ID: 1129556900

View in Genome Browser
Species Human (GRCh38)
Location 15:76519794-76519816
Sequence ATTTAGCTAGAGGAGTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129556900 Original CRISPR ATTTAGCTAGAGGAGTTTGG GGG (reversed) Intronic
901562850 1:10086512-10086534 TTTTAGCTACAAGAGTTAGGTGG + Intronic
901846961 1:11989390-11989412 ATTTAGCTAGTGGGATTTGCGGG + Intronic
903334334 1:22614741-22614763 ATTTAGCTGAAGGTATTTGGGGG + Intergenic
904855374 1:33493914-33493936 ACTAAGATAGAGGAGTTTGATGG + Intronic
907297658 1:53465613-53465635 TATGAGCTAGAGGAGTCTGGTGG + Intronic
910688460 1:89941601-89941623 AATTAGCTAGAGTAGTTTTAGGG + Intergenic
911399282 1:97354379-97354401 GTTTTACTATAGGAGTTTGGAGG - Intronic
913571928 1:120129335-120129357 GTTGAGCTAGATGATTTTGGAGG - Intergenic
914292847 1:146290958-146290980 GTTGAGCTAGATGATTTTGGAGG - Intergenic
914553891 1:148741741-148741763 GTTGAGCTAGATGATTTTGGAGG - Intergenic
923333056 1:232943574-232943596 ATTTATAGAGAGGAGTTTAGGGG + Intergenic
1065240753 10:23701556-23701578 GTTTAGCTGGAGGAGTTATGAGG + Intronic
1065839209 10:29686978-29687000 ATTTTGCGTAAGGAGTTTGGGGG - Intronic
1065905952 10:30252048-30252070 AATTAGCTATAGGACTTTGTAGG + Intergenic
1066550875 10:36555389-36555411 ATTTAGTGTTAGGAGTTTGGGGG + Intergenic
1067104119 10:43354098-43354120 ATTTAGATAAAGGAGTTCAGTGG + Intergenic
1072501956 10:96026433-96026455 ATTTAGCAAGCAGAGTTGGGAGG - Intronic
1074506622 10:114076596-114076618 ATTTAGCTAGAGCAAGTAGGTGG - Intergenic
1075524851 10:123175451-123175473 ATTTAATTAAAGGAGTCTGGTGG + Intergenic
1078128509 11:8592802-8592824 TTTGAGCTAGAGGAGGTTGGGGG + Intronic
1080637593 11:34137490-34137512 ATTTGACTACAGGAATTTGGAGG + Intronic
1081520898 11:43880472-43880494 ATAAAGGGAGAGGAGTTTGGGGG - Intergenic
1082221290 11:49640766-49640788 ATACAGCTTGATGAGTTTGGAGG + Intergenic
1085123075 11:73979872-73979894 ATTTAGCTAGGTGATTTTGGGGG + Intronic
1086977534 11:93152735-93152757 ATTCAGGTAAAGGAGTTTGAGGG - Intronic
1087652058 11:100879418-100879440 ATCTAGCTAGAGAAGATGGGTGG - Intronic
1089913134 11:122124009-122124031 ATTAAGCAAGAGGGGTTTGGTGG - Intergenic
1090430676 11:126643700-126643722 AGATAGGGAGAGGAGTTTGGAGG + Intronic
1092392979 12:8098161-8098183 AATTAGCTAGATGTGGTTGGTGG + Intergenic
1093247004 12:16751344-16751366 ATTTCTGTTGAGGAGTTTGGAGG - Intergenic
1093858855 12:24138576-24138598 ATTTGTGTAGAGGAGGTTGGTGG + Intergenic
1094966176 12:36171816-36171838 CTTTTGATGGAGGAGTTTGGAGG + Intergenic
1095009282 12:36868951-36868973 CTTTTGGTGGAGGAGTTTGGAGG + Intergenic
1097820320 12:64121891-64121913 ATTTAGTTATAGGATTTTGGAGG - Intronic
1098031699 12:66261388-66261410 ATTCACCTAGATGAGTTTTGTGG + Intergenic
1100303287 12:93327222-93327244 GTTTAGCTAGAGAAGTCTAGGGG - Intergenic
1101631755 12:106501902-106501924 AGTAAGCTAGAGGAGGTTAGGGG + Intronic
1105038101 12:132941115-132941137 ATTTAGCAAGCGCAGTTGGGTGG - Intronic
1114244842 14:20903383-20903405 ATTTGGCTAGAGGCAGTTGGGGG - Intergenic
1114334561 14:21674821-21674843 CTTTAGATAGATGAGCTTGGTGG + Intergenic
1114858025 14:26476330-26476352 ATTTATCTGGAAGATTTTGGGGG - Intronic
1115340589 14:32289641-32289663 TATTAGCTTAAGGAGTTTGGGGG + Intergenic
1116439555 14:44936728-44936750 ATTTAACTAGATGAGTATGACGG + Intronic
1117249265 14:53919104-53919126 TTTTAGTTAGAGTAATTTGGTGG - Intergenic
1117783194 14:59256000-59256022 CTCTAGCTAGAGGGGTTTAGTGG - Intronic
1118143021 14:63105931-63105953 TTTTAGCTAGGTGAATTTGGGGG - Intergenic
1119624761 14:76163237-76163259 ATTCACCTTGTGGAGTTTGGGGG + Intronic
1120855139 14:89205598-89205620 ATTTGGCTGGAGGTGGTTGGAGG + Intronic
1121236553 14:92395475-92395497 ATAAAACTAGAGGAGCTTGGGGG - Intronic
1128368391 15:67021337-67021359 ATTTAGGTAGTAGAGTTGGGAGG + Intergenic
1129556900 15:76519794-76519816 ATTTAGCTAGAGGAGTTTGGGGG - Intronic
1133596571 16:7299434-7299456 AGAAAGCTAGAGGAGTTTGAGGG + Intronic
1134217135 16:12324857-12324879 CATTACCTAGTGGAGTTTGGGGG - Intronic
1135177162 16:20240546-20240568 CTTTAGCTAGTGGAATTAGGTGG - Intergenic
1135265009 16:21017307-21017329 TTTTAGCTTGATGATTTTGGGGG - Intronic
1138570737 16:57870480-57870502 AATTAGCTAGCTGAGTGTGGTGG + Intergenic
1141072934 16:80974387-80974409 ATTTGGGTAGAGGAGTTAGTTGG - Exonic
1149391407 17:56195147-56195169 ATCTAGATGGAGGAGTTTGAAGG - Intronic
1152211189 17:79004119-79004141 AGTTAGGGAGAGGAGTTGGGGGG + Intronic
1158423967 18:57322535-57322557 ATGTTGCCAGAGGAGTCTGGCGG + Intergenic
1158454643 18:57595347-57595369 AGTTAGCTTTAGGGGTTTGGGGG - Intergenic
1161351626 19:3795641-3795663 TTTTAGCTGGAGGAGTTGTGCGG + Intronic
1161614502 19:5262549-5262571 ATTTAATTACAGAAGTTTGGGGG - Intronic
1163523268 19:17804919-17804941 ATCTAGGTGGAAGAGTTTGGTGG - Intronic
927199709 2:20570793-20570815 TCTGAGCTGGAGGAGTTTGGAGG + Intronic
927352107 2:22127891-22127913 CTTTGGCTAAACGAGTTTGGGGG - Intergenic
929400068 2:41569394-41569416 ATATTGCTAGAGGTGTTTGTTGG - Intergenic
932057035 2:68456241-68456263 ATTTAGTTACTGGAGTTTGCAGG - Intergenic
932231781 2:70089235-70089257 TTTTAGCCTGAGGTGTTTGGAGG + Intergenic
932978730 2:76636194-76636216 GTTTCAATAGAGGAGTTTGGTGG + Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
935159518 2:100517425-100517447 TTAAAGCTACAGGAGTTTGGTGG - Intergenic
936396741 2:112137498-112137520 ATTTTGCTATAGCAGTTTGAAGG + Intergenic
936833630 2:116680312-116680334 ATTGGGCTAGATGAGATTGGAGG + Intergenic
937513560 2:122627431-122627453 ATAGGGCTAGAGGAGTCTGGTGG + Intergenic
941735092 2:168965330-168965352 ATTAACCTAGAGGAGAATGGGGG - Intronic
942513379 2:176726289-176726311 ATTTTGCTAAAGGACTTTTGGGG - Intergenic
943716686 2:191160289-191160311 ATTTAGTTAGAACAGTGTGGTGG - Intergenic
947326888 2:228989121-228989143 CTTCAGCTCGAGGAGTTTTGAGG - Intronic
947795308 2:232890613-232890635 TTTTACCTTGAGCAGTTTGGGGG - Intronic
1169030022 20:2399774-2399796 ATTTAGATAGAGGAAGCTGGGGG - Intronic
1171749608 20:29036011-29036033 AATTAGGTTGAGAAGTTTGGGGG - Intergenic
1172685679 20:36752352-36752374 TTTTAGGTAGAAGAGTTTTGAGG - Exonic
1173003025 20:39119127-39119149 ATTTACCCAGAGGGGGTTGGAGG + Intergenic
1173081732 20:39875054-39875076 AGTTTGCTGGAGGAGTTTGGTGG - Intergenic
1175211972 20:57364516-57364538 TTTTTGCTAGAGGAGAATGGTGG + Intronic
1176315628 21:5239989-5240011 AATTAGGTTGAGAAGTTTGGGGG + Intergenic
1177062783 21:16395288-16395310 ATAGAGCTGGAGGAGTTGGGGGG + Intergenic
1177839771 21:26222753-26222775 CTTTAGCTTGATGATTTTGGGGG + Intergenic
1180393423 22:12305942-12305964 AATTAGGTTGAGAAGTTTGGGGG + Intergenic
1180406326 22:12558826-12558848 AATTAGGTTGAGAAGTTTGGGGG - Intergenic
1182248813 22:28983220-28983242 GATTTGATAGAGGAGTTTGGAGG + Intronic
1183688760 22:39376469-39376491 ATTTACCCAGAGTGGTTTGGGGG - Intronic
1183767987 22:39897125-39897147 AGTTAGATACACGAGTTTGGAGG - Intergenic
1183864296 22:40692128-40692150 ATTAAGCTAAAAGAATTTGGTGG + Intergenic
1185333658 22:50262248-50262270 ATGCAGCCTGAGGAGTTTGGGGG - Intergenic
967219620 3:187237635-187237657 ATTTGGCTACAGGAGGCTGGTGG - Intronic
969013578 4:4087634-4087656 ATTGAGCTTGGGGATTTTGGGGG - Intergenic
969461798 4:7332955-7332977 ATTTACCCAGCGGAGTTTTGAGG + Intronic
971530571 4:27683554-27683576 ATTCAGATAGAGGTGTCTGGTGG - Intergenic
971929930 4:33068531-33068553 ATTTAGCTAGTTGTATTTGGAGG - Intergenic
973533721 4:51859538-51859560 TCTTACCTAGAGTAGTTTGGGGG + Intronic
973563043 4:52155746-52155768 ACTTTGCTAAAGGAGTTTTGGGG - Intergenic
973674025 4:53245965-53245987 ATTTAGCTTGAGGAGCTTTGTGG - Intronic
974149233 4:57984407-57984429 AGGTAGATAGATGAGTTTGGAGG + Intergenic
974263392 4:59554178-59554200 ATTTGGGTATTGGAGTTTGGTGG + Intergenic
978782116 4:112567044-112567066 CTTTAGCCCTAGGAGTTTGGAGG - Intronic
979440753 4:120747510-120747532 ATTTATCTAGAGGGTTTGGGTGG - Intronic
979999148 4:127468051-127468073 ATTTAAAAAGAGGTGTTTGGAGG - Intergenic
982412657 4:155096718-155096740 ATTTAGCTAGAGATATTTGCAGG + Intergenic
982465797 4:155730085-155730107 ATTTCACTAGGGAAGTTTGGTGG - Exonic
983509656 4:168593943-168593965 GTTTAGCTAGATGAGTTTATTGG + Intronic
984231672 4:177108195-177108217 ATTTAGCTAGGTGAATTTAGGGG - Intergenic
984611145 4:181839648-181839670 TTTTAGATCGAGAAGTTTGGGGG + Intergenic
985431486 4:189885563-189885585 AATTAGGTTGAGAAGTTTGGGGG - Intergenic
990143569 5:52732943-52732965 ATTTAGCTGGAGGAGGCTGGTGG - Intergenic
991610354 5:68443278-68443300 AGTTAACTAGAGAAGTTTAGGGG - Intergenic
991709440 5:69393856-69393878 ATTTAGAGACAGGAGTGTGGTGG - Intronic
995427113 5:112037628-112037650 TTTTAGCTTAAGGAGTTTTGGGG - Intergenic
995721777 5:115142795-115142817 ATTTATCTAAAGGAGTTAAGAGG - Intronic
997041435 5:130260101-130260123 ATTTAACTAGATAAGTCTGGGGG - Intergenic
1001997539 5:176174431-176174453 ATTTCTCAAGATGAGTTTGGAGG - Intergenic
1005358099 6:25004304-25004326 ATTTAGTTACATGACTTTGGTGG - Intronic
1005634716 6:27742255-27742277 ATTGACCTAGATGAGTTTGTAGG + Intergenic
1006206829 6:32352281-32352303 ATTTGGAAAGAGTAGTTTGGAGG + Intronic
1006560563 6:34908143-34908165 ATAGTGCTGGAGGAGTTTGGAGG + Intronic
1007079781 6:39091505-39091527 ATTTAATTAGAGAAGTTGGGTGG + Intergenic
1009698243 6:67138855-67138877 ATTTAGCTAGCATATTTTGGTGG - Intergenic
1012160625 6:95880740-95880762 ATTTATTTAGAGGAATTTGAAGG + Intergenic
1012771899 6:103448819-103448841 ATTTAACCAGGTGAGTTTGGTGG + Intergenic
1013345128 6:109252817-109252839 ATTTAGCAGGAGGAGTTTGTGGG - Intergenic
1016821169 6:148347864-148347886 ATTTAGAGAGAAGGGTTTGGAGG + Intronic
1020402760 7:7796877-7796899 TTTTCCCCAGAGGAGTTTGGGGG - Intronic
1020748245 7:12106059-12106081 ATTTAATTAAAGGAGTTTGAAGG + Intergenic
1021562853 7:21986311-21986333 ATTTAACCTGGGGAGTTTGGAGG - Intergenic
1025174893 7:56794131-56794153 ACTTAGCTAGATGTGGTTGGTGG + Intergenic
1025572728 7:62597137-62597159 CTTTTGATAGAGCAGTTTGGAGG - Intergenic
1025696910 7:63782283-63782305 ACTTAGCTAGATGTGGTTGGTGG - Intergenic
1029483037 7:100824371-100824393 TCTGAGCTAGAGGAGTTGGGGGG + Intronic
1030827900 7:114184437-114184459 TTTTAGCTATAGGACATTGGGGG + Intronic
1031484394 7:122310545-122310567 ACTTAGCTCGAGAAGCTTGGAGG + Intronic
1033069796 7:138191616-138191638 CTTTGGCTAAATGAGTTTGGGGG + Intergenic
1033167235 7:139050795-139050817 ACTTACCTAGAAGTGTTTGGAGG - Intronic
1036255330 8:7201752-7201774 ATTGAGCTTGAGGATGTTGGGGG - Intergenic
1036362159 8:8085744-8085766 ATTGAGCTTGAGGATGTTGGGGG + Intergenic
1036514520 8:9431372-9431394 ATTTGGCTGTAGGAGTTTCGGGG - Intergenic
1039511992 8:38099389-38099411 TTTTAGCTAGAGAAGTTTCAGGG - Intergenic
1039775650 8:40733494-40733516 AATTAACTAGAGTTGTTTGGGGG + Intronic
1041548682 8:59076173-59076195 ATTTAGCTGGAGGAATTCAGTGG + Intronic
1046254229 8:111675159-111675181 TATTAGCTTAAGGAGTTTGGGGG + Intergenic
1046551264 8:115720171-115720193 ATTAAGCTAGAGAAGTATGTCGG - Intronic
1047549231 8:125851635-125851657 ATTTAGCAAGAGGAAGCTGGTGG + Intergenic
1050471643 9:5998049-5998071 TTTTGGCTAGAGCAATTTGGTGG + Intronic
1050584845 9:7099958-7099980 ATTTATCTTGAGGAGTTTGGGGG + Intergenic
1051823466 9:21193568-21193590 GTTTAGCCAGAGGAGTGGGGTGG - Intergenic
1051825286 9:21212105-21212127 GTTTAGCCAGAGGAGTGGGGTGG - Intronic
1051827265 9:21234165-21234187 GTTTAGCCAGAGGAGTGGGGTGG - Intronic
1052441418 9:28500612-28500634 AGTAAAATAGAGGAGTTTGGAGG + Intronic
1052743735 9:32418816-32418838 ATTTTGATACAGGTGTTTGGGGG + Intronic
1053720657 9:40943608-40943630 AATTAGGTTGAGAAGTTTGGGGG - Intergenic
1054345330 9:63908547-63908569 AATTAGGTTGAGAAGTTTGGGGG + Intergenic
1055852602 9:80650281-80650303 ATTCAGCGAAAGGTGTTTGGAGG + Intergenic
1056078869 9:83069354-83069376 ATTGAGCAAGAGTAGGTTGGTGG - Intergenic
1056167756 9:83955484-83955506 ATTCTGCTGGAGAAGTTTGGAGG - Exonic
1056205235 9:84313521-84313543 AAATACCTAGAGGAATTTGGAGG + Intronic
1057099714 9:92346761-92346783 ACTTAGCTAGATGGATTTGGGGG + Intronic
1058658553 9:107247882-107247904 GTTTGCCTAGAGGAGTGTGGCGG - Intergenic
1058781060 9:108335993-108336015 AGTTACCTTGTGGAGTTTGGTGG - Intergenic
1059497670 9:114722971-114722993 ATCTAGCAAGAGGCATTTGGAGG - Intergenic
1060666292 9:125434016-125434038 ATTTAGGCAGAGGTGTTTGGTGG + Intergenic
1186852234 X:13591921-13591943 CTTCAGATAGAGAAGTTTGGGGG + Intronic
1195018234 X:100799432-100799454 CTTTTGCTAAATGAGTTTGGGGG - Intergenic
1198958315 X:142156485-142156507 ATTTAGCTTGTGGAGTTTCCTGG - Intergenic
1200007518 X:153097562-153097584 ATATAGCTGGAGGAGTTGAGGGG + Intergenic