ID: 1129556347

View in Genome Browser
Species Human (GRCh38)
Location 15:76514048-76514070
Sequence CAGTGTGTGCATCCTGTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129556347_1129556349 30 Left 1129556347 15:76514048-76514070 CCAAGCACAGGATGCACACACTG 0: 1
1: 0
2: 0
3: 14
4: 201
Right 1129556349 15:76514101-76514123 GAAAATATCTCATTCTAGAAAGG 0: 1
1: 0
2: 3
3: 25
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129556347 Original CRISPR CAGTGTGTGCATCCTGTGCT TGG (reversed) Intronic
900079130 1:842543-842565 CAGTGTCTTCAGCCTCTGCTAGG - Intergenic
900359221 1:2279871-2279893 CAGTGTGGGCATCCAGTGAGGGG + Intronic
901060073 1:6467881-6467903 CAGGGTCAGCTTCCTGTGCTGGG + Exonic
901661834 1:10803382-10803404 CAAAGTGTGGATCCTGAGCTCGG - Intergenic
901710703 1:11112676-11112698 CAGTGGGTGCATCCCGTGGGAGG - Intronic
901759356 1:11460575-11460597 AAGTATGTGCATCCCATGCTGGG - Intergenic
904032946 1:27544462-27544484 CTGTGTGTCCATCCAGTGCTGGG - Intronic
904384052 1:30130126-30130148 CAGTGTGTCCAGCCTGAGCTGGG + Intergenic
904941633 1:34167602-34167624 CACTGAGCGCCTCCTGTGCTCGG + Intronic
905521176 1:38601645-38601667 CAGTGTGTGCTTGCTGTTGTAGG - Intergenic
905633303 1:39531065-39531087 CATGGTGCGCAGCCTGTGCTAGG - Intergenic
905851264 1:41276855-41276877 CAGAGGGAGCACCCTGTGCTTGG + Intergenic
905905902 1:41618385-41618407 CAGTGTTTGCAAAATGTGCTCGG + Intronic
908903772 1:68985213-68985235 CAGTGGTTGCATCCTATGGTGGG + Intergenic
909559407 1:76992860-76992882 AAGTGTGTGCATACTGTTTTGGG - Intronic
912822883 1:112881877-112881899 CAGTCTGTGCGTGCTGTGTTGGG + Intergenic
920291055 1:204923427-204923449 CAGTGTCTGCTTCCCGTGATGGG - Intronic
920558054 1:206918840-206918862 CAGTTTGTGCCTCATGCGCTAGG + Intronic
922531163 1:226346406-226346428 CAGTGTGTGACTCCTTTGCATGG - Intergenic
923375457 1:233357693-233357715 CTGTGTGTTCTTCCTGTTCTTGG - Intronic
923645086 1:235811783-235811805 CATTGTCTGCATCTTTTGCTTGG - Intronic
923885659 1:238152375-238152397 CAGTGTGAGGATACTGTGGTGGG + Intergenic
1062927682 10:1329109-1329131 CAGTGTGGGCAGCCTGTGGCAGG + Intronic
1062941203 10:1422744-1422766 CAGTGTATACAGCCTATGCTTGG - Intronic
1063370950 10:5522987-5523009 CTGTGTGTGCAGCCTTTGCTGGG + Intergenic
1065970115 10:30799365-30799387 CAGGGTGTGCAGGCCGTGCTGGG + Intergenic
1067156581 10:43786073-43786095 CAGAGTGAGGCTCCTGTGCTGGG - Intergenic
1069094330 10:64240132-64240154 CAGTGTTTGCCTCTTGAGCTGGG + Intergenic
1072172255 10:92876636-92876658 CTGTATGTCCAACCTGTGCTAGG + Intronic
1072524272 10:96257743-96257765 CAGTGTGTGCACACTGGGCATGG + Intronic
1074687862 10:115976473-115976495 CAGTGTGTGCATCTTGCCCTTGG + Intergenic
1075201824 10:120410962-120410984 CTGTGTATGGATGCTGTGCTGGG + Intergenic
1076184536 10:128435962-128435984 CAGTGTGGGGAGCCTGGGCTCGG + Intergenic
1076238410 10:128883593-128883615 CAGTGTGTGCCACCCGTGCTGGG - Intergenic
1076510419 10:131010050-131010072 CAGAGCGTGCTTCCTGTGCTGGG - Intergenic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1077472637 11:2771182-2771204 CAGGGTCTGCATGCTCTGCTGGG - Intronic
1080755893 11:35198560-35198582 CATTGTGTACTTACTGTGCTAGG + Intronic
1083693396 11:64425658-64425680 CTGTGTGCGAAGCCTGTGCTTGG - Intergenic
1084268779 11:68018367-68018389 CAGTGCGTGCTTCCTGTGTGAGG - Intronic
1084275232 11:68047896-68047918 CAGGGTAAGCATCGTGTGCTGGG - Exonic
1086093593 11:83028476-83028498 CACAGTGTGCTTCGTGTGCTGGG - Intronic
1089066082 11:115662929-115662951 CAGTGTATGCAACCTAAGCTGGG - Intergenic
1089807965 11:121108482-121108504 CAGTGTGTGCATACTGGAGTGGG - Intronic
1089826328 11:121281434-121281456 TAGTGTGTGCTTCCAGAGCTCGG + Intergenic
1090248304 11:125233510-125233532 CAGAGTGCCCAGCCTGTGCTGGG - Intronic
1091060238 11:132454319-132454341 CAGTGTTTGCATCCATTCCTGGG + Intronic
1091357572 11:134949440-134949462 CACTGTCTGCATCCTCAGCTTGG + Intergenic
1092398880 12:8154226-8154248 CAGTGGGTGCAGCCTGTGGAGGG - Intronic
1093502925 12:19832841-19832863 CAGAATGTGCATACTGTGCTAGG - Intergenic
1096529090 12:52232329-52232351 CTGTGCGTGCATCCTGGGCGAGG - Intergenic
1098824069 12:75271027-75271049 CAATTTGTGCATACTGTTCTTGG + Intergenic
1099452630 12:82825827-82825849 CAGTGTGTTCACTCTGTGATAGG + Intronic
1103933451 12:124462821-124462843 CAGTGTGTGCACAGTGTGATCGG - Intronic
1105005982 12:132720858-132720880 AAGTGTGTGCGGCCTGTGCAGGG - Exonic
1105015543 12:132784470-132784492 CATCGTGTGCATGCTGTGGTCGG - Intronic
1105678876 13:22705475-22705497 CGGTGTGTGCAGCGTGCGCTTGG + Intergenic
1106600971 13:31186667-31186689 AAATGTGTGCACCCTGGGCTGGG + Intergenic
1109191235 13:59326957-59326979 CGGAGTGTGCTTCTTGTGCTTGG - Intergenic
1109290477 13:60468579-60468601 CAATGTGTAGATACTGTGCTGGG + Intronic
1110909895 13:80945420-80945442 CAGTGAGGGCATTCAGTGCTGGG + Intergenic
1116743921 14:48793095-48793117 CAGAGTTTGAATGCTGTGCTGGG - Intergenic
1120572526 14:86139180-86139202 CAGTGGGTGCTTTCTGTGCCTGG - Intergenic
1121915129 14:97831738-97831760 CCGTATGTGCACCATGTGCTCGG + Intergenic
1122070937 14:99204976-99204998 CAGTCTGTGCCCCCTGTCCTTGG + Intronic
1124555471 15:30720957-30720979 CAGTGTTTGTATCCTGGTCTTGG - Intronic
1124675788 15:31684738-31684760 CAGTGTTTGTATCCTGGTCTTGG + Intronic
1126850187 15:52791723-52791745 AAGTGTGTGTAGCCTGTGCTGGG + Intergenic
1128338257 15:66802386-66802408 CTGTGTGTGCCGCCCGTGCTCGG - Intergenic
1128580828 15:68808456-68808478 CAGTCCTTGCATCCTGGGCTGGG - Intronic
1129556347 15:76514048-76514070 CAGTGTGTGCATCCTGTGCTTGG - Intronic
1130779038 15:87015545-87015567 CACTGAGTGCCTTCTGTGCTAGG + Intronic
1131533408 15:93213855-93213877 CATTGAGTACATTCTGTGCTTGG + Intergenic
1131898168 15:97056724-97056746 TAGTGAATGCATGCTGTGCTAGG + Intergenic
1132315051 15:100883570-100883592 CAGAGTCTGCCTCCTGTGCTTGG + Intronic
1133319454 16:4903906-4903928 CTGTGGGTGCTTCATGTGCTTGG + Exonic
1134452704 16:14373335-14373357 CAGTGTGTGCGTCCTAGGCCTGG - Intergenic
1136513493 16:30753717-30753739 CAGAGTGGGCATCCTGACCTGGG + Intronic
1138386238 16:56637586-56637608 GAGTGTGTTCATCCTCTGGTAGG + Intergenic
1140016448 16:71191620-71191642 CAGTGTCTGCAGCCTCTGCTGGG + Intronic
1140650438 16:77082477-77082499 CAGTGTGTGGTGCCTGTTCTGGG - Intergenic
1141138947 16:81484700-81484722 CATTGTGCGCATCCAGTACTCGG + Intronic
1143132082 17:4685241-4685263 CCGTGTGTGCCTCCTGAGGTGGG - Intronic
1143365485 17:6405761-6405783 CAGTGTTTGCATTCTGTCTTTGG + Intronic
1143808416 17:9449838-9449860 AGGTGTGTGCCACCTGTGCTTGG - Intronic
1144731555 17:17529075-17529097 CAGTGACTGGGTCCTGTGCTGGG - Intronic
1146199493 17:30843982-30844004 CAGTGTTTGAATGATGTGCTAGG + Exonic
1146301246 17:31691497-31691519 CAGAGTGTGAGCCCTGTGCTTGG - Intergenic
1147438623 17:40433188-40433210 CAGTTTGTGCATCCCAAGCTGGG + Intergenic
1150272922 17:63878216-63878238 CTGTGTGTCCACCATGTGCTTGG + Intronic
1150301183 17:64048658-64048680 CAGTAGGTGCAGTCTGTGCTGGG - Intronic
1151732929 17:75921695-75921717 CAGGGTGGGCAGCCTCTGCTGGG + Intronic
1152656100 17:81519816-81519838 CTGTGGGTGCCTCCTGTCCTCGG - Intronic
1153502858 18:5766966-5766988 AAGTGTGTGTCTTCTGTGCTGGG - Intergenic
1154152861 18:11920484-11920506 CAGCGTGTACATCCTATGCGGGG + Intergenic
1154497336 18:14971714-14971736 CACTGTCTGCATCCTCAGCTTGG - Intergenic
1160283880 18:77520979-77521001 CTGTGTGTGAAGCCTGTGGTAGG - Intergenic
1160367243 18:78336771-78336793 AATTGTGTGCAGCCTATGCTTGG + Intergenic
1160687680 19:444268-444290 CAGTGGGAGAATCCAGTGCTAGG - Intronic
1161176554 19:2846061-2846083 CACTGTGGGCCTCCTGTCCTAGG + Intronic
1163322375 19:16582314-16582336 CAGTGTCTGCCTCCTGGGCCTGG - Intronic
1163712834 19:18857112-18857134 CAGTGTGCGCACACTCTGCTGGG - Intronic
1164485445 19:28651896-28651918 CAGTGCGTGCTTCCTGGCCTGGG + Intergenic
1164577440 19:29413832-29413854 CAGGGTTTCCAGCCTGTGCTGGG - Intergenic
1166980510 19:46629432-46629454 CAGTGTGGGGATCCTGAGCAGGG + Intergenic
926581007 2:14632986-14633008 GATTGTTTGGATCCTGTGCTGGG + Intronic
929814245 2:45218985-45219007 CTGTGCTTGCCTCCTGTGCTGGG - Intergenic
930067655 2:47340109-47340131 CCGTGTGTGAGCCCTGTGCTAGG + Intergenic
930091066 2:47531742-47531764 CAGTGGGTGCAGCCAGTTCTAGG + Intronic
934739156 2:96706696-96706718 CTCTGTGTGCAACCTGAGCTGGG - Exonic
935055501 2:99563054-99563076 CAAAGTGTACATCCTGGGCTAGG + Intronic
935729632 2:106054885-106054907 CAGTGTGGCCACCCTGTTCTTGG + Intergenic
939421496 2:141976676-141976698 CAGAGTATGCATCCTGTGTCTGG + Intronic
939511785 2:143115680-143115702 CAGAGTGAGCATCCTTTTCTTGG - Intronic
944474435 2:200089251-200089273 CATTATGTGCATCCTCTCCTGGG + Intergenic
944723472 2:202446878-202446900 CAGTGAGTGGATCCTGAGGTCGG - Intronic
945191522 2:207192959-207192981 CACTGTGTTGATCCTGGGCTTGG + Intergenic
946221273 2:218229471-218229493 CAGTTTGTGCACGCTGTGGTTGG + Intronic
947085964 2:226453753-226453775 CAGTGGGTGCAGCCTGTGGAGGG + Intergenic
948656817 2:239481367-239481389 CAGTGTTTGCATTTTGTGCCTGG + Intergenic
1169314121 20:4574017-4574039 CAGTGTGTGCGTCATCTGTTTGG - Intergenic
1171194975 20:23189791-23189813 CAGCGTGGGCATACTCTGCTAGG - Intergenic
1172873858 20:38152535-38152557 CAGTCTTGGCATCCTGAGCTGGG - Intronic
1175228771 20:57460633-57460655 CAGTCTGGGCACCCTGTGATGGG + Intergenic
1175516909 20:59575883-59575905 CAGAGTGTGCACCCAGTGCAGGG + Intergenic
1176042767 20:63073880-63073902 CTGTGTGTCCAGCCTGTGCAGGG - Intergenic
1176173472 20:63707080-63707102 CAGCGTGTACATCCTGCCCTGGG + Exonic
1176908357 21:14532289-14532311 CAGTGGGTGCTTCCTGGGATGGG - Intronic
1178469056 21:32875353-32875375 CAGCATGGGGATCCTGTGCTGGG + Intergenic
1179618593 21:42597959-42597981 CACTGTGTGCAACCTCAGCTGGG + Intergenic
1181698993 22:24609407-24609429 TAGTGTCTGCATCCAGGGCTGGG + Intronic
1181728869 22:24830471-24830493 CAGTGTGTGAATACTGTCATGGG + Intronic
1182108058 22:27703460-27703482 CAGTCAATGCATCCTGTGCCCGG + Intergenic
1182128832 22:27835889-27835911 CAGAGTAAGCATTCTGTGCTTGG + Intergenic
1182697602 22:32207114-32207136 CACTCTCTGCATCCTGTTCTAGG + Intergenic
1182715269 22:32353014-32353036 CACTCTCTGCATCCTGTTCTAGG - Intergenic
1182978618 22:34646948-34646970 CTGTGTGTGAATGCTGTGCCAGG - Intergenic
950841604 3:15973530-15973552 CACAGTGTGCATACTGTGCCCGG - Intergenic
952250842 3:31652046-31652068 CAGTGAATCCATCCAGTGCTGGG - Intergenic
952502196 3:33974167-33974189 CACTGTGCCCATCCTGTGTTTGG - Intergenic
954757840 3:52851476-52851498 CAGAGGGCGCAGCCTGTGCTAGG + Intronic
955212584 3:56955667-56955689 CAGGATGTGCATGCTGTTCTAGG - Intronic
959863250 3:111239151-111239173 CATTGTGTGTGTCCTGTTCTTGG + Intronic
962284302 3:134073766-134073788 CAGTGTGTGAAGCCCCTGCTAGG + Intronic
963276305 3:143333657-143333679 CACTTTGTGCATTCTGTTCTTGG - Intronic
963531280 3:146476163-146476185 CAGTGTGTGAATCCTGCACTGGG + Intronic
963896052 3:150686117-150686139 CAGTGTGTGCGTGCTGGGCAAGG - Intronic
965641664 3:170835425-170835447 AGATGTGTGCATCTTGTGCTGGG + Intronic
966493782 3:180556918-180556940 CAGAGTTTGAATGCTGTGCTGGG - Intergenic
969155714 4:5208091-5208113 CAGTGTGTCCAGCCTGGACTGGG + Intronic
969272295 4:6111098-6111120 CTGTGTGGCCATCCTGAGCTGGG + Intronic
971675442 4:29621244-29621266 AAGTGGGTGCCTCCTGAGCTAGG + Intergenic
971982328 4:33768561-33768583 CAGTTTGTGCATGCTGTGTGTGG + Intergenic
975503837 4:75116935-75116957 CTGTCTGTGCAGCCTGGGCTTGG - Intergenic
980610645 4:135156837-135156859 CAGTATTTGCTTTCTGTGCTTGG - Intergenic
984511364 4:180682916-180682938 CAGTGTGTGTGTGCTGTGTTGGG + Intergenic
990011371 5:51003146-51003168 CAGTGTGTCCTTCCTATGATTGG + Intergenic
991425045 5:66482180-66482202 CAGTGGGTGCAGCCTGTGGAGGG + Intergenic
994589359 5:101754542-101754564 CTGAGTGTGGATCCTGTGGTGGG + Intergenic
999938056 5:156509486-156509508 CAGAGTGTGTACCCTGTTCTAGG + Intronic
1000240475 5:159404069-159404091 CAGAGTGTGCAGCATGTCCTAGG + Intergenic
1000251061 5:159496166-159496188 CAGTGTGTGTAAGCTGTGATAGG + Intergenic
1001322918 5:170697714-170697736 CTGAGTGTGGATGCTGTGCTGGG - Intronic
1001811829 5:174634876-174634898 CATGGAGTGCAACCTGTGCTGGG + Intergenic
1003042566 6:2701512-2701534 CAGTGTGTGTTTCCTGTGTAGGG - Intronic
1003858494 6:10299974-10299996 CAGTGGGTGTATTCTGTGCTAGG + Intergenic
1007146557 6:39640149-39640171 GAGTGTGTTCCTCCTGTTCTAGG - Intronic
1011325009 6:86141017-86141039 CAGTGAGTGCATTGGGTGCTAGG + Intergenic
1012487548 6:99739018-99739040 CAGTGAGTGGATACTGTGCCTGG - Intergenic
1013419253 6:109951207-109951229 CTGTGTGCCCAGCCTGTGCTGGG + Intergenic
1015978571 6:138816175-138816197 CACTTTGTGCATCATGTTCTAGG + Intronic
1016855963 6:148671102-148671124 CATAGTGTGAATGCTGTGCTGGG + Intergenic
1018771733 6:166976753-166976775 CAGTGTTTGGAGCCTCTGCTGGG + Intergenic
1020391353 7:7661820-7661842 CAGAGTTTGAATGCTGTGCTGGG + Intronic
1024069293 7:45772315-45772337 AAGTGTGTGTGTGCTGTGCTTGG + Intergenic
1026941098 7:74288575-74288597 CAGTACATGCATCCTGTCCTGGG + Intergenic
1029538682 7:101170562-101170584 CCTTGGGTGCATCCTGTGCCTGG - Exonic
1031888215 7:127262669-127262691 CAGTGTCTGTATCATGTGCTTGG + Intergenic
1032953435 7:136942921-136942943 CAGAGTCTTCATTCTGTGCTAGG + Intronic
1033653018 7:143356234-143356256 CAGTGTGTGCACCCTGAGGACGG - Exonic
1034344970 7:150380324-150380346 CTGTGTGTGGAGCCTGTACTGGG + Intronic
1034746142 7:153525422-153525444 CACTGTTTGCATCCTGGGTTTGG + Intergenic
1035526501 8:317140-317162 CAGTGTCTTCAGCCTCTGCTAGG + Intergenic
1035651225 8:1266886-1266908 CTGAGTGTGCATCTTCTGCTGGG - Intergenic
1035794115 8:2337538-2337560 CAGAGTTTGAATGCTGTGCTGGG - Intergenic
1035798690 8:2384170-2384192 CAGAGTTTGAATGCTGTGCTGGG + Intergenic
1036066685 8:5388679-5388701 CCGTGAGTGTTTCCTGTGCTTGG - Intergenic
1036389310 8:8310749-8310771 CCTTGTCTGCTTCCTGTGCTGGG + Intergenic
1036738280 8:11339032-11339054 CATTGTGTGCCCCCTGTGCAAGG + Intergenic
1038484164 8:27921832-27921854 CAGGGTGGGCATCCTGGGCGAGG - Exonic
1038724621 8:30069579-30069601 AGGTTAGTGCATCCTGTGCTTGG - Intronic
1041726318 8:61021007-61021029 AAGTGTGTGCAGCATGGGCTAGG - Intergenic
1043172575 8:76983748-76983770 CAGTGTGTGAATTTTGTGATTGG - Exonic
1047518154 8:125573292-125573314 CTGATTGTGAATCCTGTGCTAGG - Intergenic
1048334831 8:133494745-133494767 CTGTGTGTAGGTCCTGTGCTTGG - Intronic
1048355985 8:133654519-133654541 CTGTGTATTCATCCTCTGCTTGG + Intergenic
1048968460 8:139630539-139630561 CTGTGTCTGCAGCCTGTGCCTGG - Intronic
1050334044 9:4573806-4573828 CAGTGTGGGCACCCTCAGCTTGG - Intronic
1059980953 9:119771376-119771398 AAGTGCTTGCATCCTGGGCTAGG - Intergenic
1060112019 9:120913336-120913358 CCGTGAGCGCATCCTGAGCTTGG - Exonic
1062365018 9:136204345-136204367 GAGTGTGTGCGGGCTGTGCTGGG + Intronic
1186018889 X:5231551-5231573 ATGTGTCTGCATCCTCTGCTCGG + Intergenic
1186646099 X:11508687-11508709 CACTGTATGCCTCCTGTGCTTGG + Intronic
1189831552 X:44979618-44979640 CAGTTTGTGCTTTTTGTGCTAGG + Intronic
1190221847 X:48516962-48516984 CAGTGAGGGCATCCTGGGTTGGG - Intronic
1191780150 X:64856048-64856070 CAGTGTCTGCGTAGTGTGCTGGG - Intergenic
1192095153 X:68202781-68202803 CACTGTGTCCAGCCTATGCTAGG + Intronic
1192992171 X:76471862-76471884 CAGAGCTTGAATCCTGTGCTGGG - Intergenic
1194137416 X:90163400-90163422 TGGTGTGTGCATTCAGTGCTAGG - Intergenic
1194361542 X:92957316-92957338 CAGTTTGGGTATCCTATGCTTGG + Intergenic
1197762210 X:130035951-130035973 CTGTGTGTGCAGCCTGTGTCAGG - Intronic
1197810046 X:130433199-130433221 CACTTGTTGCATCCTGTGCTTGG + Intergenic
1200483146 Y:3733341-3733363 TGGTGTGTGCATTCAGTGCTAGG - Intergenic
1200643428 Y:5751187-5751209 AAGTGTGTGCCTCATGAGCTGGG - Intergenic
1200669736 Y:6073191-6073213 CAGTTTGGGTATCCTATGCTTGG + Intergenic
1202018239 Y:20434746-20434768 GAGTGTGTGCATACTAGGCTGGG + Intergenic