTAAAAATGTGGGCCAGG + Intronic
1015829362 6:137351232-137351254 AAAAAGGAGAAAAATGGGCCAGG + Intergenic
1016317899 6:142809887-142809909 AAAAATTAGAATATTGGGCCGGG - Intronic
1016393520 6:143598569-143598591 TAAAAGCAGAAGTGTGGGCCAGG + Intronic
1016517561 6:144911959-144911981 AGAAAATAAAATTGTGGGCCAGG + Intergenic
1016705796 6:147105872-147105894 AGAAGGTAGAATAATAGGCCGGG - Intergenic
1016721311 6:147302287-147302309 AACAAGTAGAAAAGAGGGCTAGG + Intronic
1016954260 6:149611163-149611185 AAAAAGGAAAATAATAGGCCAGG + Intronic
1016970594 6:149758503-149758525 AAAAAGAAAAAAATTGGGCCAGG - Intronic
1017352836 6:153463381-153463403 AGAAAGTAAAATAGTGGGCTGGG + Intergenic
1017689179 6:156946059-156946081 TAAAAGAAGAATAATGGGCCAGG + Intronic
1017892224 6:158648294-158648316 AAAAAATAAAATAATAGGCCAGG + Intergenic
1018055103 6:160045522-160045544 AAAAAGTAGAAGAGAGGGAATGG - Intronic
1018144618 6:160872759-160872781 AGAAAGTAAAATAGGGGGCTGGG - Intergenic
1018214797 6:161516530-161516552 AAAAAGAAGAAAAGTGGGCTAGG + Intronic
1018246322 6:161827801-161827823 AAAAAGTAAAATCAAGGGCCGGG - Intronic
1018248123 6:161841643-161841665 AGAAAGTCTAAAAGTGGGCCAGG - Intronic
1018259160 6:161952320-161952342 TAAAATTACAATAGTCGGCCAGG + Intronic
1019498680 7:1353330-1353352 AAAAAGTAGAAAAATAAGCCGGG + Intergenic
1019873701 7:3790511-3790533 AAAAAGTCTAACAGTCGGCCAGG + Intronic
1019980274 7:4616358-4616380 AAAAAGTAGATTATAGGGGCTGG + Intergenic
1019988513 7:4675960-4675982 AAAAAGAAGCATAGCTGGCCAGG - Intergenic
1020135123 7:5583268-5583290 AAAAAGAAAAAAAGTGGGCCAGG + Intergenic
1020178257 7:5899604-5899626 AAAAAATTGAAAAGTGAGCCGGG + Intronic
1020304672 7:6825397-6825419 AAAAAATTGAAAAGTGAGCCGGG - Intronic
1020631882 7:10649664-10649686 AAAAAGTAGTTTTGTGGGCTGGG - Intergenic
1020814315 7:12886159-12886181 TAAAAGTAGATTAGTGGGGAAGG + Intergenic
1021036873 7:15810135-15810157 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
1021069873 7:16223129-16223151 AAAAAATAGAAAAGTTAGCCAGG + Intronic
1021119349 7:16780393-16780415 AAAAAAATGAATATTGGGCCAGG - Intronic
1021488423 7:21192293-21192315 TAAAATTAGAATAATAGGCCAGG + Intergenic
1021676882 7:23089569-23089591 AAAAGGTAGTAAAATGGGCCGGG + Intergenic
1021708577 7:23392788-23392810 AAAAAGTACAATAATTTGCCAGG - Intronic
1021918380 7:25458026-25458048 AAAAAAATTAATAGTGGGCCAGG + Intergenic
1022158727 7:27686608-27686630 AAAAAGTAAAGTAGTGAGGCAGG - Intergenic
1022204130 7:28147139-28147161 AAAAATCAGAATTCTGGGCCAGG - Intronic
1022678353 7:32521805-32521827 AAAAAGTGGTTTTGTGGGCCTGG + Intronic
1022725529 7:32978215-32978237 AAAATATATAAAAGTGGGCCAGG - Intronic
1023316645 7:38944595-38944617 AAAAAGGAGTAAACTGGGCCAGG + Intergenic
1024078171 7:45834054-45834076 AAAAAATAGAAAAGTTAGCCGGG + Intergenic
1024430322 7:49281253-49281275 AAAAAGTAGAATTGTGTACTGGG - Intergenic
1024843933 7:53620319-53620341 AAAAAATGGTTTAGTGGGCCAGG + Intergenic
1025005711 7:55353097-55353119 AAAAAAAAAAATTGTGGGCCAGG + Intergenic
1025048084 7:55709466-55709488 AAAATATATAAAAGTGGGCCAGG + Intergenic
1025773607 7:64537630-64537652 AAAAAACAGAATAGACGGCCAGG + Intronic
1025779616 7:64588616-64588638 AAAAAGTTAAAAAGTGGGCCCGG - Intergenic
1026246025 7:68620543-68620565 AAAAAATAGATTAGTAGGCCTGG + Intergenic
1026348047 7:69491976-69491998 TAAAAGAAAAAAAGTGGGCCGGG + Intergenic
1026532526 7:71212125-71212147 AAAAAGTGGTTTTGTGGGCCTGG + Intronic
1026743975 7:72997041-72997063 AAAAATTAGAAAATTAGGCCGGG - Intergenic
1026797377 7:73375087-73375109 AAAAATAAGAATAATTGGCCAGG + Intergenic
1026856263 7:73757168-73757190 AAAAAAAAGAAGAGAGGGCCGGG + Intergenic
1027004215 7:74678537-74678559 AGAAAATAAAATAATGGGCCTGG + Intronic
1027030082 7:74881736-74881758 AAAAATTAGAAAATTAGGCCGGG - Intergenic
1027099762 7:75368041-75368063 AAAAATTAGAAAATTAGGCCGGG + Intergenic
1027122076 7:75528997-75529019 AAAAAGAACAGTAGTTGGCCGGG - Intergenic
1027218369 7:76198601-76198623 AAAAATTATAAGAGAGGGCCGGG + Intergenic
1027261749 7:76469686-76469708 AAAAATTGGAATATTTGGCCGGG - Intronic
1027294425 7:76753599-76753621 AGAAAGTAAAATAGTGGGTGGGG + Intergenic
1027313128 7:76967785-76967807 AAAAATTGGAATATTTGGCCGGG - Intergenic
1027394907 7:77744329-77744351 AAAAAGTCAAACAGTAGGCCAGG - Intronic
1027519116 7:79181519-79181541 AAAAAATAGTTTTGTGGGCCGGG - Intronic
1027532149 7:79349374-79349396 AAGAAGTAGAATACTTGTCCAGG - Intronic
1027554802 7:79649960-79649982 AAACTGTAGAATATTTGGCCTGG + Intergenic
1027590796 7:80116447-80116469 AAGAACATGAATAGTGGGCCAGG + Intergenic
1027799148 7:82730791-82730813 AAAAAATAGAATGTTGGGCTGGG + Intergenic
1027979603 7:85200791-85200813 AAAAAATGGTTTAGTGGGCCAGG + Intergenic
1028513846 7:91654756-91654778 AAGAAGTAAAATAGTGGGAAGGG - Intergenic
1028516600 7:91684149-91684171 AAGAAGTAGAAGAGTGGGAGAGG - Intergenic
1028690757 7:93647021-93647043 AAAAATCAGAAAAGGGGGCCGGG + Intronic
1028972416 7:96874230-96874252 AAAAAGTAGAAAGATGGGACAGG + Intergenic
1029172816 7:98642890-98642912 AAAAAAAAAAATAGTTGGCCAGG + Intergenic
1029286979 7:99472561-99472583 TAAAAGAAGAAAAATGGGCCAGG - Intergenic
1029369274 7:100137663-100137685 AAAAAAAAAAAAAGTGGGCCGGG - Intergenic
1029796939 7:102906261-102906283 AAAAAGTTAAAAAGTGGGGCAGG - Intronic
1030103718 7:105969099-105969121 AAAAATAAAAAAAGTGGGCCGGG + Intronic
1030207959 7:106968902-106968924 AAAAAGTTGAATTGAGGGTCGGG + Intergenic
1030212584 7:107011048-107011070 AAAATGTCCCATAGTGGGCCGGG + Intergenic
1030242591 7:107344817-107344839 AGAAAGTAAAACAGTCGGCCAGG - Intronic
1030316732 7:108123548-108123570 AAAAAGTAGAATATTCAGACAGG + Intronic
1030627672 7:111861449-111861471 TAAAAGTATAATATTAGGCCGGG + Intronic
1030748843 7:113204273-113204295 AAAAAGGAGAATAGTAGGCAAGG + Intergenic
1030915142 7:115303673-115303695 AAAAAGTGGTTTCGTGGGCCAGG + Intergenic
1031145697 7:117994929-117994951 AAAAAGTGGTTTAGTGGGCTGGG + Intergenic
1031288973 7:119908319-119908341 AAAAAGTAATTTTGTGGGCCAGG - Intergenic
1031299153 7:120042492-120042514 AAAAAGTGGTTTCGTGGGCCAGG + Intergenic
1031600403 7:123700731-123700753 AAGAGGTAGAATAGTTGGCCGGG - Intronic
1031626337 7:123996875-123996897 AAAAAGAAAAAAAGGGGGCCGGG + Intergenic
1031825181 7:126556349-126556371 AAAAAAAAAAAAAGTGGGCCAGG + Intronic
1031835733 7:126679868-126679890 AAAAAATAGAAAAATGAGCCAGG + Intronic
1032061456 7:128728647-128728669 AAAAATCAGAATATTTGGCCTGG - Intronic
1032170075 7:129577399-129577421 AAAAAATAGAATTATAGGCCAGG - Intergenic
1032210866 7:129912954-129912976 AAAATGTACAACATTGGGCCAGG + Intronic
1032381013 7:131480828-131480850 AATAAATAAAATAATGGGCCTGG - Intronic
1032615546 7:133465838-133465860 AAAAAGGAGAAAACTCGGCCGGG + Intronic
1032624787 7:133579988-133580010 AGAAAGTAATATTGTGGGCCGGG - Intronic
1032814186 7:135454729-135454751 AAAAAGTACAATAATGAGCTGGG + Intronic
1032860039 7:135868113-135868135 AAAAATTATAAAAGTAGGCCTGG + Intergenic
1033209244 7:139448289-139448311 AAAAAGGAGAAATGTTGGCCAGG - Intergenic
1033354462 7:140588356-140588378 AGAAAATAGAAAAGGGGGCCGGG + Intronic
1033864623 7:145673614-145673636 TAAAAGTAGTTTAGTCGGCCGGG + Intergenic
1033892584 7:146033395-146033417 AAAAAATAGAATTTTTGGCCGGG + Intergenic
1034095708 7:148405878-148405900 AAAAATTACAATGGTAGGCCAGG - Intronic
1034571995 7:151963691-151963713 AAAAATTAGAATAAATGGCCAGG - Intronic
1034604698 7:152301207-152301229 AAAAAAAAGAAAAGTTGGCCGGG + Intronic
1034623040 7:152471180-152471202 AAAAAGTGGTATAATGGGCCAGG + Intergenic
1034757471 7:153635912-153635934 ACAAAGTAGAATAGTTGGCTGGG - Intergenic
1035162526 7:156961449-156961471 AGAAAGTACATTAGTGGGCTGGG + Intronic
1035172377 7:157024499-157024521 AAAGAGTAGAATGATAGGCCAGG - Intergenic
1036141137 8:6209825-6209847 AGAAAGTATAATGATGGGCCAGG + Intergenic
1036532571 8:9608099-9608121 AAAAAGTAAAAAAATGAGCCAGG - Intronic
1036976161 8:13415105-13415127 AAAAAATAACATCGTGGGCCAGG - Intronic
1036980318 8:13462699-13462721 AAGAATAAGAATAGTAGGCCGGG - Intronic
1037056821 8:14452804-14452826 AAAAAGAAGAGTAAGGGGCCGGG + Intronic
1037117433 8:15243516-15243538 AATAATAATAATAGTGGGCCGGG + Intergenic
1037190844 8:16123138-16123160 AAGAATTTGAATAGAGGGCCGGG - Intronic
1037436726 8:18870936-18870958 AAAGAGTACAAAAGTTGGCCAGG + Intronic
1037486939 8:19356708-19356730 AAAGAGGAGAATTGTGGGCCAGG + Intronic
1037871210 8:22498827-22498849 TAAAAGTAGAATTATTGGCCGGG + Intronic
1038261161 8:25996139-25996161 AAAAAGTAAAACAATTGGCCAGG + Intronic
1038297512 8:26309019-26309041 AAAAAGTAGAAATATGAGCCAGG - Intronic
1039497352 8:37990842-37990864 AAAAAATAGAAAAATGAGCCAGG - Intergenic
1039710570 8:40052028-40052050 GAAAAAAAGATTAGTGGGCCAGG - Intergenic
1039816026 8:41095162-41095184 AAAAATTAGAAAAGGAGGCCAGG - Intergenic
1039826799 8:41181612-41181634 AAAAAATAAAGTGGTGGGCCGGG + Intergenic
1039914209 8:41847871-41847893 AAAAAATAGAACTGTGGGCCAGG + Intronic
1039954212 8:42194978-42195000 TAAAAGTAGGTTAGTCGGCCGGG + Intronic
1039995297 8:42527108-42527130 AAAAAAAAAAAAAGTGGGCCGGG + Intronic
1040025796 8:42780894-42780916 AAAAAGAAGAAAAGATGGCCAGG - Intronic
1040636679 8:49283552-49283574 AAGGTGTGGAATAGTGGGCCTGG - Intergenic
1040933863 8:52763600-52763622 AAAAAGCTGAAAAGTGGGACTGG + Intergenic
1041085298 8:54251209-54251231 AAAAAGCAGAAGGGTGGGGCCGG - Intergenic
1041369000 8:57140624-57140646 AAAAAGTACAAAAGTTAGCCGGG + Intergenic
1041492542 8:58450655-58450677 TAAAAGTAGAAAAGTGGCTCTGG - Exonic
1041572417 8:59352493-59352515 AAAAAGTAGAAAAATTAGCCAGG - Intergenic
1042244178 8:66694254-66694276 AAAAAAAAAAATAGTGGGCCAGG - Intronic
1042248928 8:66736912-66736934 AAAAAGTAGCTGGGTGGGCCGGG - Intronic
1042261156 8:66860830-66860852 AAAAAGTAAAATAATAGGCCAGG + Exonic
1042276400 8:67009270-67009292 AAAAAATAAAATAAAGGGCCGGG + Intronic
1042288834 8:67145816-67145838 AAAAATTAGAAAAGGGGGCTGGG - Intronic
1042540648 8:69904291-69904313 AAAAAAAAAAATTGTGGGCCAGG - Intergenic
1042843320 8:73146698-73146720 AAATAGTGGAATTGTAGGCCTGG - Intergenic
1042967873 8:74375030-74375052 AATAAGAAAAATATTGGGCCAGG + Intronic
1043047624 8:75347716-75347738 AAAAAGTAGAAAAATTAGCCGGG + Intergenic
1043660572 8:82735953-82735975 AAAAAGTGGTTTTGTGGGCCAGG + Intergenic
1044231149 8:89779613-89779635 AAAAACTTGAAAATTGGGCCAGG - Intronic
1044243263 8:89911637-89911659 AAAAAAAAGAAAAGAGGGCCAGG + Intronic
1044394226 8:91691092-91691114 TAAAAGTAGAAACATGGGCCAGG + Intergenic
1044592407 8:93926970-93926992 AAAAAGTACATATGTGGGCCAGG - Intergenic
1044847315 8:96394847-96394869 AAAAATTAGCATGGTGGGCATGG + Intergenic
1045078993 8:98604006-98604028 AAAAAGTGGAAGAGGGAGCCAGG + Intronic
1045104874 8:98882704-98882726 AAAAAAGAGGATATTGGGCCAGG - Intronic
1045162856 8:99568584-99568606 AAAAAATGAAATAGTTGGCCAGG - Intronic
1045359731 8:101421827-101421849 AAAAAGTTAAAAAGTTGGCCGGG + Intergenic
1045421097 8:102015937-102015959 AAAAAGAAGAAGGGTGGGGCTGG + Intronic
1045697233 8:104823385-104823407 AAAAAGTCAAAAAGTAGGCCAGG + Intronic
1045855252 8:106757475-106757497 AAGAAGTGAAATAGAGGGCCAGG - Intergenic
1045940111 8:107728702-107728724 AAAAAGTGGTTTAATGGGCCAGG - Intergenic
1046052929 8:109044873-109044895 AAAAAGTGGTTTTGTGGGCCGGG - Intergenic
1046618144 8:116499832-116499854 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
1046662127 8:116959142-116959164 AAAAATGAAAAGAGTGGGCCGGG - Intronic
1046814740 8:118571542-118571564 AAAAAGTGGTTTTGTGGGCCGGG + Intronic
1046929010 8:119824616-119824638 AAAAAGTGGTTTTGTGGGCCAGG + Intronic
1047271037 8:123358997-123359019 TAAAAGTAATATACTGGGCCAGG - Intronic
1047304440 8:123641598-123641620 AAGGAGAAGAATAGGGGGCCGGG + Intergenic
1047593246 8:126349641-126349663 TAAAAAAAGAATAGTCGGCCAGG + Intergenic
1047832131 8:128645574-128645596 AAAATGTAAAATGTTGGGCCAGG - Intergenic
1048046072 8:130774681-130774703 AAAAAATAGTTTCGTGGGCCAGG + Intergenic
1048065925 8:130968464-130968486 AAAAAGCAGAATAACTGGCCGGG - Intronic
1048286180 8:133143382-133143404 ATAAAATAGAATCGTGGGCTGGG + Intergenic
1048886701 8:138914812-138914834 AAAAAGTAGAAGGGTGCCCCGGG - Intergenic
1049076269 8:140398909-140398931 AAAAAGTGGTTTCGTGGGCCGGG + Intronic
1049626699 8:143626478-143626500 AAAAAAAAGAATATCGGGCCGGG - Intergenic
1049717857 8:144101709-144101731 AAAAATTAGCTGAGTGGGCCGGG - Intronic
1049825552 8:144665511-144665533 AAAAAGTAGTTTTGTGGGCCAGG + Intergenic
1050196914 9:3094888-3094910 AAAAGGTGGAAAAGTGGGCAAGG + Intergenic
1050535479 9:6626998-6627020 AAAAGGCAAACTAGTGGGCCGGG + Intronic
1051282555 9:15456626-15456648 AAAAAATAGAAAAATTGGCCAGG - Intronic
1051573123 9:18583185-18583207 AAAAAGTGGTTTCGTGGGCCGGG + Intronic
1051623404 9:19075656-19075678 AAGAAGTACATTAATGGGCCAGG + Intronic
1051857416 9:21584785-21584807 AAAAACTAGAACATTGGGCATGG - Intergenic
1052315064 9:27107927-27107949 AAAAACAAAAACAGTGGGCCTGG - Intergenic
1052414269 9:28157419-28157441 AAAAAGTGGTTTTGTGGGCCAGG - Intronic
1052914620 9:33915140-33915162 AAAAAATCAAATAGTTGGCCAGG + Intronic
1053088582 9:35251257-35251279 AAAAAATGGAAGAGTAGGCCGGG - Intronic
1053747727 9:41216966-41216988 AAAAAGTCTAATTGTAGGCCAGG - Intergenic
1053780245 9:41599845-41599867 AAAAAGTGGTTTTGTGGGCCAGG + Intergenic
1054168187 9:61810002-61810024 AAAAAGTGGTTTTGTGGGCCAGG + Intergenic
1054338664 9:63833548-63833570 AAAAAGTCTAATTGTAGGCCAGG + Intergenic
1054479558 9:65648404-65648426 AAAAAGTCTAATTGTAGGCCAGG + Intergenic
1054669341 9:67770816-67770838 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
1054742952 9:68827045-68827067 AAAAAGTGGAATTTTTGGCCGGG - Intronic
1054938593 9:70715561-70715583 AAACAGAAGAAGAGTGGCCCAGG + Intronic
1054940284 9:70733554-70733576 AAACAGAAGAAGAGTGGCCCAGG + Intronic
1055008416 9:71536020-71536042 AAAAAATATAATAATAGGCCGGG + Intergenic
1055141953 9:72886564-72886586 AAAAAGTGGTTTAATGGGCCAGG + Intergenic
1055175617 9:73314150-73314172 AAAAAGTGGCTTTGTGGGCCAGG - Intergenic
1055219579 9:73912656-73912678 AAAAAATATAATTCTGGGCCAGG + Intergenic
1055341938 9:75293220-75293242 AAAAAGTAGTTTCATGGGCCGGG - Intergenic
1055867743 9:80835984-80836006 AAAAAGTAGAACACTGTGCTAGG + Intergenic
1055929317 9:81543291-81543313 AAAAAGTATAAAAATAGGCCAGG + Intergenic
1055952335 9:81741927-81741949 AAAAATTAAAATAATAGGCCGGG + Intergenic
1056042490 9:82682707-82682729 AATAAGCAGAGCAGTGGGCCTGG - Intergenic
1056560350 9:87724383-87724405 AAAAAGAGGAATAATCGGCCGGG + Intergenic
1056595117 9:88001799-88001821 AAAAAGTGGTTTTGTGGGCCAGG + Intergenic
1056631946 9:88301210-88301232 AAAAAGTGGAACAGGAGGCCAGG - Intergenic
1056811625 9:89769474-89769496 AAAAAAAAGAATAGGAGGCCGGG - Intergenic
1057081131 9:92175487-92175509 ACAAAGGAGAATAGTGGCTCTGG + Intergenic
1057100136 9:92351540-92351562 AAAAAGTAGAATGGTGGATGAGG - Intronic
1057101431 9:92364326-92364348 TAAAAGCAGAATATTAGGCCAGG - Intronic
1057349534 9:94283771-94283793 AAAAAGTATAATATGAGGCCGGG + Intronic
1057538897 9:95945900-95945922 AAGAAGGAGAAAAGTGGGGCTGG + Intronic
1057753817 9:97813841-97813863 AAAAAATACAAAAGTTGGCCAGG + Intergenic
1058008074 9:99940774-99940796 AAAAAGTAAAATTCTAGGCCGGG - Intronic
1058157278 9:101529651-101529673 ATGATGTAGTATAGTGGGCCAGG + Intronic
1058292824 9:103263753-103263775 AAAAGGTAGAAGAGTGGGAGAGG - Intergenic
1058437744 9:104978894-104978916 AAAAAATAAAATAGTTGGCCAGG + Intergenic
1058666895 9:107326932-107326954 AAGAAATAGAAAAGTTGGCCGGG - Intronic
1058863111 9:109136679-109136701 AAAAAGTACAAAAATGAGCCAGG - Exonic
1058877572 9:109257832-109257854 AAAAAATAGAAAAATGAGCCAGG + Intronic
1059721193 9:116961394-116961416 AGAAAGTAGAATAGTGGTTGCGG - Intronic
1059977680 9:119735755-119735777 AAAATAAAAAATAGTGGGCCGGG + Intergenic
1060021379 9:120134206-120134228 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
1060095134 9:120782171-120782193 AGAAAGTAGAATGGTGGGCCAGG + Intronic
1060506954 9:124204989-124205011 AAAAAATAGAAAAGTTAGCCAGG - Intergenic
1060540301 9:124424793-124424815 AAAAAATAGAAAAATTGGCCAGG + Intergenic
1060874204 9:127068502-127068524 ATCATGTAGAACAGTGGGCCAGG + Intronic
1060923631 9:127440155-127440177 AAAAAGTAGATTAGTGGGCCGGG - Intronic
1061001833 9:127907054-127907076 AAAAAAAAAAAAAGTGGGCCAGG - Intergenic
1061029390 9:128070654-128070676 AAAAGGTAGAATGGCTGGCCGGG + Intronic
1061184479 9:129044284-129044306 AAAGAGTAGAAGAAGGGGCCAGG - Intronic
1061630380 9:131868569-131868591 GTAAATCAGAATAGTGGGCCGGG - Intronic
1061827058 9:133265049-133265071 AAAAATAAAAATAGAGGGCCAGG - Intronic
1061827080 9:133265214-133265236 AAAAAGTAGAATAATTAGCCGGG - Intronic
1202783861 9_KI270718v1_random:27737-27759 AAAAAGTCTAATTGTAGGCCAGG - Intergenic
1203428059 Un_GL000195v1:59507-59529 AGAAACTAGACTTGTGGGCCTGG + Intergenic
1185532001 X:829646-829668 AAAAAATATAAAAGTTGGCCGGG - Intergenic
1185590092 X:1270532-1270554 AAAAATGATAATATTGGGCCAGG - Intronic
1185595975 X:1307294-1307316 GTAAAGGAGAAGAGTGGGCCTGG - Intronic
1186129627 X:6452480-6452502 CAAAAATATAATAGTTGGCCAGG + Intergenic
1186291082 X:8099851-8099873 AAAAAGAAGAATAATTGGGCTGG + Intergenic
1186348572 X:8719674-8719696 AAAAAGTCACATAATGGGCCAGG - Intronic
1186420257 X:9419977-9419999 AAAAAGAAAACTGGTGGGCCAGG + Intergenic
1186436182 X:9544919-9544941 AAATAGTAGCAAAGTGGGACTGG + Intronic
1186647070 X:11518437-11518459 AAAAAAAAGAAAATTGGGCCAGG - Intronic
1186806554 X:13145913-13145935 AAAGAATGGCATAGTGGGCCAGG + Intergenic
1187504825 X:19870639-19870661 AAAATGTATAGTAGTGGGCTGGG - Intronic
1187523704 X:20035593-20035615 AAAATATAAAATAGTTGGCCAGG + Intronic
1187541504 X:20200841-20200863 AAAAAATAGAATAATTAGCCAGG - Intronic
1187567190 X:20462757-20462779 AAAAACTAAAATATTGGGCAAGG - Intergenic
1188449538 X:30294839-30294861 AAAAAGTTGTTTTGTGGGCCAGG + Intergenic
1189449728 X:41117852-41117874 AAAAAGAAGAAAAAAGGGCCGGG - Intronic
1189583370 X:42430885-42430907 AAAAAGTAGAATATTGTGGGAGG - Intergenic
1189620938 X:42836768-42836790 AAAAAATATAAGAGGGGGCCGGG + Intergenic
1190175638 X:48146817-48146839 AAAAAGTAGAAAAATCTGCCGGG - Intergenic
1190513325 X:51195878-51195900 AAAAAGTGGTTTAGTGGGCTGGG - Intergenic
1190573524 X:51809411-51809433 AAAAAGGAGACTAAGGGGCCGGG - Intronic
1190580280 X:51886757-51886779 TAAAAATAGAATACTGGGCTGGG + Intronic
1190846090 X:54192006-54192028 AAAAAAAAAAAAAGTGGGCCAGG + Intergenic
1190949291 X:55127134-55127156 AAAAAGGAGAAGAGTGAGGCTGG + Intronic
1190952106 X:55156245-55156267 AGAAAGTAAAATACTGGGCCAGG - Intronic
1191864590 X:65693756-65693778 AAAATGGAGGATAGTGGGCCGGG + Intronic
1192271656 X:69585992-69586014 AAAAATTATAAAAGCGGGCCGGG + Intergenic
1192301184 X:69904643-69904665 AAAGAGTAGAAGAGGGGGCCAGG - Intronic
1192355022 X:70394362-70394384 AAAAAGTAGAAAAATTAGCCAGG - Intronic
1192675724 X:73193924-73193946 AAAAATTAGAATATTAGGCAGGG + Intergenic
1193153409 X:78147982-78148004 AAAAAGTGGTTTTGTGGGCCAGG + Intergenic
1193185245 X:78503793-78503815 AAAAATTAGAATAGTATACCTGG + Intergenic
1193438954 X:81515424-81515446 AAAAAGTAGTTTTGTGGGCCAGG + Intergenic
1193486349 X:82089061-82089083 TAAAAGTAGAATAGGAGGACAGG + Intergenic
1193519630 X:82512572-82512594 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
1193629256 X:83862234-83862256 AGAAAGAAAAAGAGTGGGCCGGG + Intronic
1193942175 X:87689403-87689425 AAAAAGTACAATAATTAGCCGGG + Intergenic
1194053849 X:89105403-89105425 AAAAAATAGTTTTGTGGGCCAGG - Intergenic
1194178092 X:90677223-90677245 AAAAATGAGAAAAATGGGCCGGG + Intergenic
1194212738 X:91088583-91088605 AAAAAGTAAAAAAATAGGCCAGG - Intergenic
1194220083 X:91179065-91179087 AAAAATAAGAATAAGGGGCCGGG + Intergenic
1194297351 X:92143376-92143398 AAAAAGTGGTTTTGTGGGCCTGG + Intronic
1194572761 X:95573904-95573926 AAAAAATAGTTTCGTGGGCCAGG + Intergenic
1194626029 X:96227611-96227633 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
1195058176 X:101167047-101167069 AAAAAGGAAAAAAATGGGCCGGG - Intergenic
1195165984 X:102220988-102221010 AAAAAATATAATAGTAGGCCGGG - Intronic
1195192875 X:102466100-102466122 AAAAAATATAATAGTAGGCCGGG + Intronic
1195242072 X:102961707-102961729 AAGGAGAAGAAAAGTGGGCCAGG - Intergenic
1195390324 X:104355115-104355137 ATAAAGTAGAAAGGTAGGCCGGG - Intergenic
1195471253 X:105232991-105233013 AAAAAGCTGAATAGTTGGCCAGG + Intronic
1195931695 X:110084206-110084228 AAAATCAAGAATAGTTGGCCAGG + Intronic
1195943658 X:110187056-110187078 AAAAAGTGAAACAGTCGGCCAGG + Intergenic
1195953644 X:110305984-110306006 AAAAAGTAAAAAATTGGGCGAGG + Intronic
1196327527 X:114425284-114425306 AAAAAAAAAAATTGTGGGCCGGG + Intergenic
1196777981 X:119358214-119358236 AAAAGGAAGAATAATGGGGCAGG + Intergenic
1196808707 X:119611538-119611560 GAAAAGTGCAATAGTGGGCCAGG + Intergenic
1197023505 X:121718309-121718331 AAAAAATAGATTCCTGGGCCAGG - Intergenic
1197160608 X:123318174-123318196 AAAAAGTGGTTTTGTGGGCCAGG - Intronic
1197431916 X:126376992-126377014 AAAAAGTAGTTTTGTGGGCCAGG - Intergenic
1197856621 X:130919793-130919815 AAAAAGTGGTTTTGTGGGCCAGG - Intergenic
1197910945 X:131482238-131482260 AAAAAGTGGTTTTGTGGGCCAGG + Intergenic
1198082610 X:133253328-133253350 AAAAAGTAGCATTCTGGGCCGGG + Intergenic
1198347181 X:135769909-135769931 TGAAAGTAGAAAAATGGGCCGGG - Intergenic
1198349087 X:135787171-135787193 TGAAAGTAGAAAAATGGGCCGGG - Intergenic
1198350993 X:135804443-135804465 TGAAAGTAGAAAAATGGGCCGGG - Intergenic
1198352899 X:135821708-135821730 TGAAAGTAGAAAAATGGGCCGGG - Intergenic
1198354808 X:135838964-135838986 TGAAAGTAGAAAAATGGGCCGGG - Intergenic
1198356719 X:135856246-135856268 TGAAAGTAGAAAAATGGGCCGGG - Intergenic
1198358632 X:135873526-135873548 TGAAAGTAGAAAAATGGGCCGGG - Intergenic
1198629298 X:138616977-138616999 AAAAAATGGTTTAGTGGGCCAGG - Intergenic
1198732956 X:139753511-139753533 AAAAAGTTAAAAAGAGGGCCGGG + Intronic
1199165603 X:144671404-144671426 AACAATTAGAGCAGTGGGCCAGG - Intergenic
1199410737 X:147519502-147519524 AAAAAGTATAACATTGGGTCTGG - Intergenic
1200306495 X:155030981-155031003 AAAAAGTAGAAAATAGGGGCTGG - Intronic
1200524758 Y:4259380-4259402 AAAAATGAGAAAAATGGGCCGGG + Intergenic
1200556593 Y:4642825-4642847 AAAAATAAGAATAAGGGGCCGGG + Intergenic
1200781409 Y:7219754-7219776 AAAAAGTAGAAATGGGGGCTGGG + Intergenic
1200805300 Y:7427717-7427739 AAAAAATACAAAAGTGAGCCAGG + Intergenic
1200950358 Y:8892773-8892795 GAAAAGAAGATTAATGGGCCGGG - Intergenic
1201069230 Y:10129245-10129267 AAGAAGAAGAAAAATGGGCCAGG + Intergenic
1201321818 Y:12707410-12707432 AAAAAGTAAATTGCTGGGCCAGG - Intronic
1201548070 Y:15188645-15188667 AAAAAAAAGAATACTGGGCCGGG + Intergenic
1201562314 Y:15331276-15331298 TAAAAGAGGAATAGTGGACCAGG + Intergenic
1201759339 Y:17520153-17520175 AAGAAGTACAAAATTGGGCCAGG - Intergenic
1201842215 Y:18385837-18385859 AAGAAGTACAAAATTGGGCCAGG + Intergenic
1202364182 Y:24144620-24144642 AAAAAATACAAAAGTTGGCCGGG - Intergenic
1202506598 Y:25525502-25525524 AAAAAATACAAAAGTTGGCCGGG + Intergenic
1202599094 Y:26574285-26574307 AGAAATTAGAAAAATGGGCCAGG - Intergenic