ID: 1129567597

View in Genome Browser
Species Human (GRCh38)
Location 15:76639972-76639994
Sequence CTGTAGCCATACATAGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 4, 2: 6, 3: 6, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129567593_1129567597 -2 Left 1129567593 15:76639951-76639973 CCAGAGAAGGTATTTGGCTCCCT 0: 3
1: 6
2: 5
3: 19
4: 136
Right 1129567597 15:76639972-76639994 CTGTAGCCATACATAGGCCTTGG 0: 1
1: 4
2: 6
3: 6
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129567597 Original CRISPR CTGTAGCCATACATAGGCCT TGG Intronic
904053743 1:27656723-27656745 CTGTACCCATTTGTAGGCCTGGG - Intergenic
905847462 1:41244355-41244377 CTGTAGCCTTAGATAAGGCTTGG + Intergenic
905868773 1:41391251-41391273 ATGTAGCCATGCAGATGCCTGGG + Intergenic
906561271 1:46758924-46758946 CAGTAATCATATATAGGCCTGGG - Intronic
908382424 1:63609281-63609303 CTGCAGCAAGACATTGGCCTGGG - Intronic
911160782 1:94680799-94680821 CTGTTGCCATAAACAGGCTTGGG - Intergenic
911683617 1:100747575-100747597 ATTTAGCCAAACAGAGGCCTAGG + Intergenic
912435568 1:109658730-109658752 CTGGGGCCATACACAGCCCTGGG + Intronic
912494182 1:110080702-110080724 TTGTAGCCCTACATATGCTTTGG + Intergenic
915400789 1:155620224-155620246 CTCAAGCCATCCATCGGCCTTGG + Intergenic
916767574 1:167876372-167876394 CAGTATCCAAACATAGGCCAGGG + Intronic
924283192 1:242458823-242458845 CCGTAGCCTTACACAGGCCTTGG + Intronic
1063554615 10:7066394-7066416 CAGTACCCATCCATAGCCCTGGG + Intergenic
1065574268 10:27102379-27102401 CTTTAGCCTTAGATAGGCATGGG - Intergenic
1068757095 10:60668340-60668362 AAGTAGCTATTCATAGGCCTGGG + Intronic
1072077160 10:91988539-91988561 CTGTAGCCTTAGATAGCTCTTGG + Intronic
1072456013 10:95576649-95576671 CTCAAGCGATCCATAGGCCTTGG - Intergenic
1077425812 11:2476415-2476437 CTGTAGCTATAAATTTGCCTCGG - Intronic
1077526104 11:3066456-3066478 CTCAAGCAATCCATAGGCCTTGG + Intergenic
1078323407 11:10357754-10357776 CTGTAGACTTCCATAGGCCATGG + Intronic
1079321943 11:19458436-19458458 GTCTAGCCATGCATATGCCTTGG + Intronic
1081399478 11:42626187-42626209 CTGTAGCATTACAGAGGCCCTGG - Intergenic
1081450162 11:43163336-43163358 CTGTAGCCTTACATAGGCCTCGG - Intergenic
1083067280 11:59938359-59938381 CTGAAGCCACACATAGGTGTGGG - Intergenic
1086957155 11:92945191-92945213 CTGTAGCCTTACATGGGCCTTGG - Intergenic
1087934801 11:104020128-104020150 CTGAAGCAATAAATCGGCCTAGG - Intronic
1091538081 12:1432421-1432443 CACTAGCCATCCACAGGCCTTGG + Intronic
1093688272 12:22081369-22081391 CTGGAGCCATCCATCCGCCTTGG + Intronic
1095093408 12:38128504-38128526 CCATAGCCTTACATAGGCCTTGG + Intergenic
1096258185 12:50075239-50075261 CTGCAGGCATACAGGGGCCTGGG + Intronic
1099494124 12:83324066-83324088 CTGCAGCCTTACATAGTGCTTGG - Intergenic
1100042126 12:90332640-90332662 CTGTGGTCATACCTGGGCCTAGG + Intergenic
1100242370 12:92722354-92722376 TTGTAGCCATGCAGAGACCTAGG - Intronic
1101415534 12:104505031-104505053 CTGTAGCCAAACCCAGACCTTGG + Intronic
1103125341 12:118417134-118417156 CTGTAGCCATACCAAAGCCAGGG + Exonic
1104931547 12:132341822-132341844 CTGTGGCCAGGCATAGGCCAGGG + Intergenic
1109781771 13:67120109-67120131 CTATAAACATACATAGGCTTGGG - Intronic
1113961380 13:114128168-114128190 GTGTGGCCACACATGGGCCTTGG - Intronic
1121735764 14:96216964-96216986 GGGTAGCTATACATAGCCCTAGG + Intronic
1123156459 14:106232002-106232024 CAGGAGCCAGACATAGGACTGGG - Intergenic
1123207206 14:106725093-106725115 TTGGAGCCAGACATAGGACTGGG - Intergenic
1123212230 14:106772096-106772118 TTGGAGCCAGACATAGGACTGGG - Intergenic
1123629611 15:22252711-22252733 CTCAAGCCATACACTGGCCTCGG - Intergenic
1129567597 15:76639972-76639994 CTGTAGCCATACATAGGCCTTGG + Intronic
1129805005 15:78448600-78448622 CTCTAGTCAGACATAGGCATGGG + Intronic
1132582833 16:693407-693429 CTGTAGCCACCCTCAGGCCTGGG - Exonic
1135200628 16:20434723-20434745 ATATAGTCATACATAGGCTTTGG + Intronic
1136297321 16:29311129-29311151 CTGTAGCCAGCCCTGGGCCTTGG + Intergenic
1137962585 16:52897920-52897942 CTGTAGCCAGAGAAAGCCCTTGG - Intergenic
1139052746 16:63145757-63145779 CTGGAGCAATTTATAGGCCTGGG - Intergenic
1140121909 16:72091234-72091256 CTGTACCCATCCCTAGGCCATGG + Intronic
1143622068 17:8086423-8086445 CTGGAGTCCTACATAGCCCTGGG - Intronic
1158659947 18:59377903-59377925 GGGCAGCCATACATTGGCCTTGG - Intergenic
1164947833 19:32311218-32311240 CTTTGGCAATACATAGGCTTGGG + Intergenic
925387424 2:3471961-3471983 CTGTGGCCAGTCCTAGGCCTCGG + Intronic
926488681 2:13496373-13496395 CTGTAGCCATTCATATTTCTGGG - Intergenic
933356995 2:81223317-81223339 ATGTAGGTATACATAGGCCATGG - Intergenic
935248847 2:101243477-101243499 TCGTAGCCTTACATAGGCCTTGG + Intronic
936432475 2:112476560-112476582 GTGTAGGCACCCATAGGCCTGGG - Intergenic
939965566 2:148607013-148607035 GTGAAGGCAAACATAGGCCTGGG + Intergenic
941894674 2:170617281-170617303 CTGTAGCCTTACATAGGCCTTGG - Intronic
944494350 2:200291251-200291273 CTGAAGCCATTCTTAGGCCAGGG - Intergenic
946542219 2:220697280-220697302 CTGTAGTCATCTCTAGGCCTGGG + Intergenic
1168862889 20:1058738-1058760 CTGTAGCCATCCCTAGGCCTTGG + Intergenic
1173046578 20:39518224-39518246 CTGAAGCCATAAATAAGGCTGGG - Intergenic
1174361592 20:50032170-50032192 CAGTAGACATTCACAGGCCTGGG + Intergenic
1174362075 20:50035154-50035176 CAGTAGACATTCACAGGCCTGGG + Intergenic
1176106148 20:63388777-63388799 CTGGAGGCATCCATTGGCCTGGG + Intergenic
1179401454 21:41087848-41087870 CTGGAGCCATCCATAAGCCCAGG - Intergenic
1181609905 22:24005404-24005426 CTCTGGCCAGACATAGGCCCAGG - Intergenic
1182573957 22:31260215-31260237 CTGTAACCGTACCTGGGCCTTGG + Intronic
950447874 3:13048530-13048552 CTGTGGCCAAACATAGGCCCAGG - Intronic
956793515 3:72698526-72698548 CTGTTGCAATCCACAGGCCTAGG - Intergenic
959043070 3:101441287-101441309 CTGTAGCCATCCATAGTGGTGGG - Intronic
963787706 3:149551722-149551744 CTATGGCCATCCATAGACCTAGG + Intronic
965192288 3:165547303-165547325 CCGTAGCCTTACATAGGCCTTGG + Intergenic
968217168 3:196902823-196902845 CAGTAACCATAAAAAGGCCTTGG - Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
971924097 4:32984308-32984330 CTGTAGCCATACCTAAGTCATGG + Intergenic
977190046 4:93988061-93988083 ATGTAGACAAACATAAGCCTTGG - Intergenic
978544540 4:109857007-109857029 CTGTAGCCTTACATAGGCCTTGG - Intronic
981197864 4:141941926-141941948 ATATAGACATATATAGGCCTAGG + Intergenic
983198848 4:164838596-164838618 CTGTAGTCATCAAAAGGCCTGGG - Intergenic
988774200 5:34462532-34462554 CCATAGCTTTACATAGGCCTTGG - Intergenic
990709651 5:58565823-58565845 CTGTAGCCATCCACTTGCCTTGG - Intergenic
991514501 5:67419774-67419796 CTGAAGCAATACATCTGCCTTGG + Intergenic
992504801 5:77376193-77376215 CTGCAGCCATCCCTAGTCCTAGG - Intronic
994324301 5:98431629-98431651 TTGTAGACTTCCATAGGCCTGGG + Intergenic
995632019 5:114144550-114144572 CCGTAGCCTTACATAGGCCTTGG - Intergenic
1000248016 5:159465913-159465935 CTGTGGCCATTCAAAGGGCTAGG + Intergenic
1001231623 5:169993763-169993785 CTGTAGCCAGACAAAGCCCAGGG - Intronic
1001941614 5:175743676-175743698 GTGAAGCCAAACATGGGCCTCGG + Intergenic
1002641102 5:180631002-180631024 CTGTGGCCAAGCACAGGCCTTGG + Intronic
1002947024 6:1772031-1772053 CTGTAGCCTTACTGAGGTCTGGG + Intronic
1003137853 6:3446748-3446770 CTGTAGCCACCCATAGGCAGAGG - Intronic
1008178509 6:48298704-48298726 CTGAAGCTATAGAAAGGCCTTGG - Intergenic
1008272149 6:49502856-49502878 CCGTAGCCTTACATAGGCCTTGG - Intronic
1014405708 6:121047727-121047749 CTGTAGCCTTACATAGGCCTTGG + Intergenic
1016878997 6:148891607-148891629 CTGGAGCTATACACAGCCCTGGG - Intronic
1017725357 6:157273200-157273222 CTGTAGGCAGACCTAGGCTTCGG + Intergenic
1027839093 7:83284318-83284340 CTGGAGCAAGTCATAGGCCTGGG - Intergenic
1033736795 7:144230203-144230225 CTCTAGCCAAAGATAGGCATTGG - Intergenic
1033746262 7:144320747-144320769 CTCTAGCCAAAGATAGGCATTGG + Intergenic
1035054274 7:156023502-156023524 CTGGAGCCATCAAAAGGCCTTGG + Intergenic
1037932955 8:22894336-22894358 CTGAAGCCATCCATCTGCCTTGG - Intronic
1043257540 8:78155517-78155539 CTATTTTCATACATAGGCCTTGG + Intergenic
1049945047 9:586296-586318 CTGTAACCTTGAATAGGCCTGGG - Intronic
1056713326 9:89009134-89009156 CTGGAGCCATGCAAGGGCCTGGG - Intergenic
1188991867 X:36830644-36830666 CTGTAGGAAAACATAAGCCTGGG - Intergenic
1195506835 X:105667787-105667809 CCGTAGCCTTACACAGGCCTTGG - Intronic
1196195109 X:112831407-112831429 CTGTAGCCAGACATTGTGCTAGG + Intronic
1200857405 Y:7954080-7954102 CTGTAGTCTTACATAGGCCTTGG - Intergenic
1201622425 Y:15974977-15974999 CTGTAGACTTACATAGGTCTTGG - Intergenic