ID: 1129565999

View in Genome Browser
Species Human (GRCh38)
Location 15:76624636-76624658
Sequence TTCCTCAGTGATTTATAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129565999 Original CRISPR TTCCTCAGTGATTTATAGTA GGG Intronic
905288416 1:36903223-36903245 TTCCTCAATGACATATAATATGG - Intronic
907428034 1:54393421-54393443 GTTCTCAGTGATTGATAATAAGG - Intronic
908488559 1:64619510-64619532 TTTGTCAGTATTTTATAGTATGG + Intronic
908690379 1:66773074-66773096 ATTCTTAGTGATCTATAGTAAGG - Intronic
908930803 1:69314673-69314695 TTCCTCAGTGGTTTATGGTATGG + Intergenic
909150508 1:71996968-71996990 TCTCTTAGTGAATTATAGTAGGG - Intronic
910364579 1:86450889-86450911 ATCCTCAGTGATTCATGGTAGGG + Intronic
911083419 1:93956501-93956523 TTCCTCAGTGGCTTAGAGTGTGG + Intergenic
911269404 1:95782131-95782153 TTCCTCAGTGATGTGTAATATGG + Intergenic
911953790 1:104210555-104210577 TTCTTCAGTGATTTATTTTCTGG - Intergenic
913060287 1:115198147-115198169 TCCCTCACTGAACTATAGTAAGG + Intergenic
916559301 1:165919251-165919273 TCCCTCAGTGATGTTCAGTATGG - Intergenic
917894714 1:179476507-179476529 TTCCTCTAGGATTTATTGTAAGG + Intronic
918072596 1:181143909-181143931 TTCCTCAGTATTTTATACTTAGG + Intergenic
919774919 1:201188230-201188252 TTCCTCAGTGCCTTATGGAAAGG - Intergenic
923239209 1:232064083-232064105 TTCCTCTGTGATTTAAAGCAGGG - Intergenic
923799563 1:237194366-237194388 TTTCTCACTCATGTATAGTACGG - Intronic
1065152480 10:22836361-22836383 TTACTAAGGGATTTATATTATGG - Intergenic
1066202473 10:33155086-33155108 TTCCCCAGAGATTGCTAGTAAGG - Intergenic
1066620478 10:37344493-37344515 TTCCTCAGTGCATTACAGTGTGG + Intronic
1066623740 10:37385030-37385052 TTCCTCAGTGTGTTACAGTGTGG + Intergenic
1068023561 10:51616098-51616120 TTCCTCAGTGACTTACGATATGG + Intronic
1068036394 10:51765191-51765213 TCCCTCAGTGATTCATTCTATGG - Intronic
1068390321 10:56387389-56387411 TTCATCAGTTTTTTAAAGTAGGG + Intergenic
1070970083 10:80556758-80556780 TTAATCAGTGATTTTTAGCAAGG - Intronic
1071009716 10:80923831-80923853 TTCCTCAGTGGTTTGGATTATGG - Intergenic
1071089152 10:81898535-81898557 TTTGTCAGTAATTTTTAGTATGG + Intronic
1071367084 10:84910293-84910315 TTCCTCATTTATTTTTAGAAAGG + Intergenic
1071914173 10:90272488-90272510 TTCCTCAGTGATATATTGGAGGG + Intergenic
1072104367 10:92259872-92259894 TACCTCATAGATTTATTGTATGG - Intronic
1075372781 10:121951877-121951899 TTCCTAAGTGCTTTCTGGTAAGG - Intergenic
1075613395 10:123871872-123871894 TTTCTTATTGATTTATAGGAGGG - Intronic
1078185916 11:9052081-9052103 TTCCTCAGAGGGTTGTAGTATGG + Intronic
1079533825 11:21486329-21486351 TTCCTCAGTGGCTTAGGGTATGG - Intronic
1083518133 11:63279426-63279448 TTCCTCAGTGAAATCCAGTATGG + Intronic
1084345818 11:68548105-68548127 TTCCTATGTGCTTTATAATAAGG - Exonic
1086800186 11:91163658-91163680 TTGCTGAATGATTTATAGGAGGG + Intergenic
1092514607 12:9196167-9196189 TTCATCAGTGATATTTAGAAAGG + Intronic
1093504369 12:19847945-19847967 TTTCTCAGTGATTTATTCAAGGG - Intergenic
1095549840 12:43421567-43421589 TTTCTCATTCATATATAGTAAGG - Intronic
1097661643 12:62436532-62436554 TTCCTCAGTGGTTTAGGGTTGGG - Intergenic
1100891072 12:99126515-99126537 TTACTCAGTGATTCAGAGCAGGG - Intronic
1101481932 12:105106975-105106997 CTCTTCAGTGATTCGTAGTATGG + Intergenic
1106611653 13:31288598-31288620 TTCCTCAGTGGCTTAGGGTATGG - Intronic
1110398655 13:75064148-75064170 TTCCTGAGTGCTTTATATTTTGG - Intergenic
1110413434 13:75227518-75227540 TTGCTCAGTGAATTAACGTATGG - Intergenic
1110557884 13:76881149-76881171 TTTTTAAATGATTTATAGTAAGG + Exonic
1111923481 13:94437747-94437769 TTCATAATTGATTTATTGTAAGG + Intronic
1112787142 13:102963603-102963625 TTCCTCACAGAATTATAGTTTGG - Intergenic
1115358283 14:32473052-32473074 TTCCACAGGGATTTATATTTAGG - Intronic
1115508499 14:34116218-34116240 TTCCCCAATGATTCATAGTTTGG + Intronic
1115774767 14:36703042-36703064 TTCCCCAGTGGTTTCTAGAAAGG + Intronic
1119275092 14:73348151-73348173 TTCCTCAGTCAGATATAGCAGGG - Intronic
1120253223 14:82085818-82085840 TTACTCATTGATTTAAATTAAGG - Intergenic
1123411214 15:20061369-20061391 TGACTCAGGTATTTATAGTAGGG + Intergenic
1126490244 15:49229254-49229276 TTCCTCAGTGACTTAGGATATGG + Intronic
1127086072 15:55425554-55425576 TTACTCAGTAACTTATAATAAGG - Intronic
1127428451 15:58878746-58878768 TTCTTCACTGATTTATATAAAGG + Intronic
1129565999 15:76624636-76624658 TTCCTCAGTGATTTATAGTAGGG + Intronic
1130166068 15:81460601-81460623 TTCCTCAGTGGCTTAGGGTATGG + Intergenic
1130755871 15:86762557-86762579 TCCCTCAGAGCTTTATAGTAAGG - Intronic
1132923731 16:2415801-2415823 TTTCTCACTGATTTATATGATGG - Intergenic
1133275734 16:4637489-4637511 TTCCTAAGTGCTTTTTATTATGG + Intronic
1140649098 16:77067054-77067076 TTCCTACGTGATTTATGGTCTGG - Intergenic
1141247619 16:82324649-82324671 TTCCTCAGTGATGTAGACTGTGG + Intergenic
1144314255 17:14044581-14044603 TTCCACAGTGACATATAGTGTGG + Intergenic
1145071668 17:19814881-19814903 TTCCCTACTGATTTATAGTTGGG - Intronic
1145084019 17:19920237-19920259 ATCCTAAGTAATTTAAAGTAGGG + Intronic
1146526876 17:33574397-33574419 TTTCTTATTGATTTATAGCAGGG + Intronic
1148626567 17:49073883-49073905 TTCCTCACTGATAAATAGTTTGG + Intergenic
1153098960 18:1442670-1442692 TTCCTGAGAGATTTCTTGTATGG - Intergenic
1154096947 18:11426692-11426714 TTCCTAACTGATATATAGAAAGG + Intergenic
1156189315 18:34700072-34700094 TTTCTCTGTGATCTATAGTTGGG - Intronic
1157543003 18:48525462-48525484 GTCCTCAGGGATTTTTAGTTTGG + Intergenic
1159386251 18:67729006-67729028 TTTCTCAGTGCTTGCTAGTATGG + Intergenic
1164966205 19:32487020-32487042 TTCTTCCGTGAGTTATAGTCAGG + Intergenic
930924174 2:56796382-56796404 GTTTTCAGTGATTTATAGTGTGG + Intergenic
931551451 2:63450696-63450718 TTCCTCAGTGGTTTAGGGTGTGG - Intronic
932744855 2:74325679-74325701 TACCTCACTGAATTATAGTGAGG - Intronic
935357521 2:102217119-102217141 TTCCTTAGGGATTTCTTGTAAGG + Intronic
939945294 2:148402019-148402041 GTTCTCGGTGCTTTATAGTAGGG + Intronic
940225518 2:151397147-151397169 TTCCTCAGTGAATCATATCAGGG + Intergenic
940749572 2:157611314-157611336 TTCCTCAGTGAGTTAGAGTATGG + Intronic
941336965 2:164257921-164257943 TTCCTCAGTGAGCTATACCACGG - Intergenic
942745805 2:179230582-179230604 TTCCTCAGTGCCTTTTATTAAGG - Intronic
943656631 2:190515853-190515875 TTCATTAGTAATTTATAGTTAGG + Intronic
944188634 2:196977672-196977694 TTCCTCATTTATTTTTATTATGG - Intronic
945866419 2:215181817-215181839 TTCCTCAGTGTCTTAGGGTATGG + Intergenic
945971396 2:216234930-216234952 TTGCTCAGTGATTGAAAGAATGG + Intergenic
1169913343 20:10664928-10664950 TTCCTTCGTAATTTACAGTAAGG + Intronic
1171559896 20:26114340-26114362 TTCCTCAGACATTTGTAGAAAGG - Intergenic
1172728469 20:37065973-37065995 TTCCTCAGATATCTATATTATGG - Intronic
1174591856 20:51652224-51652246 TTCCTCCGTGACTTACTGTACGG + Intronic
1174854502 20:54030167-54030189 TATTTCACTGATTTATAGTAGGG - Intronic
1177437322 21:21072298-21072320 TTTCTCAGTAATATATTGTAAGG + Intronic
1178018666 21:28382833-28382855 TGCCTCAGTTATTTACAGTTTGG + Intergenic
1178235361 21:30835336-30835358 TTCTTCACTGTTTTATAGGAAGG - Intergenic
1179282054 21:39942118-39942140 TTCTTAAGGGATCTATAGTAGGG - Intergenic
1180657354 22:17434056-17434078 TCCCCCAGTGTTTTAAAGTAAGG + Intronic
952453083 3:33449493-33449515 AACCTCAGTGTTTTATAATAGGG + Intergenic
955809702 3:62774490-62774512 GTCCTCAGTGATTTTTAAGAGGG - Intronic
956675365 3:71726963-71726985 TTCCTCATTGGCTTATTGTAAGG - Intronic
956966003 3:74461470-74461492 TTACTGATTGATTTATATTAAGG + Intronic
957290004 3:78267966-78267988 TTCCTCAGTGGCTTAGGGTATGG + Intergenic
957984458 3:87555681-87555703 TTACTCAGTTCTTTATAGTTGGG - Intergenic
958846961 3:99276585-99276607 TTCATCAGTGTTTTATAGTTTGG + Intergenic
959449245 3:106479709-106479731 GTCCTCAGTAATTTATATTGTGG + Intergenic
959926670 3:111929656-111929678 GTCCTCTGTGATTTATAGCCAGG + Intronic
960205567 3:114893275-114893297 TTCCTCTGTGCTGTATAATAAGG - Intronic
962956034 3:140267715-140267737 AACCTCAGTGATTTCTAGTTTGG + Intronic
965259447 3:166462011-166462033 TTGCTCAGTCAATTATCGTATGG - Intergenic
965533371 3:169799282-169799304 ATTCTCAGTGATTCATACTAAGG + Intronic
966499667 3:180625767-180625789 TTCCTCAGTGACTTAAGGTATGG + Intronic
966584432 3:181605500-181605522 TTCCTTAGTGATTTTTAATTTGG - Intergenic
967096194 3:186179385-186179407 ATCCTCAGTCCTTTACAGTAGGG - Intronic
967437088 3:189460116-189460138 TTCTTTAGTAATGTATAGTAAGG + Intergenic
967674047 3:192274821-192274843 TTCCACAGTGATTGATATGAAGG - Intronic
969328353 4:6457257-6457279 TTCCTCATTGATTATTAGGATGG - Intronic
970672571 4:18413666-18413688 TTCCTCACAAATTTATTGTATGG + Intergenic
970785987 4:19796993-19797015 TTCCTCTGTCATTTCTATTATGG - Intergenic
970830546 4:20334707-20334729 TACCTCAGTTTTTCATAGTATGG + Intronic
971081062 4:23211958-23211980 TTCCTCATTGATTTATCATGGGG - Intergenic
971103892 4:23500070-23500092 GACCTCAGTGATTTATTGGAAGG + Intergenic
972040037 4:34582125-34582147 TTCCTCAGTGATATATAAAGTGG + Intergenic
972212255 4:36853076-36853098 TTTCTCAGTGATTTGTGATAAGG - Intergenic
972691502 4:41403228-41403250 TTCCTGGTTGATTTATAGCATGG + Intronic
977568123 4:98602573-98602595 TTCCTCAGGGATTTAGAGTAGGG - Intronic
977875750 4:102148115-102148137 TTTCTCTATGATATATAGTATGG + Intergenic
978901529 4:113955944-113955966 TTTCTGAGTTATTTGTAGTATGG + Intronic
979741085 4:124151924-124151946 TTCCTCACTCATATATAGTGTGG + Intergenic
981558812 4:146024675-146024697 TTCTTCAGTGATTTGTACCATGG + Intergenic
981727779 4:147865938-147865960 CTCCTCATTGAGTTATAGTGTGG - Intronic
981868984 4:149463567-149463589 TTCCTCAGGGATTCAGAATATGG - Intergenic
984332564 4:178344006-178344028 TTCTTCAGTGATTTTTATTTGGG - Intergenic
986431968 5:7690598-7690620 ATCCTCACTGATTTGTAGGAAGG - Intronic
986820833 5:11464940-11464962 TTCCTCAGTTATTGTGAGTATGG + Intronic
992171486 5:74106044-74106066 TTCCTCACTGATGTAGATTAAGG - Intergenic
992528517 5:77633720-77633742 TTTCTCAGTCATTTATAGCTGGG - Intronic
992607778 5:78478062-78478084 TTACTCAGTGATTTGTAATTTGG + Exonic
994861756 5:105204483-105204505 TTGCTCAGTTTTTTATATTATGG - Intergenic
995340369 5:111051945-111051967 TACCTCAGTGAATCATAGTGAGG + Intergenic
995441314 5:112195413-112195435 TTCTGCAGTGGTTTATAATATGG + Intronic
995906434 5:117129460-117129482 TTCTCCAGTGATTGATAATAGGG + Intergenic
1004055272 6:12130152-12130174 TTTCACATTGATTTACAGTAAGG + Intronic
1006587324 6:35124484-35124506 TTACCCAGTGTTCTATAGTAAGG - Intronic
1007938364 6:45753968-45753990 TTCCTCAGAGAATGATGGTAGGG + Intergenic
1008971066 6:57368823-57368845 AACCTCAGTGACTTATAGAAAGG + Intronic
1009160028 6:60270642-60270664 AACCTCAGTGACTTATAGAAAGG + Intergenic
1009385900 6:63083935-63083957 AACCTCAGTGTTCTATAGTAGGG - Intergenic
1012792551 6:103715579-103715601 TTCCTCTGTCAAATATAGTAAGG + Intergenic
1013292843 6:108733346-108733368 TTCCTCAGTGGTTAATCTTAGGG + Intergenic
1014822340 6:126004788-126004810 TTTCTCAGGGATATAGAGTAGGG + Intronic
1014917116 6:127164159-127164181 TGCCACAGTGATTCAAAGTAGGG - Intronic
1016143805 6:140645255-140645277 TACCTCAGTGACTTATAGATAGG - Intergenic
1016626714 6:146179090-146179112 TTCGCCAGTGGTTTATAGTCTGG - Intronic
1019626983 7:2021020-2021042 TTCCTCAGTGCATTTTAGTACGG - Intronic
1019856560 7:3614295-3614317 TTCCTTAGTAATTTATTCTAGGG + Intronic
1021088986 7:16458868-16458890 TTCAGTAGTGATTTATAGGATGG + Intergenic
1023504334 7:40884549-40884571 TTCCGCAGTGATTGATATTAAGG + Intergenic
1024830949 7:53456178-53456200 CTTCTGAGTGATTTATAGCATGG + Intergenic
1025277835 7:57599414-57599436 TTCCTCAGACGTTTATAGAAAGG + Intergenic
1026112243 7:67467719-67467741 TTCCTCCATGATTTATAATGTGG + Intergenic
1028635869 7:92988806-92988828 TTTCTGTGTGAATTATAGTATGG + Intergenic
1029714274 7:102317566-102317588 TCCCTCAGTGATGTGTAGGAGGG - Intronic
1030571471 7:111230353-111230375 TTCCTGTGTGATCTAAAGTATGG - Intronic
1030852856 7:114512571-114512593 TTGCTCAGTGATTTCTGATAGGG + Intronic
1030934391 7:115567108-115567130 TTCTTCTGTTATTTATAGCATGG - Intergenic
1031122254 7:117735128-117735150 ATCCTCAGTGAGTTATGTTATGG + Intronic
1031211468 7:118833710-118833732 TTAATAAGTGATTTTTAGTAAGG + Intergenic
1031762882 7:125736403-125736425 TTCCTCAGTGATATAGGGTTAGG + Intergenic
1032779908 7:135157354-135157376 TTCCTCAGTGGGATAGAGTATGG + Intronic
1033968662 7:147010612-147010634 TTATTCAGTGAGTTATAATACGG - Intronic
1037089627 8:14897850-14897872 TTCCTGAGTGATTGGTAGAAAGG - Intronic
1042708822 8:71692512-71692534 TGCCTCATAGATTTATTGTATGG + Intergenic
1044945964 8:97390479-97390501 TTCATGAGTGATTTAGAGTAAGG - Intergenic
1045019923 8:98033356-98033378 TTCCTCAGTAATCCACAGTAAGG + Intronic
1046700077 8:117390698-117390720 TTCCTCAGTTATTTCTACTTTGG - Intergenic
1049045842 8:140150858-140150880 TTCCTCAGTGACTTCAAATAAGG + Intronic
1052152581 9:25136418-25136440 TTCCTCAATGTTTTATAACATGG + Intergenic
1055300163 9:74874497-74874519 GTCCTCAGTGACTTAAAGAAAGG - Intronic
1056002518 9:82231596-82231618 TTCCTTAGTAATTTATGGTGTGG - Intergenic
1056673942 9:88656946-88656968 TTCCTCACAGAGTTATAGTGGGG + Intergenic
1058642524 9:107101274-107101296 AACCTCAGATATTTATAGTAAGG + Intergenic
1058811107 9:108640393-108640415 TTTGTCATTGAATTATAGTATGG + Intergenic
1060127957 9:121067945-121067967 TTACTCAGTTCTTTATAGTAGGG + Intergenic
1185853967 X:3516425-3516447 TTCATCACTTAATTATAGTACGG + Intergenic
1186732489 X:12424934-12424956 TTACTGAGGGATTTAGAGTAAGG - Intronic
1193636292 X:83953372-83953394 TTCATCAGTGTTTTGTAGTTTGG - Intergenic
1193777013 X:85656137-85656159 TTCCTCATTAATTTTTTGTATGG + Intergenic
1196207313 X:112955666-112955688 TTCCTTTGAGATTTATAGGACGG + Intergenic
1196319856 X:114273407-114273429 TTCCTCAGGGATTAATAGGTTGG + Intergenic
1198152428 X:133923958-133923980 TTCCTGGGCGATTTATAGGACGG - Intronic
1198795364 X:140388892-140388914 TTGCACAGTGGTTTATAGTATGG - Intergenic
1200752190 Y:6956653-6956675 TTCCTCAGTGGTCCATAGGAGGG - Intronic
1200752203 Y:6956725-6956747 TTCCTCAGTGGTCCATAGGAGGG - Intronic
1200959335 Y:8982727-8982749 TTCCTCGATGTTTTATAATAGGG + Intergenic
1201296868 Y:12471225-12471247 TTCCTCAGTGGTCCATAGGAGGG + Intergenic
1201296881 Y:12471297-12471319 TTCCTCAGTGGTCCATAGGAGGG + Intergenic
1201955617 Y:19619244-19619266 TTCCTCAGGGGTATATAGTGTGG - Intergenic