ID: 1129556433

View in Genome Browser
Species Human (GRCh38)
Location 15:76515083-76515105
Sequence AATTATAAGCTACAGTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129556432_1129556433 -10 Left 1129556432 15:76515070-76515092 CCAAAAACAGTAAAATTATAAGC 0: 1
1: 0
2: 1
3: 41
4: 604
Right 1129556433 15:76515083-76515105 AATTATAAGCTACAGTTTGAAGG 0: 1
1: 0
2: 1
3: 18
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129556433 Original CRISPR AATTATAAGCTACAGTTTGA AGG Intronic
901515438 1:9742327-9742349 AATTATTAACTAACGTTTGAGGG + Intronic
901761482 1:11474640-11474662 GATTATAACCTCCAGGTTGAGGG - Intergenic
901894073 1:12293897-12293919 AAGTGAAAGCTAAAGTTTGAAGG - Intronic
904309375 1:29617920-29617942 ATTTATAAAGTACAGTTTGGCGG + Intergenic
907495544 1:54841834-54841856 AATTGTAATCCACAGTTGGAGGG - Exonic
908957222 1:69647620-69647642 AAATATAAGCTTCAAATTGAAGG - Intronic
908990140 1:70076777-70076799 AATTATAAAGAACAGTTAGAAGG + Intronic
909380224 1:74989330-74989352 AATTCTAAGTTCTAGTTTGATGG - Intergenic
911334962 1:96571852-96571874 CATTATAAAATACAGTTTCACGG + Intergenic
911376159 1:97054880-97054902 ATTTAAAAAGTACAGTTTGATGG + Intergenic
911731154 1:101293660-101293682 AATTTTATGCTTCAGTTGGAAGG + Intergenic
911924402 1:103810102-103810124 AATTCTAAGTTACACTTTTAAGG - Intergenic
913015970 1:114735565-114735587 TATTATTAGTTACAGTCTGAAGG - Intronic
913154312 1:116079860-116079882 AATTTTAAGATACAGATTCATGG + Intergenic
914509986 1:148323291-148323313 AATTGTAGGCTGGAGTTTGAGGG + Intergenic
916000345 1:160609012-160609034 AATTATAAGCTAGAGATGAAAGG + Exonic
917819738 1:178750210-178750232 AATTAAAATCTACACTTTGCAGG + Intronic
918031334 1:180815227-180815249 AATTAATTGCTACAATTTGAGGG + Intronic
918222599 1:182449467-182449489 AATTCTTGGCTAAAGTTTGAAGG + Intergenic
918297707 1:183172565-183172587 GATTATGAGGTACAGTTTCAAGG - Intergenic
918416381 1:184312224-184312246 ATTTATGAGGTACAGTTTGATGG + Intergenic
918769807 1:188542631-188542653 AAATATAAACTCCAGTTTAAAGG + Intergenic
919443523 1:197670727-197670749 TTTTAAAAGCTACAGTTTAAAGG - Intronic
919951409 1:202367753-202367775 AACTTAAATCTACAGTTTGATGG + Intronic
921199245 1:212789719-212789741 AATTATAAGATAAAGTTTACAGG - Intronic
921840580 1:219823786-219823808 AATTCTAAGCTACAGTACAATGG - Intronic
923974262 1:239242697-239242719 TATTATAAGCTACACACTGAAGG + Intergenic
924688018 1:246316079-246316101 AATCATAATTTAAAGTTTGAGGG + Intronic
1064608861 10:17075912-17075934 AATTTTAAGGTACAGTATGATGG + Intronic
1064918494 10:20489053-20489075 ATATCTAACCTACAGTTTGAGGG - Intergenic
1065390738 10:25177999-25178021 ATTTAAAGGCTACAGTTTGCTGG - Intronic
1068479505 10:57572210-57572232 AATAAAATGCTACACTTTGAGGG - Intergenic
1071416101 10:85443056-85443078 AATTTTATGCTACAGTTAAAAGG - Intergenic
1071556731 10:86609381-86609403 AATTATTATGTACAGTTTTAAGG - Intergenic
1071635225 10:87246411-87246433 AATTATTGACTACAGTTTTATGG - Intergenic
1071660021 10:87491583-87491605 AATTATTGACTACAGTTTTATGG + Intergenic
1071927451 10:90426595-90426617 AATTATAAATGAGAGTTTGATGG - Intergenic
1073335776 10:102707516-102707538 AATTCTAAGACTCAGTTTGAAGG - Intronic
1074123231 10:110508675-110508697 AGTTAAAAGCTAAACTTTGAAGG + Intronic
1074959409 10:118427475-118427497 ATTTATAAGTCACAGTCTGAGGG + Intergenic
1075224200 10:120611260-120611282 AAATCTAAGCTACTGTTTAAAGG + Intergenic
1075932191 10:126308673-126308695 ACTTCTAAGATATAGTTTGAGGG - Intronic
1078947743 11:16089723-16089745 ATTGAGAAGCTACAGTTGGATGG - Intronic
1081010579 11:37806444-37806466 AATTATGATCTTCAGTATGATGG - Intergenic
1081326126 11:41747247-41747269 AATTGGAAGTTACAGTTTAATGG + Intergenic
1083518574 11:63284492-63284514 AATTAAAAGTCACAGTTTTAAGG + Intronic
1085036605 11:73304355-73304377 AATGAAAAGATATAGTTTGAAGG + Intergenic
1085708117 11:78805031-78805053 AATTATAAGCTCCATTGTTAAGG + Intronic
1086214472 11:84362084-84362106 AATTAAAAGGTAGAGATTGATGG + Intronic
1086972398 11:93097727-93097749 AATTATAAAATACATTTTGGGGG - Intergenic
1087222347 11:95560099-95560121 ATTTATAAGCCAGAGTATGAGGG + Intergenic
1088088621 11:106011166-106011188 AATTTTAAGCTATATTTAGAGGG - Intronic
1089927138 11:122270496-122270518 AAGTGTAAACTACAGATTGAAGG - Intergenic
1090099561 11:123779686-123779708 AATTATAAGCATCAGTTCTATGG + Intergenic
1090825906 11:130385858-130385880 AATTATCAACTACATATTGAGGG - Intergenic
1090925850 11:131249879-131249901 AATTATGACCTCCAGTGTGATGG - Intergenic
1091416434 12:290489-290511 AGTTATCATCTACATTTTGATGG - Intronic
1092744269 12:11658954-11658976 AATAATAAGCAACTGTATGAAGG - Intronic
1093075338 12:14752504-14752526 AGTTATAAGGAACAGTTTGGAGG + Intergenic
1093143156 12:15534004-15534026 AATTATTGGCAACTGTTTGAGGG - Intronic
1093762099 12:22922091-22922113 AAATCTAATCTTCAGTTTGATGG - Intergenic
1094254734 12:28410472-28410494 AATTAAAAGCTACTGATTGTTGG - Intronic
1094631359 12:32178484-32178506 GGTTCTAAGCTACAGTTTCAGGG + Intronic
1096076571 12:48809574-48809596 AATAATAAGCAACAGGTTGTGGG + Intergenic
1096421573 12:51462971-51462993 AATTTTAAGCCAAATTTTGAAGG + Intronic
1098838847 12:75454620-75454642 AATTATAATCTACTTTTTAAAGG - Intergenic
1099354759 12:81620307-81620329 AATCATAATTTACAGTTTTAAGG + Intronic
1100261771 12:92939020-92939042 AATTATAATTGACAGTTTGGGGG - Intergenic
1101297690 12:103441368-103441390 AATGATCAGTTTCAGTTTGAAGG - Intronic
1101915174 12:108890278-108890300 GATTTTAAGCTTCACTTTGAGGG + Intronic
1102987189 12:117287878-117287900 AATTATAAGCAACCCTTTGCAGG + Intronic
1103003942 12:117406970-117406992 TATTATAAGCTGCTGTTTAATGG + Intronic
1105047465 12:133017124-133017146 AATTATAAGATGTAATTTGATGG + Exonic
1106937320 13:34737507-34737529 AACTATAAGCTACAACTTTATGG - Intergenic
1107172341 13:37357826-37357848 AAGGATAAGCTAGAGTTAGAAGG - Intergenic
1107733392 13:43370872-43370894 ATATAGAAGCTACAGTTTGTGGG - Intronic
1108939926 13:55940095-55940117 AATTACATGCTACAGTTATATGG - Intergenic
1110968223 13:81728220-81728242 AAATAACAGCTACATTTTGACGG + Intergenic
1111099582 13:83566208-83566230 AATTAAAAGCCAAAATTTGAGGG + Intergenic
1111719916 13:91929997-91930019 AGTTATAAGCTAGCCTTTGATGG + Intronic
1114848190 14:26349256-26349278 TATTATAAACAACTGTTTGAAGG - Intergenic
1115049244 14:29036226-29036248 GATGTTAAGCTACATTTTGAAGG - Intergenic
1115529220 14:34311365-34311387 AATTATAATGAACAGATTGAAGG + Intronic
1115684711 14:35784306-35784328 TATTATAAGCTACAATGTGATGG + Intronic
1115878381 14:37887433-37887455 AATTAAAAGATACAGATTGTTGG - Intronic
1116093557 14:40338576-40338598 AATGAGAAGCTACAGTTTTATGG + Intergenic
1118145303 14:63128359-63128381 AATTGTAATCCCCAGTTTGAAGG + Intergenic
1120110455 14:80548307-80548329 AATTTTCAGCTAAAGATTGAAGG + Intronic
1121295564 14:92819057-92819079 AATTATAACCTGCAATTTCAGGG + Intronic
1124292027 15:28461387-28461409 AGTTATAAGCTAGCCTTTGATGG + Intergenic
1124936250 15:34174523-34174545 AATTAAAAGCCAGAGATTGATGG + Intronic
1125035551 15:35120303-35120325 AATTATTAACTATATTTTGATGG - Intergenic
1125146679 15:36477779-36477801 ATTTATAAGTTACTTTTTGATGG + Intergenic
1127131319 15:55867338-55867360 AATTATAAGGTGCATTCTGAGGG + Intronic
1127243302 15:57142878-57142900 CATTCTAAGCTACAGTATGAAGG + Intronic
1127357476 15:58214404-58214426 CATTATAAGCAACAGCTAGATGG + Intronic
1127750927 15:62042393-62042415 AATTATTACCTACATTTTGGTGG - Intronic
1129099237 15:73243317-73243339 AATTTTAATCTGCAATTTGAAGG + Intronic
1129420333 15:75420040-75420062 ATTTAGAAGCTACAGATTTAAGG + Intronic
1129556433 15:76515083-76515105 AATTATAAGCTACAGTTTGAAGG + Intronic
1129962643 15:79701692-79701714 AATTATAAGACTCAGTTAGAAGG - Intergenic
1131730033 15:95269728-95269750 AATTCTGACCTTCAGTTTGAGGG - Intergenic
1131954836 15:97723154-97723176 ATTTATGTGCTACTGTTTGAAGG + Intergenic
1133919006 16:10135183-10135205 AATTATATGCTACAGTTGTGTGG - Intronic
1134238978 16:12490146-12490168 AATTTTAAGGTACAGTTTGATGG + Intronic
1134475478 16:14569884-14569906 ATTTAAAATGTACAGTTTGATGG - Intronic
1136279480 16:29199553-29199575 ACTTTTAAGGTACAGTTTGGTGG + Intergenic
1136293271 16:29288440-29288462 CATCATAAGCTACAGTTTGCAGG + Intergenic
1136706759 16:32196293-32196315 AGTTATAAGCTAGGCTTTGACGG - Intergenic
1136761152 16:32733125-32733147 AGTTATAAGCTAGGCTTTGACGG + Intergenic
1136806951 16:33137261-33137283 AGTTATAAGCTAGGCTTTGACGG - Intergenic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1141395653 16:83702219-83702241 AATTACAAAATACAGTGTGATGG - Intronic
1142099155 16:88262447-88262469 CATCATAAGCTACAGTTTGCAGG + Intergenic
1203063304 16_KI270728v1_random:993441-993463 AGTTATAAGCTAGGCTTTGACGG + Intergenic
1148224841 17:45892133-45892155 AAATTTGAGCTAGAGTTTGAAGG + Intergenic
1151515737 17:74594239-74594261 ACTTACAAGCTACACTTTAAGGG + Intergenic
1152051106 17:77978473-77978495 AATAAAAAGCAACTGTTTGAAGG + Intergenic
1153645320 18:7190838-7190860 AGTTACAAGTGACAGTTTGAAGG - Intergenic
1155846242 18:30710926-30710948 AGTTATAATTTACAGTATGAAGG + Intergenic
1156591052 18:38488794-38488816 AATTATAAGATAAAGATAGATGG - Intergenic
1156803791 18:41151476-41151498 ACATATAAGGTACAATTTGAGGG - Intergenic
1157638170 18:49183527-49183549 TTTTCTAAGCTACATTTTGAAGG - Intronic
1158038814 18:53068422-53068444 AATGATATGGTACAGTTTGTGGG - Intronic
1163994652 19:21032361-21032383 GATTATAATTTACTGTTTGAGGG + Intronic
1164951821 19:32343706-32343728 AATTAAATGCTCCAGTATGAAGG + Intergenic
925510412 2:4619214-4619236 AATTCTATCCTACAGTTTAAAGG - Intergenic
928189437 2:29148927-29148949 AATTATCACATAAAGTTTGAGGG - Intronic
929727103 2:44441295-44441317 AATTATTAGTTACAATTTAAAGG - Intronic
930400949 2:50886556-50886578 AATTATAAGCATGACTTTGAAGG + Intronic
931089272 2:58868171-58868193 AGTCATAAGCCACAGTTGGAGGG + Intergenic
933588112 2:84201650-84201672 AATCCTAAGCCACAGTGTGATGG - Intergenic
934127242 2:88907756-88907778 AACTATAAACTACAGTTTCCAGG - Intergenic
935004963 2:99065002-99065024 AGTGATAAGTTCCAGTTTGAGGG + Exonic
937565923 2:123289138-123289160 AAATTTAAGCTACAGAATGAGGG + Intergenic
939173155 2:138719353-138719375 AAGGAGAAGCTACAGGTTGAGGG + Intronic
940978152 2:159970031-159970053 ATTTATAAGTTAATGTTTGAAGG + Intronic
941492506 2:166159784-166159806 ATTTATATGCTACATTTTTAAGG - Intergenic
941492632 2:166161650-166161672 ATTTATATGCTACATTTTTAAGG + Intergenic
941528565 2:166635947-166635969 AATTCTATGCCACAGTTTAAGGG - Intergenic
941618393 2:167749600-167749622 AATTATTGACTACAGTTTGAGGG + Intergenic
941821006 2:169843239-169843261 AATTATTTCTTACAGTTTGAAGG + Intronic
945406205 2:209451794-209451816 AATTCTAAGCTCCATTTTGGGGG + Intronic
945601915 2:211878190-211878212 AATTATAAGATAAATTTCGATGG - Intronic
946992525 2:225351367-225351389 AATTATATGCAACAATTTAAAGG + Intergenic
1169621466 20:7511487-7511509 ATTTATAAGATATATTTTGAAGG - Intergenic
1169648729 20:7843199-7843221 AGTAATAAGCTACAATCTGAAGG + Intergenic
1169799052 20:9496505-9496527 ATGTTTAAGCTACAGTTAGAAGG - Intergenic
1170054448 20:12184931-12184953 AATTAAAAGATAGAGTTTGGTGG - Intergenic
1170417815 20:16163160-16163182 AAATATATGTCACAGTTTGAAGG - Intergenic
1173984081 20:47247580-47247602 TATTATTATCTACAGTATGATGG - Intronic
1176919011 21:14664083-14664105 AATTAGGAGCTACAATATGATGG + Intergenic
1177125927 21:17192839-17192861 AATTCCAAGCTTCAGGTTGAAGG + Intergenic
1178563677 21:33663364-33663386 AATTATAAGCTTTAGTTAGATGG + Intronic
1183004221 22:34887395-34887417 AATTACAAGCAAAAGTTTGTTGG + Intergenic
951193672 3:19800663-19800685 AAATATAAGCCCCAGTGTGATGG + Intergenic
951346282 3:21549989-21550011 AATTATAAATTCCATTTTGAGGG - Intronic
952780656 3:37093932-37093954 AACTCTGAGCTAAAGTTTGAAGG - Intronic
956909013 3:73797502-73797524 AATTATTAGCTATAGAGTGATGG + Intergenic
956931108 3:74043990-74044012 AATTAAAAGCTAAAGTTGAAAGG - Intergenic
957533483 3:81470887-81470909 AAATATAAGAGACATTTTGAAGG - Intergenic
958056956 3:88426019-88426041 ATATATCAGCTACAGTTTCATGG + Intergenic
958582805 3:96048258-96048280 AATTGTAAGTTACAGATTGAAGG - Intergenic
958597502 3:96246587-96246609 AATTAAAAGATACAGTTTTCTGG + Intergenic
958776261 3:98486880-98486902 AATTAGAAGATAAAGCTTGAAGG + Intergenic
959012659 3:101096591-101096613 AGTTACAATCTAAAGTTTGAAGG + Intergenic
959913096 3:111787212-111787234 AATTATAAGCTAGAGTCTCTTGG - Intronic
960388908 3:117052693-117052715 AAATAGAATCTACATTTTGATGG + Intronic
961473108 3:127130407-127130429 AATTATAATCTTCAATTAGAAGG + Intergenic
962928704 3:140018079-140018101 AATTATAAGGTACAACTTCAGGG + Intronic
964894977 3:161584702-161584724 AATTTCAATCTACAGTGTGATGG - Intergenic
965902950 3:173666417-173666439 AGTTAAAAGCTACACTATGAAGG + Intronic
966457282 3:180131899-180131921 AATTATAAGCAACTGTTTTGTGG + Intergenic
969513025 4:7630451-7630473 AATTATTATCTCCAATTTGAAGG + Intronic
970130937 4:12870600-12870622 AATGATAAGTTACAGTTTTATGG + Intergenic
971121956 4:23714496-23714518 AATTATAGTTTACAGTTTTAGGG + Intergenic
971211382 4:24621168-24621190 AATTCAAAGCAACTGTTTGAAGG - Intergenic
974661601 4:64897404-64897426 CATTATAATCTTCAGTGTGAAGG - Intergenic
975688294 4:76939747-76939769 AAATCTAAGCAAAAGTTTGATGG + Intergenic
975933184 4:79552132-79552154 AAATAAATGCCACAGTTTGAGGG + Intergenic
975939384 4:79623795-79623817 AATTTTAAGATACATTTTAATGG - Intergenic
976959941 4:90957972-90957994 AATAATGTGTTACAGTTTGAAGG + Intronic
977450936 4:97196939-97196961 AATTATAAGATACTATTTCATGG + Intronic
977490670 4:97706088-97706110 AATTCAAAGCTACAGTTATAAGG - Intronic
977573452 4:98653884-98653906 AATTAGAAGCCACCTTTTGATGG - Intronic
981110319 4:140927348-140927370 AATTGTAATCTCCAGTTTGGAGG + Intronic
982806077 4:159764938-159764960 ATGTATAAGCTACATTTTTATGG + Intergenic
983606850 4:169596713-169596735 GATGCTAAGCTACAGTTTAATGG + Intronic
986482278 5:8201880-8201902 AATTATAAGCTACATTTATGAGG - Intergenic
986962561 5:13233017-13233039 AATTACATGCTTCAGTTTTAAGG + Intergenic
987179406 5:15351257-15351279 AATTTTAAGCTACAGAGTGATGG - Intergenic
987625972 5:20400864-20400886 AATTATAAGTTTCAGTATAAGGG - Intronic
988007154 5:25430618-25430640 AATTATTATATACAGTTTAAGGG - Intergenic
990010557 5:50992536-50992558 AATTATCACATACATTTTGAGGG - Intergenic
990270337 5:54130804-54130826 AATTAAAAGCCATGGTTTGAAGG + Intronic
992229306 5:74648135-74648157 AATTATAATATCCAGTTTGCAGG + Intronic
992735539 5:79715581-79715603 AATAATAAGCTATAGTTGGCTGG - Intronic
993517798 5:88859260-88859282 ATTCATAAGCTGCAGTGTGACGG + Intronic
993965350 5:94353659-94353681 AATTATCAGCTTCATTTTGATGG - Intronic
994630783 5:102284786-102284808 CATTACAAGCTATAGTTTGCTGG - Intronic
994959361 5:106578960-106578982 AAGTATAAGCCACAGTGTGCAGG + Intergenic
997478601 5:134165089-134165111 AATTGGAAGTTACAGTTTAATGG + Intronic
998026727 5:138823341-138823363 AATTATAATCCACAGTAAGAAGG - Intronic
998237810 5:140414946-140414968 AATGACAAGCTACAGAATGAAGG - Intronic
998904275 5:146887817-146887839 AATTTAAAGGTACAGTTTGTAGG + Intronic
1000071153 5:157742359-157742381 AATTAGAAGCCACTGTTTGATGG + Intergenic
1000359777 5:160436261-160436283 GATTCCAAGCTGCAGTTTGAGGG + Intergenic
1002708885 5:181182137-181182159 AATTATAGGCCACAGTCAGAAGG - Intergenic
1004107016 6:12675259-12675281 AATTATAAACTAAAAATTGATGG + Intergenic
1008579427 6:52892849-52892871 AATTCTAATTTACAGCTTGATGG - Intronic
1009275897 6:61679235-61679257 AAATGTAAGCTAAATTTTGATGG - Intergenic
1009548653 6:65056960-65056982 AATTATAAGATACCTTTTTAAGG + Intronic
1009640200 6:66325522-66325544 TATTTTAAGATACAATTTGATGG - Intergenic
1009843242 6:69104016-69104038 AATTAAAAACTAAAGTTTAATGG - Intronic
1010257187 6:73771798-73771820 AATTATCACCTAAAGTTAGATGG + Intronic
1010297075 6:74210742-74210764 ATATTTAAGCTACATTTTGAAGG - Intergenic
1012041058 6:94204128-94204150 AATTATAAGCTATAAATTCAAGG + Intergenic
1012171246 6:96018583-96018605 CATTATAAGATACAGTTCAATGG - Intronic
1012796289 6:103766175-103766197 AAATAAATGCTACAGGTTGAAGG + Intergenic
1014461334 6:121699366-121699388 AATTATAAGCTACACTTACCTGG + Intergenic
1016478384 6:144453576-144453598 AATTATAAGCTCCTATTAGAAGG - Intronic
1017723351 6:157259484-157259506 AGTTATAAGCCAGAGTTTCATGG - Intergenic
1022324658 7:29320282-29320304 AATTAGAAGCCACAGTTTGGTGG - Intronic
1022432123 7:30334761-30334783 AACTTAAAGCTACAGTTTAATGG + Intronic
1024621479 7:51161356-51161378 TATTAAAAGCTACATTTTAAAGG - Intronic
1026525993 7:71153985-71154007 AATTAAACTCTACCGTTTGATGG - Intronic
1027913708 7:84286510-84286532 ATTTATTACCTATAGTTTGATGG + Intronic
1028325102 7:89513982-89514004 ACTTATAAGCTACAGTCAGGTGG - Intergenic
1030724684 7:112912920-112912942 ATTTAAGAGATACAGTTTGAGGG + Intronic
1031046641 7:116896612-116896634 AAGTATAAGATACAACTTGATGG + Intronic
1032543401 7:132722983-132723005 AATTTTGAGCTACAGTTGGCTGG + Intronic
1032759913 7:134930588-134930610 AATTAGAAGCTACTTATTGAGGG - Intronic
1038046651 8:23771359-23771381 AATTGTAAGCTAAAATCTGAGGG + Intergenic
1039938834 8:42071218-42071240 AATTATAATCTTCAGTATGTTGG + Intergenic
1041173505 8:55169685-55169707 AATAATAAAATACAGTTAGATGG - Intronic
1041726048 8:61018281-61018303 AATTATAAGCGACAGTAAGGAGG - Intergenic
1041900966 8:62982076-62982098 AAATCTAAACTACAGTTTTATGG + Intronic
1042224821 8:66507256-66507278 AATTAGAAGCTCCAGGTTTAGGG + Intronic
1043287818 8:78557181-78557203 AATTAGAAGCCACATTTTGAGGG + Intronic
1045659259 8:104419645-104419667 AATTATAAGCTTCGGGTTGTGGG - Intronic
1046510937 8:115201628-115201650 AATTATAAACTACATCTTTATGG + Intergenic
1046540705 8:115578456-115578478 AATTATAAAGGACATTTTGAAGG - Intronic
1047476435 8:125236095-125236117 AATTAAAGGCTAAAGTCTGAAGG + Intronic
1047682293 8:127266361-127266383 TTTTATTATCTACAGTTTGAAGG - Intergenic
1048014747 8:130487237-130487259 AAATAAAAGGTATAGTTTGATGG - Intergenic
1048100155 8:131342328-131342350 AATGATGAGATTCAGTTTGAGGG - Intergenic
1048650869 8:136475627-136475649 GATAATATGCTACACTTTGAGGG + Intergenic
1051196370 9:14566308-14566330 AATCATAAGTTACATTTTAAAGG - Intergenic
1051903619 9:22069555-22069577 AATTATGGGATACAATTTGATGG + Intergenic
1057779084 9:98035263-98035285 TATTGTAAACTACAGTTTGCAGG + Intergenic
1059526928 9:115000657-115000679 AATTATAAGATCCAGTTAGGGGG - Intergenic
1187892434 X:23948755-23948777 AATTCTAACCTCCAGTGTGATGG - Intergenic
1188911372 X:35851818-35851840 AAATATAAACTACAGATTTAAGG - Intergenic
1189256881 X:39646844-39646866 ATTTTTAAAATACAGTTTGAGGG - Intergenic
1192273640 X:69608536-69608558 AATTTTAAGCAGCAGTTTGAAGG - Intergenic
1193172674 X:78354850-78354872 AACTATAAAGAACAGTTTGAAGG - Intergenic
1193908261 X:87269313-87269335 AATTGGAAGCTACAGTTTAATGG - Intergenic
1194283304 X:91979458-91979480 AATTATATGCTCCATTTTCACGG - Intronic
1195158847 X:102151887-102151909 AATTGCAAGCTACAGTGTGTAGG + Intergenic
1196993153 X:121349996-121350018 AATTATAACCTTTAGATTGATGG + Intergenic
1197060865 X:122179436-122179458 AATAATACGCTACAGGATGAAGG - Intergenic
1199120586 X:144048481-144048503 AGTTATAAGCTAAACTATGAGGG + Intergenic
1200354759 X:155536654-155536676 AATTTTTAGCTATATTTTGAAGG - Intronic
1200600878 Y:5203992-5204014 AATTATATGCTCCATTTTCACGG - Intronic
1201472880 Y:14352965-14352987 AATTTTGGGCTACAGTTTGTTGG + Intergenic
1202119220 Y:21507415-21507437 AGTTGTAAGATACATTTTGATGG - Intergenic
1202121672 Y:21530955-21530977 AGTTGTAAGATACATTTTGATGG - Intronic
1202157333 Y:21898427-21898449 AGTTGTAAGATACATTTTGATGG + Intronic
1202159780 Y:21921968-21921990 AGTTGTAAGATACATTTTGATGG + Intergenic